A method for preventing an animal model of temporomandibular joint osteoarthritis by knocking out a FAM20C gene

Abstract

This invention proposes a method for constructing an animal model for the prevention of temporomandibular joint osteoarthritis (TMJ) by knocking out the FAM20C gene, belonging to the field of pharmaceutical technology. It solves the problem of providing effective treatment and prevention methods for TTMJ osteoarthritis. It includes the application of the FAM20C gene in the preparation of drugs for the prevention or treatment of TTMJ osteoarthritis. It is mainly used for the prevention or treatment of TTMJ osteoarthritis.

Description

Technical Field

[0001] This invention belongs to the field of pharmaceutical technology, and in particular relates to a method for constructing an animal model for preventing temporomandibular joint osteoarthritis by knocking out the FAM20C gene. Background Technology

[0002] Temporomandibular joint osteoarthritis (TMJOA) is a disease characterized by degenerative changes in the temporomandibular joint fossa and mandibular condyle, primarily manifested by cartilage degradation and degeneration. Clinical symptoms mainly include pain in the temporomandibular joint region, ear and head pain, grinding sounds and muscle pain during chewing, malocclusion, and limited movement. The pathogenesis of TMJOA is not fully understood. Current conventional treatments include drug therapy, intra-articular injection therapy, mesenchymal stem cell therapy, and surgery. However, these treatments may be accompanied by complications such as nausea, headache, cartilage damage, ligament damage, and postoperative infection. A radical cure remains lacking clinically. Compared to treating late-stage TMJOA, early intervention can more effectively halt disease progression and reduce the severity of the disease. Therefore, exploring and intervening in the genetic aspects related to TMJOA is a potentially effective treatment method. Summary of the Invention

[0003] In view of this, the present invention aims to propose a method for constructing an animal model for the prevention of temporomandibular joint osteoarthritis by knocking out the FAM20C gene, so as to solve the problem of providing effective treatment and prevention methods for temporomandibular joint osteoarthritis.

[0004] To achieve the above objectives, the present invention adopts the following technical solution: The present invention provides the application of the FAM20C gene in the preparation of drugs for the prevention or treatment of temporomandibular joint osteoarthritis.

[0005] In one implementation, the Fam20 gene is shown in SEQ ID NO.1.

[0006] This invention provides the application of the FAM20C gene in the preparation of an animal model of temporomandibular joint osteoarthritis.

[0007] In one implementation, the Fam20 gene is shown in SEQ ID NO.1.

[0008] In one implementation, utilizing Wnt1-Cre Mice and Fam20c flox / flox Obtained by hybridization of mice.

[0009] This invention provides a method for constructing an animal model to prevent temporomandibular joint osteoarthritis by knocking out the FAM20C gene. Step 1: Fam20c flox / floxCre was obtained by mating mice with Wnt1-Cre mice; Fam20c f / + and Fam20c f / + ; Step 2: Add Cre; Fam20c f / + and Fam20c f / + Obtained through mating in pairs Wnt1-Cre; Fam20c flox / flox .

[0010] In one embodiment, the above method is used to obtain an animal model of temporomandibular joint osteoarthritis.

[0011] Compared with the prior art, the beneficial effects of the present invention are as follows: In in vitro and in vivo experiments, the present invention demonstrates that conditional knockout of Fam20c can reduce apoptosis of condylar hypertrophic chondrocytes by inhibiting the mitochondrial pathway, and can alleviate the degree of lesions in the condylar cartilage of mice with temporomandibular joint osteoarthritis, inhibit the expression of pro-inflammatory factors and proteases, and promote the expression of anti-inflammatory factors, providing the application of FAM20C in the preparation of drugs for the treatment of temporomandibular joint osteoarthritis, and proving that conditional knockout of Fam20c has the potential to treat TMJOA. Attached Figure Description

[0012] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an undue limitation of the invention. In the drawings: Figure 1 The results of Fam20c and Wnt1-Cre genotype identification in Example 1 Figure 2 The results of anti-FAM20C staining of the condyles of mice in the control and knockout groups in Example 1 are shown (A, B: 10x, C, D: 20x). Figure 3 The results of H&E staining of the condyles of mice in the control and knockout groups in Example 2 are shown (A, B: 10x, C, D: 20x). Figure 4 The results of TUNEL staining of condylar tissue from control and knockout mice in Example 3 are shown in 4x. (A1) and (B1) are magnified areas within the white boxes in (A) and (B), respectively, where green fluorescence represents apoptotic cells. Figure 5 Immunohistochemical results (10x) of proteins related to the condylar mitochondrial apoptosis pathway in the control and knockout groups of mice in Example 3. Figure 6 To verify the expression of FAM20C in chondrocytes of the control and knockout groups in Example 3 using Western blotting. Figure 7 The expression of proteins related to the mitochondrial apoptosis pathway in chondrocytes of control and knockout mice in Example 3. Figure 8 Immunofluorescence staining results (10x) of mitochondrial apoptosis pathway-related proteins in chondrocytes of control and knockout mice in Example 3. Figure 9 Quantitative analysis of immunofluorescence staining of chondrocytes from the control and knockout groups of mice in Example 3. Figure 10 TUNEL staining (10x) of cells in the control and knockout groups in Example 3. Figure 11 To establish a mouse model of temporomandibular joint osteoarthritis in Example 4 Figure 12 The results of H&E staining of condylars in blank control, TMJOA control, and TMJOA cKO mice in Example 4 are shown. Figure 13 Immunohistochemical results (bar = 100 μm) of condylar inflammatory factors and proteases in blank control, TMJOA control, and TMJOA cKO mice in Example 5. Detailed Implementation Example 1. Knockout Fam20c Wnt1 marks pre-migrating neural crest cells during mouse embryonic development and plays an important role in the differentiation and development of maxillofacial tissues. This invention uses Cre mice with the Wnt1 promoter-driven recombinase and mice with... Fam20c flox / flox Mice with different genes are bred through mating.

[0013] Cre mice with Wnt1 promoter-driven recombinase Wnt1-Cre :Recorded in Wang X, Wang J, LiuY, Yuan B, Ruest LB, Feng JQ, Qin C. The specific role of FAM20C indentinogenesis. J Dent Res. 2015 Feb;94(2):330-6. Fam20c flox / floxIn mice, the LoxP site was inserted at both ends of exons 6-9 in the Fam20c gene (...[intron 5] --(LoxP)-->[exon 6] -- [exon 7]-- [exon 8] -- [exon 9]--(LoxP)-->[intron 10] ...). The LoxP sequence is 5' - ATAACTTCGTATA -GCATACAT - TATACGAAGTTAT - 3'.

[0014] The two types of mice were bred together to obtain the final result. Wnt1-Cre; Fam20c flox / flox Fam20c flox / flox Conditional knockout mice (cKO mice) are mice in which Wnt1 is specifically knocked out in tissues that express it. Fam20c Gene.

[0015] The breeding and mating method is as follows: Fam20c flox / flox rats and Wnt1-Cre Mice are bred and mated, and the F1 generation can produce mice with the following two genotypes: Wnt1-Cre;Fam20c flox / + and Fam20c flox / + .

[0016] Wnt1-Cre;Fam20c flox / + In Wnt1 expression tissues, Cre recombinase removes exon 6-9 between the LoxP site of one allele of Fam20c; Fam20c flox / + To insert LoxP sites flanking exons 6-9 of one allele in Fam20c, the other allele is wild-type+.

[0017] Then select from the F1 generation Wnt1-Cre;Fam20c flox / + and Fam20c flox / + When mice of two different genotypes are mated, the F2 generation can produce mice with the following six genotypes: Wnt1-Cre; Fam20c flox / flox Wnt1-Cre;Fam20c flox / + Wnt1- Cre;Fam20c + / + Fam20c flox / flox Fam20c flox / + Fam20c + / + . Wnt1-Cre; Fam20c flox / floxIn Wnt1 expression tissues, Cre recombinase removes exon 6-9 between the LoxP sites of the two Fam20c alleles; Wnt1-Cre; Fam20c + / + To express Cre recombinase in Wnt1 expression tissues, but the Fam20c gene was not modified; Fam20c + / + These were wild-type mice, and the Fam20c gene was not modified. Wnt1-Cre; Fam20c flox / flox Gene knockout mice required for this invention ( Fam20c cKO); the other genotypes can be used as littermate control mice (Normal).

[0018] Gene identification consisted of three parts: DNA extraction, PCR, and agarose gel electrophoresis. Three primers were designed for the mouse Fam20c gene identification PCR: Fam20c-a, Fam20c-b, and Fam20c-c. The primer sequence for Fam20c-a was TCCAGCTTGCTAGGGCTCTGACC (SEQ ID NO.2); the primer sequence for Fam20c-b was CTATGTCCAACGGCCGCAGCTT (SEQ ID NO.3); and the primer sequence for Fam20c-c was GTCCTGAGGGCTGACCCAAGACTA (SEQ ID NO.4). Both Fam20c-a and Fam20c-c amplified a 500bp single band, representing the genotype of wild-type WT, i.e. Fam20c + / +， ( Figure 1 (Lane 1); the double bands at 400bp and 500bp represent the heterozygous genotype, i.e. Fam20c flox / + ( Figure 1 (Middle lane 2); Fam20c-a and Fam20c-b amplified a 400bp single band, representing the Fam20c homozygous genotype, i.e. Fam20c flox / flox， ( Figure 1 (Middle Lane 3) Wnt1-Cre A positive recombinase gene result showed a 270bp band ( Figure 1 In the middle 4 lane, if the test is negative, there will be no band ( Figure 1 (Middle 5 lane).

[0019] The anti-FAM20C IHC staining of the condyles of 4-week-old control mice and knockout mice is shown in the figure below: At the same location in the condylar cartilage, the FAM20C protein in the Normal group was mainly found in the cytoplasm of the proliferating cell layer, the cytoplasm and nuclear membrane of the mast cell layer in the condylar cartilage, and in the bone marrow cavity of the subchondral bone; while... Fam20c The cKO group showed almost no FAM20C expression. These results indicate that the experiment successfully constructed [a specific therapeutic target]. Fam20c Conditional knockout of mice. Figure 2 ) Fam20c Gene sequence (SEQ ID NO.1):

[0020] Example 2. Knockout Fam20c Increases the thickness of the chondrocyte layer in condylar hypertrophy Observation of 4-week-old infants using H&E staining Fam20c Histological morphology of the condyles of cKO mice and control mice, H&E staining results showed ( Figure 3 Compared to the Normal group, Fam20c In the cKO group mice, the anterior condylar slope was short, and the cartilaginous region was significantly widened, mainly occupied by mast cells. The number of mast cell layers in the cartilage was significantly increased, the structure was significantly widened and thickened, and the extracellular matrix was reduced. There were almost no trabecular structures in the subchondral bone along the mandibular ramus, the medullary cavity was small and irregular, the bone tissue was in clumps, and there was a large amount of osteoid.

[0021] Example 3. Knockout Fam20c It can inhibit apoptosis of condylar chondrocytes (1) This embodiment is for 4-week-old infants Fam20c Paraffin sections of the condyles of cKO mice and control mice were stained with TUNEL and green fluorescence was observed at the same locations. Compared with the Normal group, Fam20c The number of green fluorescent cells in the cKO group was significantly reduced, as indicated by the white arrows. Figure 4 The location is mainly in the hypertrophic chondrocyte layer, indicating that it is 4 weeks old. Fam20c In the cKO group of mice, apoptotic activity in condylar chondrocytes was reduced. Fam20c Conditional knockout affects the normal life cycle of condylar cartilage and inhibits chondrocyte apoptosis.

[0022] (2) IHC was performed on key proteins in the mitochondrial pathway of apoptosis, namely Bcl-2, Bax, Caspase-3, and Cytochrome C. Figure 5 The expression and distribution of Fam20c in the condylar cartilage of 4-week-old mice were observed, and the effects of Fam20c deficiency on mitochondrial apoptosis pathway and cell proliferation were analyzed.

[0023] The results of anti-Bcl-2 IHC showed that there were almost no brown strongly positive expression granules in the condylar cartilage layer and subchondral bone in the Normal group. Fam20c In the cKO group, Bcl-2 protein was mainly located in the nucleus and cytoplasm of cells in the surface layer, quiescent layer, proliferative layer, and subchondral bone region of the condylar joint. Brown positive expression granules were more obvious. A small amount of expression was also found in the cytoplasm of the mast cell layer, with a lighter brown color. Compared with the Normal group, Bcl-2 protein expression was significantly increased.

[0024] Anti-Bax IHC results showed that brown positive expression granules were present in both the condylar cartilage layer and subchondral bone in the Normal group, with more prominent Bax positive granules in the hypertrophic cartilage layer; while Fam20c In the cKO group, except for a very small amount of expression in the mast cell layer, there was almost no positive expression of Bax protein, and the overall trend was decreasing.

[0025] Anti-Caspase-3 IHC results showed that, similar to the anti-Bax histochemistry results, brown positive expression granules were found in the condylar cartilage layer and subchondral bone in the Normal group, with the Bax positive granules being more prominent in the hypertrophic cartilage layer. Fam20c Brown granules were also expressed in the cKO group, mainly concentrated in the upper layer of the hypertrophic cartilage layer, but the brown color was not as deep as in the Normal group. Expression in other layers was not obvious, and the overall trend was decreasing.

[0026] The results of anti-Cytochrome C IHC showed that brown positive granules were expressed in the entire condylar layer in the Normal group, with the color being more obvious in the mast cell layer, while the color was lighter in other layers than in the mast cell layer. Fam20c Brown granule expression in the cKO group was mainly concentrated in the lower and middle layers of the hypertrophic cartilage layer, but the brown color was not as deep as in the Normal group. Expression in other layers was not obvious, and overall, it showed a decreasing trend. These results indicate that knockout... Fam20c Apoptosis of condylar mast chondrocytes can be reduced by inhibiting the mitochondrial pathway.

[0027] (3) Constructing a knockout system through lentiviral transfection Fam20c Mouse chondrocytes were subjected to WB, IF, and TUNEL staining to observe the differences in the expression of key proteins in condylar mitochondrial apoptosis.

[0028] The CAS9-Easy-lentivirus (single vector) used in this experiment was puromycin-resistant, and the working concentration of puromycin for screening mouse chondrocytes was 2.5 μg / ml. The optimal conditions for chondrocyte infection with recombinant lentivirus were MOI=10.

[0029] Chondrocyte transfection experiment, construction Fam20c Cell knockout: Cell seeding: Cells must be in good condition (clear morphology, normal growth, and free from any contamination). To reduce error, 2-3 replicates are required. For a 6-well plate, use 250,000 cells / ml per well, incubate at 37°C for 16-24 hours until the cell density reaches 20%-30%.

[0030] Infection: ① Calculate the required amount of mouse chondrocyte virus in a 6-well plate using the formula (virus volume = (MOI × cell number) / virus titer), MOI, and product virus titer, and then prepare the virus-containing cell culture medium; ② After culturing at 37℃ for 16 hours, replace with regular cell culture medium and continue culturing; ③ The need to change the culture medium can be determined based on cell viability during the culturing process; ④ After 3 days, observe the infection efficiency: continue culturing the cells in puro medium, and after 2 days of screening, if all chondrocytes in the Normal + puro group die, then all remaining cells in the transfection group are considered to be puro-positive, and culturing can continue to screen for stable mixed clones.

[0031] Screening of stable mixed clones: Maintenance concentration: Reduce the puro concentration to 1 / 2 to 1 / 4 of the original concentration; ① Prepare a maintenance concentration culture medium and continue culturing the transfected cells; ② Perform screening and amplification. Since the purchased lentivirus carries the Cas9 protein, its downstream DNA repair or transcriptional activation requires a certain amount of time, so downstream identification and other experiments can only be carried out 7 to 10 days after infection; ③ Collect cells for Western blotting to identify the expression of FAM20C protein, and amplify and cryopreserve chondrocytes that do not express FAM20C protein.

[0032] After lentiviral transfection, cells were amplified, and total cellular protein was extracted for Western blotting. The presence or absence of FAM20C protein expression was used to verify whether the knockout in chondrocytes was successful. Fam20c Genes. From Figure 6 It is evident that the KO group showed almost no FAM20C expression, proving that this experiment successfully constructed [the necessary framework / system]. Fam20c Knockout chondrocytes.

[0033] Western Blot results ( Figure 7 The results showed that the Bcl-2 bands were generally narrow, with the KO group bands being thicker and darker than the Normal group, and the KO group showing a significant increase in Bcl-2. Similarly, the Bax bands were also relatively narrow, with the KO group showing narrower and lighter Bax bands compared to the Normal group, and the KO group showing a decreasing trend in Bax. In the Caspase-3 group, both groups showed thick and dark bands, with the KO group showing a significantly decreasing trend in Caspase-3. In the Cytochrome C group, there was little difference in band thickness between the two groups, only slight color differences; the KO group's color was slightly lighter than the Normal group, and although the trend was decreasing, the difference was not significant. IF staining is shown in the figure ( Figure 8As shown in the figure: Under the same exposure time, the red fluorescence of the KO group in Bax was significantly weaker than that of the Normal group; the fluorescence difference between the Normal group and the KO group in Bcl-2 was small, with no significant difference; the red fluorescence of the KO group in Caspase-3 was also significantly weaker than that of the Normal group; in Cytochrome C, the red fluorescence trend was more significant in the KO group compared to the Normal group, with a significant weakening in the KO group. Subsequently, quantitative fluorescence analysis was performed on the IF results of each group (…). Figure 9 Although the Bcl-2 results were not significant, the increased Bcl-2 / Bax ratio was significant, indicating reduced intracellular apoptosis. TUNEL staining of cells showed a significant reduction in apoptotic cells in the KO group compared to the Normal group. Figure 10 This once again validated the knockout mechanism at the cellular level. Fam20c Effects and functions on mitochondrial apoptosis.

[0034] Example 4. Knockout Fam20c Reduces the severity of lesions in the condylar cartilage and subchondral bone of temporomandibular joint osteoarthritis (TMJ OA) mice. Select 6-week-old Wnt1-Cre; Fam20c flox / flox Mice and their littermate normal control mice, on Wnt1-Cre; Fam20c flox / flox A mouse model of temporomandibular joint osteoarthritis (TMJ) was established. Normal control mice were randomly divided into two groups: one group developed the TMJ osteoarthritis model, and the other group received no treatment. Therefore, the mice were further divided into three groups: a blank control group, a TMJ osteoarthritis control group, and a TMJ osteoarthritis knockout group. Fam20c Mouse group. Temporomandibular joint osteoarthritis (TMJ) models were established in a control mouse group and a knockout mouse group using the unilateral anterior crossbite method.

[0035] Mouse model of temporomandibular joint osteoarthritis (TMJ) Figure 11 Take a 5ml syringe needle, grind it to a length of 5mm, and bend it at a certain angle using a needle holder. Temporomandibular joint osteoarthritis control mouse group and temporomandibular joint osteoarthritis knockout mouse group. Fam20c Mice were anesthetized and placed in a quiet state using 1.25% aphthylamine. After the mice lost their ability to move, they were placed in a supine position on a table. A prepared metal needle was inserted into a cement and quickly cemented to the upper and lower anterior teeth of the mice to create an anterior crossbite model, indirectly altering the position of the temporomandibular joint condyle and inducing temporomandibular joint osteoarthritis. The mice were returned to their cages after waking up. The control group mice received no treatment. Their food and water intake remained unchanged, and the temporomandibular joint osteoarthritis control group and the temporomandibular joint osteoarthritis knockout group were examined every other day. Fam20c Whether the metal needle in the mouse group fell off. Three weeks later, the mice in all three groups were sacrificed for further experimental research.

[0036] H&E staining was used to observe the results in the blank control mouse group, the temporomandibular joint osteoarthritis control mouse group, and the temporomandibular joint osteoarthritis knockout mouse group. Fam20c Histological changes in the mandibular condylar cartilage and subchondral bone of the mouse group. Compared with blank control mice ( Figure 12 Compared to A, A1, and A2, TMJ OA control mice ( Figure 12 B, B1, B2) The condylar cartilage is significantly thinned (indicated by the blue double arrows), especially on the anterior oblique surface of the joint. Figure 12 B1), disordered chondrocyte arrangement, and disappearance of the normal trabecular structure of subchondral bone, confirming the successful establishment of the TMJ OA model; TMJ OA cKO mice ( Figure 12 C, C1, C2) compared to littermate TMJ OA control mice ( Figure 12 (B, B1, B2) The lesions of the condylar cartilage and subchondral bone are alleviated.

[0037] Table 1 shows the cartilage thickness of the anterior and middle condyles of the three groups of mice. One-way ANOVA among the three groups showed that the thickness of the anterior condyle cartilage was significantly different (P=0.0010), and the thickness of the middle condyle cartilage was significantly different (P=0.0250), with all P values ​​less than 0.05. Independent samples t-tests between the two groups showed that the thickness of the anterior condyle cartilage was significantly different (P=0.0019) and the thickness of the middle condyle cartilage was significantly different (P=0.012) between the control group and the control OA group; the thickness of the anterior condyle cartilage was significantly different (P=0.1728) and the thickness of the middle condyle cartilage was significantly different (P=0.294) between the control group and the cKO OA group; and the thickness of the anterior condyle cartilage was significantly different (P=0.0035) and the thickness of the middle condyle cartilage was significantly different (P=0.09) between the control OA group and the cKO OA group.

[0038] Table 1. Condylar cartilage thickness in three groups of mice (unit: μm) Example 5. Knockout Fam20c Regulating the expression of condylar inflammatory factors and proteases in TMJ OA mice Positive expression of CD90, TNFα, IL-4, IL-10, MMP9, MMP13, and ADAMTS5 proteins was localized in the cytoplasm of the articular disc, condylar cartilage, and subchondral bone. Figure 13 ).

[0039] Immunohistochemical staining revealed the following pro-inflammatory factor expression results: The expression levels of CD90 and TNFα in the articular discs, condylar cartilage, and subchondral bone of TMJ OA control mice were higher than those in the blank control mice; the expression levels of CD90 and TNFα in the articular discs, condylar cartilage, and subchondral bone of TMJ OA cKO group mice were lower than those in the TMJ OA control mice.

[0040] The results of anti-inflammatory factor expression are as follows: The expression levels of IL-4 and IL-10 in the articular disc, condylar cartilage and subchondral bone of TMJ OA control mice were lower than those in the blank control mice; Compared with TMJ OA control mice, the expression level of IL-4 in the articular disc, condylar cartilage and subchondral bone of TMJ OA cKO group mice was increased, while the expression level of IL-10 was not significantly different.

[0041] Protease expression results: The expression levels of MMP9, MMP13 and ADAMTS5 in the articular disc, condylar cartilage and subchondral bone of TMJ OA control mice were higher than those in the blank control mice; the expression levels of MMP9, MMP13 and ADAMTS5 in the articular disc, condylar cartilage and subchondral bone of TMJ OA cKO group mice were lower than those in TMJ OA control mice.

[0042] The above results prove that conditional knockout Fam20c It inhibits the expression of pro-inflammatory factors and proteases in the condyles of TMJ OA mice and promotes the expression of anti-inflammatory factors.

[0043] In summary, FAM20C plays a crucial role in the development, structure, and function of condylar cartilage and subchondral bone in mice. It can influence the condyle by affecting mitochondrial apoptosis in condylar cartilage cells and alleviate the severity of temporomandibular joint osteoarthritis (TMJ OA), thus serving as a therapeutic target for TMJ OA. This invention provides histological reference and theoretical basis for the preparation of drugs for treating temporomandibular joint osteoarthritis.

Claims

1. Application of the FAM20C gene in the preparation of drugs for the prevention or treatment of temporomandibular joint osteoarthritis.

2. The application according to claim 1, characterized in that, The Fam20 gene is shown in SEQ ID NO.

1.

3. Application of FAM20C gene in the preparation of animal models of temporomandibular joint osteoarthritis.

4. The application according to claim 3, characterized in that, The Fam20 gene is shown in SEQ ID NO.

1.

5. The application according to claim 3, characterized in that, use Wnt1-Cre Mice and Fam20c flox / flox Obtained by hybridization of mice.

6. A method for constructing an animal model for preventing temporomandibular joint osteoarthritis by knocking out the FAM20C gene, characterized in that, Step 1: Fam20c flox / flox Cre was obtained by mating mice with Wnt1-Cre mice; Fam20c f / + and Fam20c f / + ; Step 2: Add Cre; Fam20c f / + and Fam20c f / + Obtained through mating in pairs Wnt1-Cre; Fam20c flox / flox .

7. The method according to claim 6, characterized in that, The primer combinations for identification are shown in SEQ ID NO.2-4.

8. The application of the method according to claim 6 or 7 in obtaining an animal model of temporomandibular joint osteoarthritis.

Images