An enzyme preparation for catalytically synthesizing d-chiro-inositol and a preparation method of d-chiro-inositol

By mutating and co-expressing specific sites of inositol dehydrogenase and ketoisomerase, the enzyme activity was improved, the problem of low enzyme activity was solved, and the efficient catalysis of D-chiral inositol production was achieved, simplifying the production process and making it suitable for industrial applications.

CN122128260APending Publication Date: 2026-06-02ZHUCHENG HAOTIAN PHARMA CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
ZHUCHENG HAOTIAN PHARMA CO LTD
Filing Date
2026-03-02
Publication Date
2026-06-02

AI Technical Summary

Technical Problem

The low enzyme activity of ketoisomerase and inositol dehydrogenase in the existing technology leads to limited conversion of D-chiral inositol, thus restricting the yield of D-chiral inositol.

Method used

By mutating specific sites of wild-type inositol dehydrogenase and ketoisomerase, recombinant strains were constructed to co-express inositol dehydrogenase and ketoisomerase, thereby improving their enzyme activity. Enzyme preparations were then prepared by fermentation culture, simplifying the production process.

Benefits of technology

It significantly improves the conversion rate of catalytic muscle inositol reaction to chiral inositol, simplifies the production process, reduces costs, and is more suitable for large-scale industrial production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

This invention relates to the field of genetic engineering technology, and particularly to an enzyme preparation for the catalytic synthesis of D-chiral inositol and a method for preparing D-chiral inositol. The enzyme preparation includes inositol dehydrogenase and ketoisomerase. The amino acid sequence of the inositol dehydrogenase is any one of the sequences shown in SEQ ID NO. 23 to SEQ ID NO. 25; the amino acid sequence of the ketoisomerase is any one of the sequences shown in SEQ ID NO. 29 to SEQ ID NO. 31. This invention co-expresses inositol dehydrogenase and ketoisomerase with specific site mutations, significantly improving the conversion rate of D-chiral inositol.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to an enzyme preparation for catalytic synthesis of D-chiral inositol and a method for preparing D-chiral inositol. Background Technology

[0002] D-chiro-inositol (DCI) is one of the nine isomers of inositol that is optically active. Recent studies have found that, in addition to its role in promoting hepatic lipid metabolism, D-chiro-inositol also possesses unique physiological functions such as insulin sensitization, blood sugar reduction, improvement of ovulation in patients with polycystic ovary syndrome, regulation of hormone balance, improvement of menstrual disorders, and antioxidant, anti-aging, and anti-inflammatory effects.

[0003] The dual-enzyme combination of ketoisomerase and inositol dehydrogenase can convert the substrate muscle inositol into D-chiral inositol. However, existing technologies generally suffer from low enzyme activity of both ketoisomerase and inositol dehydrogenase, resulting in limited overall conversion rate. This is a key bottleneck restricting the production of D-chiral inositol.

[0004] Therefore, traditional techniques need to be improved. Summary of the Invention

[0005] In view of this, the present invention provides an enzyme preparation for catalytic synthesis of D-chiral inositol and a method for preparing D-chiral inositol, which overcomes the defects of low enzyme activity of ketoisomerase and inositol dehydrogenase in the prior art, resulting in limited reaction conversion rate.

[0006] To achieve the above objectives, in a first aspect, the present invention provides an enzyme preparation for catalyzing the synthesis of D-chiral inositol, the enzyme preparation having enzymatic activity for catalyzing the reaction of muscle inositol to produce chiral inositol, the enzyme preparation comprising inositol dehydrogenase and ketoisomerase, the amino acid sequence of the inositol dehydrogenase being any of the following: (1) The amino acid sequence shown in SEQ ID NO.23; (2) The amino acid sequence shown in SEQ ID NO.24; (3) The amino acid sequence shown in SEQ ID NO.25; and / or, The amino acid sequence of the ketoisomerase is shown in any of the following: (1) The amino acid sequence shown in SEQ ID NO.29; (2) The amino acid sequence shown in SEQ ID NO.30; (3) The amino acid sequence shown in SEQ ID NO.31.

[0007] Compared with the prior art, the present invention mutates specific sites of wild-type inositol dehydrogenase (amino acid sequence as shown in SEQ ID NO.1) and wild-type ketoisomerase (amino acid sequence as shown in SEQ ID NO.3). After mutation, the enzyme activities of inositol dehydrogenase and ketoisomerase are higher, which can significantly improve the conversion rate of chiral inositol, a product of muscle inositol, in the process of catalyzing the reaction of muscle inositol to produce chiral inositol.

[0008] Furthermore, the enzyme activity ratio of the inositol dehydrogenase to the ketoisomerase is 0.5:(0.5~2).

[0009] Furthermore, the method for modifying the enzyme activity of the inositol dehydrogenase includes the following methods: (1) The amino acid sequence shown in SEQ ID NO.23 is obtained by changing the N to Q of the 123rd amino acid in the amino acid sequence shown in SEQ ID NO.1; (2) The amino acid sequence shown in SEQ ID NO.24 is obtained by mutating amino acid Y to W at position 285 of the amino acid sequence shown in SEQ ID NO.1; (3) The amino acid sequence shown in SEQ ID NO.25 is obtained by changing the N to Q amino acid at position 123 of the amino acid sequence shown in SEQ ID NO.1 and changing the Y to W amino acid at position 285.

[0010] The amino acid sequence shown in SEQ ID NO.23 is the inositol dehydrogenase mutant N123Q; the amino acid sequence shown in SEQ ID NO.24 is the inositol dehydrogenase mutant Y285W; and the amino acid sequence shown in SEQ ID NO.25 is the inositol dehydrogenase mutant N123Q / Y285W. The coding gene for the inositol dehydrogenase mutant N123Q is shown in SEQ ID NO.26; the coding gene for the inositol dehydrogenase mutant Y285W is shown in SEQ ID NO.27; and the coding gene for the inositol dehydrogenase mutant N123Q / Y285W is shown in SEQ ID NO.28.

[0011] Furthermore, the method for modifying the enzyme activity of the ketoisomerase includes the following methods: The amino acid sequence shown in SEQ ID NO.29 is obtained by mutating amino acid R to K at position 33 of the amino acid sequence shown in SEQ ID NO.3; The amino acid sequence shown in SEQ ID NO.30 is obtained by mutating amino acid E to D at position 239 of the amino acid sequence shown in SEQ ID NO.3; The amino acid sequence shown in SEQ ID NO.31 is obtained by changing the amino acid at position 33 from R to K, and simultaneously changing the amino acid at position 239 from E to D.

[0012] The amino acid sequence shown in SEQ ID NO. 29 is the ketoisomerase mutant R33K, the amino acid sequence shown in SEQ ID NO. 30 is the ketoisomerase mutant E239D, and the amino acid sequence shown in SEQ ID NO. 31 is the ketoisomerase mutant R33K / E239D; the coding gene for the ketoisomerase mutant R33K is shown in SEQ ID NO. 32; the coding gene for the ketoisomerase mutant E239D is shown in SEQ ID NO. 33; and the coding gene for the ketoisomerase mutant R33K / E239D is shown in SEQ ID NO. 34.

[0013] Secondly, the present invention provides a method for preparing an enzyme preparation, comprising the following steps: A recombinant strain containing both an inositol dehydrogenase encoding gene and a ketoisomerase encoding gene was constructed. The recombinant strain was fermented and cultured to induce the expression of inositol dehydrogenase and ketoisomerase.

[0014] Furthermore, the preparation method of the above-mentioned enzyme preparation specifically includes the following steps: Recombinant strains containing both inositol dehydrogenase and ketoisomerase genes were seed cultured to obtain seed liquid. The seed culture was inoculated into the fermentation medium at an inoculation rate of 1% to 5% by volume for fermentation culture. When the dissolved oxygen level rose, feeding was started, and the culture was continued until the OD reached 50%. 600 When the OD value reaches 65-75, add an inducing agent for induction culture until the OD value reaches 65-75. 600 The value stops increasing, and fermentation broth is obtained; The fermentation broth is centrifuged to collect the bacterial cells. After the bacterial cells are resuspended, the cells are broken up, centrifuged again, and the supernatant is collected to obtain the crude enzyme solution of the enzyme preparation.

[0015] The seed culture involves inoculating the recombinant strain into LB liquid medium and culturing it with shaking at 30℃~40℃ and 200rpm~300rpm for 5h~6h to obtain a seed culture. The fermentation culture temperature is 30℃~40℃, and the air volume is 0.5m³ / h. 3 / h~1m 3 / h, rotation speed of 200rpm~400rpm, pressure of 0.01MPa~0.05MPa, pH value of 6.5~7.5, dissolved oxygen content of 15%~35%; and / or, The induction culture temperature is 25℃~35℃, the inducer is L-arabinose, and the final concentration of the inducer is 1g / L~5g / L.

[0016] Compared with existing technologies, this invention co-expresses inositol dehydrogenase and ketoisomerase to construct a single recombinant engineered strain, replacing the existing method of constructing bacterial cells with two enzymes separately. This simplifies the production process of chiral inositol, shortens the production cycle, and reduces the cost of bacterial cell culture, making it more suitable for large-scale industrial production.

[0017] Thirdly, the present invention provides the use of the above-mentioned enzyme preparation, the use of which includes catalyzing the reaction of muscle inositol to produce chiral inositol.

[0018] Fourthly, the present invention provides a method for preparing D-chiral inositol, comprising adding muscle inositol and NAD to a 25mM~50mM buffer solution. + The crude enzyme solution containing metal ions and enzyme preparations is used to make the concentration of muscle inositol in the reaction system 50g / L~100g / L, and NAD+. + The concentration of the enzyme is 0.5mM~1mM, the concentration of the metal ions is 2mM~5mM, and the enzyme activity of the crude enzyme preparation is 5U / ml~25U / ml.

[0019] Furthermore, the metal ions include manganese ions, magnesium ions, or zinc ions; the buffer solution includes PBS buffer, Tris-HCl buffer, or HEPE buffer; the reaction temperature is 30℃~37℃, and the pH value is 7~9.

[0020] Compared with existing technologies, the use of the enzyme preparation of the present invention, which includes specific inositol dehydrogenase and ketoisomerase, to catalyze the reaction of muscle inositol to produce chiral inositol can effectively improve the conversion rate of chiral inositol. Detailed Implementation

[0021] To make the technical problems to be solved, the technical solutions, and the beneficial effects of the present invention clearer, the present invention will be further described in detail below with reference to specific embodiments. It should be understood that the specific embodiments described herein are only for explaining the present invention and are not intended to limit the present invention.

[0022] It should be understood that, unless otherwise specified, all raw materials used in the following examples are commercially available.

[0023] Example 1: Construction of the recombinant expression vector pYB1s----ioIG1----ioll1 S1. The amino acid sequences of wild-type inositol dehydrogenase ioIG and wild-type ketoisomerase ioll were artificially synthesized and mutated. AlphaFold site prediction was used, and saturation mutation screening was performed on the predicted key sites. Finally, the ioIG mutants N123Q, Y285W, and N123Q / Y285W and the ioll mutants R33K, E239D, and R33K / E239D were obtained. The amino acid sequence of wild-type inositol dehydrogenase ioIG is shown in SEQ ID NO.1; the nucleotide sequence is shown in SEQ ID NO.2; the amino acid sequence of wild-type ketoisomerase ioll is shown in SEQ ID NO.3, and the nucleotide sequence is shown in SEQ ID NO.4.

[0024] The amino acid sequence of the ioIG mutant N123Q is shown in SEQ ID NO.23; the amino acid sequence of the ioIG mutant Y285W is shown in SEQ ID NO.24; and the amino acid sequence of the ioIG mutants N123Q / Y285W is shown in SEQ ID NO.25.

[0025] The nucleotide sequence encoding the ioIG mutant N123Q is shown in SEQ ID NO.26; the nucleotide sequence encoding the ioIG mutant Y285W is shown in SEQ ID NO.27; and the nucleotide sequence encoding the ioIG mutant N123Q / Y285W is shown in SEQ ID NO.28.

[0026] The amino acid sequence of the ioll mutant R33K is shown in SEQ ID NO.29; the amino acid sequence of the ioll mutant E239D is shown in SEQ ID NO.30; and the amino acid sequence of the ioll mutant R33K / E239D is shown in SEQ ID NO.31.

[0027] The nucleotide sequence encoding the ioll mutant R33K is shown in SEQ ID NO.32; the nucleotide sequence encoding the ioll mutant E239D is shown in SEQ ID NO.33; and the nucleotide sequence encoding the ioll mutant R33K / E239D is shown in SEQ ID NO.34.

[0028] S2. Using F1 as the upstream primer and F2 as the downstream primer, and the nucleotide sequence shown in SEQ ID NO.2 as the template, PCR amplification was performed using high-fidelity DNA polymerase (Wuhan Aiboteke Biotechnology Co., Ltd.) to obtain the correct ioIG1 gene fragment. The PCR amplification system is shown in Table 1.

[0029] S3. Using F3 as the upstream primer and F4 as the downstream primer, and the nucleotide sequence shown in SEQ ID NO.4 as the template, PCR amplification was performed using high-fidelity DNA polymerase (Wuhan Aiboteke Biotechnology Co., Ltd.) to obtain the correct ioll1 gene fragment. The PCR amplification system is shown in Table 1.

[0030] S4. Using pYB1s-F as the upstream primer and pYB1s-R as the downstream primer, and using the empty pYB1s vector as a template, PCR amplification was performed using high-fidelity DNA polymerase (Wuhan Aiboteke Biotechnology Co., Ltd.) to obtain the correct pYB1s expression vector fragment. The PCR amplification system is shown in Table 1.

[0031] Table 1 PCR system (10 μL) The PCR reaction procedures for all of the above were as follows: pre-denaturation: 98℃ pre-denaturation for 3 min; amplification cycle: 98℃ denaturation for 10 s, 55℃ annealing for 30 s, 72℃ extension for 4.5 min, 32 cycles; completion: 72℃ extension for 10 min.

[0032] S5. The ioIG1 gene fragment, ioll1 gene fragment, and pYB1s expression vector fragment were ligated using the Gibson assembly method (10 μL system). The ligation system is shown in Table 2. The Gibson ligation product was obtained. The Gibson ligation product was then added to *E. coli* DH5α competent cells (Beijing TransGen Biotech Co., Ltd.), incubated on ice for 30 min, then in a 42 ℃ water bath for 90 s, and then placed on ice for 2 min. 1 mL of LB medium was then added, and the cells were incubated at 37 ℃ for 1 h on a shaker. Finally, the cells were plated on LB agar plates containing streptomycin sulfate and incubated overnight at 37 ℃. Single clones were picked, plasmids were extracted, and sent to Beijing Ruiboxingke Biotechnology Co., Ltd. for sequencing verification. The correctly sequenced vector was named pYB1s---ioIG1---ioll1.

[0033] Table 2 Gibson linkage reaction system The sequences of the above primers F1~F4, pYB1s-F, and pYB1s-R are as follows (5) , -3 , ): F1:GCTAACAGGAGGAATTAACCATGCTAAATGTAGGAGTTATAGG, SEQ ID NO.5; F2:TCTCCTTGGTAGTTGAGGACTTTTTATAAAATTCCGGCTTCTC, SEQ ID NO.6; F3:TCCTCAACTACCAAGGAGAAAACATGAAGACCACCCTGAA, SEQ ID NO.7; F4: TACCAGATCTACCCTCGAGTTACGCCGCACGCGCTTGC; SEQ ID NO.8; pYB1s-F: CTCGAGGGTAGATCTGGTAC, SEQ ID NO.9; pYB1s-R: GGTTAATTCCTCCTGTTAGC, SEQ ID NO. 10.

[0034] Example 2: Construction of the recombinant expression vector pYB1s--ioll2--ioIG2 S1. Using F5 as the upstream primer and F6 as the downstream primer, and the nucleotide sequence shown in SEQ ID NO.4 as the template, PCR amplification was performed using high-fidelity DNA polymerase (Wuhan Aiboteke Biotechnology Co., Ltd.). The PCR amplification system is shown in Table 1. The PCR amplification reaction procedure is as described in Example 1, and the correct ioll2 gene fragment is obtained.

[0035] S2. Using F7 as the upstream primer and F8 as the downstream primer, and the nucleotide sequence shown in SEQ ID NO.2 as the template, PCR amplification was performed using high-fidelity DNA polymerase (Wuhan Aiboteke Biotechnology Co., Ltd.). The PCR amplification system is shown in Table 1. The PCR amplification reaction procedure is as described in Example 1, and the correct ioIG2 gene fragment is obtained.

[0036] S3. Using pYB1s-F as the upstream primer and pYB1s-R as the downstream primer, and pYB1s empty vector as the template, PCR amplification was performed using high-fidelity DNA polymerase (Wuhan Aibote Biotechnology Co., Ltd.). The PCR amplification system is shown in Table 1. The PCR amplification reaction procedure is as described in Example 1 to obtain the correct pYB1s expression vector fragment.

[0037] S4. The ioll2 gene fragment, ioIG2 gene fragment, and pYB1s expression vector fragment were ligated using the Gibson assembly method (10 μL system). The ligation system is shown in Table 2. The Gibson ligation product was then obtained. The Gibson ligation product was added to DH5α competent cells (Beijing TransGen Biotech Co., Ltd.), incubated on ice for 30 min, then incubated in a 42 ℃ water bath for 90 s, then placed on ice for 2 min. 1 mL of LB medium was then added, and the cells were incubated at 37 ℃ for 1 h on a shaker. Finally, the cells were plated on LB agar plates containing streptomycin sulfate and incubated overnight at 37 ℃. Single clones were picked, plasmids were extracted, and sent to Beijing Ruiboxingke Biotechnology Co., Ltd. for sequencing verification. The correctly sequenced vector was named pYB1s--ioll2--ioIG2.

[0038] The sequences of the above primers F5~F8, pYB1s-F, and pYB1s-R are as follows (5) , -3 , ): F5:GCTAACAGGAGGAATTAACCATGAAGACCACCCTGAACCACA, SEQ ID NO.11; F6:TTTCTCCTTGGTAGTTGAGGACTTTTACGCCGCACGCGCTTG, SEQ ID NO.12; F7: GTCCTCAACTACCAAGGAGAAAACATGCTAAATGTAGGAGTTA, SEQ ID NO.13; F8:GTACCAGATCTACCCTCGAGTTTATAAAATTCCGGCTTCCTACA, SEQ ID NO.14; pYB1s-F: CTCGAGGGTAGATCTGGTAC, SEQ ID NO.9; pYB1s-R: GGTTAATTCCTCCTGTTAGC, SEQ ID NO. 10.

[0039] Example 3 Construction of recombinant strains S1. Constructing the mutant plasmid ioIG N123Q --ioll: Using the recombinant expression vector pYB1s---ioIG1---ioll1 constructed in Example 1 as a template, with N123QF as the upstream primer and N123QR as the downstream primer, a mutant plasmid containing the ioIG mutant N123Q gene and the wild-type ioll gene was obtained by PCR amplification, which is plasmid 1.

[0040] N123QF:GCAAGTTGGCTTCCAACGTCGTTTTGATCC, SEQ ID NO.15; N123QR: GGATCAAAACGACGTTGGAAGCCAACTTGC, SEQ ID NO. 16.

[0041] S2. Constructing the mutant plasmid ioIG N123Q / Y285W --ioll: Using plasmid 1 as a template, Y285WF as the upstream primer and Y285WR as the downstream primer, a mutant plasmid containing the ioIG mutant N123Q / Y285W gene and the wild-type ioll gene was obtained by PCR amplification, which is plasmid 2.

[0042] Y285WF: GTTACACCCAAGCGTGGATCCACGAAGTGGC, SEQ ID NO.17; Y285WR:GCCACTTCGTGGATCCACGCTTGGGTGTAAC, SEQ ID NO. 18.

[0043] S3. Constructing the mutant plasmid ioIG N123Q / Y285W --ioll R33K Using plasmid 2 as a template, with R33KF as the upstream primer and R33KR as the downstream primer, a mutant plasmid containing the ioIG mutant N123Q / Y285W gene and the ioll mutant R33K gene was obtained by PCR amplification, which is plasmid 3.

[0044] R33KF: ATCGGCGTTGAGGTGAAAAACGACATTGCG, SEQ ID NO.19; R33KR: CGCAATGTCGTTTTTCACCTCAACGCCGAT, SEQ ID NO. 20.

[0045] S4. Constructing the mutant plasmid ioIG N123QE / Y285W --ioll R33K / E239D Using plasmid 3 as a template, with E239DF as the upstream primer and E239DR as the downstream primer, a mutant plasmid containing the ioIG mutant N123Q / Y285W gene and the ioll mutant R33K / E239D gene was obtained by PCR amplification, which is plasmid 4.

[0046] E239DF: GCCCGATTAGCTATGATTGCTTTAGCCCGGA, SEQ ID NO. 21; E239DR:TCCGGGCTAAAGCAATCATAGCTAATCGGGC, SEQ ID NO. 22.

[0047] S5. Constructing the mutant plasmid ioll R33K --ioIG: Using the recombinant expression vector pYB1s--ioll2--ioIG2 prepared in Example 2 as a template, and R33KF as the upstream primer and R33KR as the downstream primer, a mutant plasmid containing the ioll mutant R33K gene and the wild-type ioIG gene was obtained by PCR amplification, which is plasmid 5.

[0048] S6. Constructing the mutant plasmid ioll R33K / E239D --ioIG: Using plasmid 5 as a template, with E239DF as the upstream primer and E239DR as the downstream primer, a mutant plasmid containing the ioll mutant R33K / E239D gene and the wild-type ioIG gene was obtained by PCR amplification, which is plasmid 6.

[0049] S7. Constructing the mutant plasmid ioll R33K / E239D --ioIG N123Q Using plasmid 6 as a template, with N123QF as the upstream primer and N123QR as the downstream primer, a mutant plasmid containing the ioll mutant R33K / E239D gene and the ioIG mutant N123Q gene was obtained by PCR amplification, which is plasmid 7.

[0050] S8. Constructing the mutant plasmid ioll R33K / E239D --ioIG N123Q / Y285W Using plasmid 7 as a template, Y285WF as the upstream primer and Y285WR as the downstream primer, a mutant plasmid containing the ioll mutant R33K / E239D gene and the ioIG mutant N123Q / Y285W gene was obtained by PCR amplification, which is plasmid 8.

[0051] The systems and procedures for each of the above PCR amplification processes are the same as those for the amplification process in Example 1.

[0052] After each of the above PCR reactions was completed, the template was digested using the restriction endonuclease DpnI. The digestion reaction system for each reaction was: 1 μL of 10× buffer, 8 μL of PCR product, and 1 μL of DpnI. The digestion was carried out at 37°C for 1 h to obtain the digested solution.

[0053] After digestion, 10 μL of the digestion solution was added to each *E. coli* DH5α competent cell. The cells were incubated on ice for 30 min, then heat-shocked at 42°C for 90 s, and incubated on ice for 5 min. 600 μL of LB broth was added, and the cells were incubated at 37°C for 1 h. The cells were then plated onto LB agar plates (containing 50 μg / mL streptomycin sulfate) until the bacterial culture was completely absorbed. The plates were inverted and incubated overnight at 37°C. Plasmids were then extracted and sent to BGI Genomics for sequencing verification.

[0054] S9. Preparation of Expression Strains: E. coli BW25113 competent cells were prepared using the CaCl2 method. Plasmids 1-8, recombinant expression vectors pYB1s-ioll1-ioIG1 and pYB1s-ioIG2-ioll2 were transformed into E. coli BW25113 competent cells, respectively. The cells were then plated onto LB agar plates containing streptomycin sulfate and incubated overnight at 37°C. Positive clones were selected. The successfully transformed strains were named: Recombinant Bacterium 1, Recombinant Bacterium 2, Recombinant Bacterium 3, Recombinant Bacterium 4, Recombinant Bacterium 5, Recombinant Bacterium 6, Recombinant Bacterium 7, Recombinant Bacterium 8, Recombinant Bacterium 9, and Recombinant Bacterium 10.

[0055] Among them, recombinant bacteria 1 contains plasmid 1, recombinant bacteria 2 contains plasmid 2, recombinant bacteria 3 contains plasmid 3, recombinant bacteria 4 contains plasmid 4, recombinant bacteria 5 contains plasmid 5, recombinant bacteria 6 contains plasmid 6, recombinant bacteria 7 contains plasmid 7, recombinant bacteria 8 contains plasmid 8, recombinant bacteria 9 contains the recombinant expression vector pYB1s---ioIG1---ioll1, and recombinant bacteria 10 contains the recombinant expression vector pYB1s--ioll2--ioIG2.

[0056] Example 4 Induction of enzyme production S1. Pick recombinant bacteria 1 to recombinant bacteria 10 respectively, inoculate them into 10 300ml LB medium, and culture them at 37℃ and 220rpm for 5.5h with shaking to obtain seed liquid 1 to seed liquid 10 of recombinant bacteria 1 to recombinant bacteria 10 respectively. S2. Seed solutions 1 through 10 were inoculated at a rate of 2% (v / v) into 10 fermenters (30L in volume) containing fermentation medium for fermentation culture. The fermentation conditions were: temperature: 37℃; airflow: 0.5m³ / h. 3 / h; Rotation speed: 300 rpm; Pressure: 0.02 MPa; pH: adjusted to pH 7 with ammonia; Dissolved oxygen: 20%; After about 12 hours of cultivation, dissolved oxygen and pH increased significantly, so feeding was started. Cultivation continued until the bacterial biomass reached the OD value. 600After the value reached 70, the temperature was lowered to 30℃ and L-arabinose with a final concentration of 2g / L was added to start induction culture. After the biomass of the cells stopped increasing, the cells were transferred to fermentation tanks to obtain fermentation broth 1 to fermentation broth 10.

[0057] Among them, fermentation broth 1 contains the ioIG mutant N123Q and wild-type ioll; fermentation broth 2 contains the ioIG mutant N123Q / Y285W and wild-type ioll; fermentation broth 3 contains the ioIG mutant N123Q / Y285W and the ioll mutant R33K; fermentation broth 4 contains the ioIG mutant N123Q / Y285W and the ioll mutant R33K / E239D; fermentation broth 5 contains the ioll mutant R33K and wild-type ioIG; and fermentation broth 6 contains... The fermentation broth contains the ioll mutant R33K / E239D and the wild-type ioIG. Fermentation broth 7 contains the ioll mutant R33K / E239D and the ioIG mutant N123Q. Fermentation broth 8 contains the ioll mutant R33K / E239D and the ioIG mutant N123Q / Y285W. Fermentation broth 9 contains wild-type ioIG and wild-type ioll (obtained by fermentation of recombinant strain 9). Fermentation broth 10 contains wild-type ioIG and wild-type ioll (obtained by fermentation of recombinant strain 10).

[0058] The feeding rate during the above fermentation process is shown in Table 3.

[0059] Table 3 Feeding Rate The fermentation medium in the fermenter consisted of: citric acid 2 g / L, potassium dihydrogen phosphate 14 g / L, dipotassium hydrogen phosphate 4.5 g / L, ammonium sulfate 4 g / L, glucose 20 g / L, magnesium sulfate 0.6 g / L, yeast powder 1 g / L, pantothenic acid 2 mg / L, defoamer 0.1 g / L, and 100× trace element-10 ml / L.

[0060] The culture medium for feeding consisted of: 600 g / L glucose, 2 g / L magnesium sulfate, 10 g / L yeast extract, and 100× trace element 2 at 10 mL / L.

[0061] The concentrations of each component in the above 100× Trace Element I are as follows: 25mg / L 150mg / L 15mg / L 30mg / L 25mg / L 130 mg / L, ferric citrate 1 g / L.

[0062] The concentrations of each component in the above 100× Trace Element II are as follows: 40mg / L 24mg / L 25mg / L 50mg / L 40mg / L 160 mg / L, ferric citrate 0.4 g / L.

[0063] S3. Enzyme Solution Preparation: Fermentation broths 1 through 10 were centrifuged at 8000 rpm for 20 min, and the bacterial cells were collected. The fermentation broth was discarded, and the bacterial cells were resuspended in 50 mmol, pH=7 PBS buffer. The cells were homogenized and disrupted at a homogenization pressure of 45 MPa for 3 cycles, with the circulating solution temperature maintained below 25℃. After cell disruption, the cells were centrifuged at 8000 rpm for 20 min, and the supernatant was collected to obtain crude enzyme solution 1 containing both ioIG mutant N123Q and wild-type ioll, crude enzyme solution 2 containing both ioIG mutant N123Q / Y285W and wild-type ioll, and crude enzyme solution 3 containing both ioIG mutant N123Q / Y285W and ioll mutant R33K. 4. Crude enzyme solution containing ioIG mutant N123Q / Y285W and ioll mutant R33K / E239D; 5. Crude enzyme solution containing ioll mutant R33K and wild-type ioIG; 6. Crude enzyme solution containing ioll mutant R33K / E239D and wild-type ioIG; 7. Crude enzyme solution containing ioll mutant R33K / E239D and ioIG mutant N123Q; 8. Crude enzyme solution containing ioll mutant R33K / E239D and ioIG mutant N123Q / Y285W; 9. Crude enzyme solution containing wild-type ioIG and wild-type ioll (prepared from fermentation broth 9); 10. Crude enzyme solution containing wild-type ioIG and wild-type ioll (prepared from fermentation broth 10).

[0064] Example 5 Enzyme Activity Assay Enzyme activity was determined by high-performance liquid chromatography (HPLC). A 1.0 mL reaction system was prepared by adding muscle inositol and NAD to a phosphate buffer solution with a pH of 8 and a concentration of 50 mM. + The crude enzyme solution and manganese sulfate prepared in Example 4 were used to make the concentration of muscle inositol in the reaction system 20 mM, the concentration of manganese sulfate 2 mM, and the total concentration of crude enzyme 4 mg / ml (wherein, the enzyme activity ratio of inositol dehydrogenase to ketoisomerase was 0.5:1).

[0065] According to the above preparation method of the reaction system, reaction system 1 to reaction system 10 were prepared respectively. The crude enzyme solution 1 to crude enzyme solution 10 prepared in Example 4 were added to reaction system 1 to reaction system 10 respectively. The above reaction systems were reacted at 37°C for 30 min respectively. The concentration of D-chiral inositol in each reaction solution was determined by high performance liquid chromatography (HPLC).

[0066] Detection conditions for high performance liquid chromatography: Column: 4.6×250 mm amino column with a particle size of 5 μm; Mobile phase: acetonitrile and 50 mM ammonium acetate aqueous solution in a volume ratio of 75:25; Column temperature: 30℃; Flow rate: 1.0 mL / min; Detector: differential refractive index detector.

[0067] One enzyme activity unit (U) is defined as the amount of enzyme required to generate 1 μmol of D-chiral inositol per minute under the above conditions.

[0068] The enzyme activities of crude enzyme solutions 1 to 10 are shown in Table 4.

[0069] Table 4 Results of enzyme activity assay As can be seen from the above results, after mutating specific sites of wild-type inositol dehydrogenase and wild-type ketoisomerase, the enzyme activities of the resulting inositol dehydrogenase mutant and ketoisomerase mutant were significantly improved.

[0070] Example 6 Preparation of D-chiral inositol Preparation of the reaction system (total volume 1L): Add muscle inositol and NAD to a PBS buffer with a pH of 7 and a strength of 25mM. + The crude enzyme solution prepared in Example 4, along with manganese sulfate, was used to make the concentration of muscle inositol in the reaction system 50 g / L and NAD+. + The concentration of the enzyme was 0.5 mM, the total enzyme activity of the crude enzyme in the crude enzyme solution was 23 U (of which, the enzyme activity ratio of inositol dehydrogenase to ketoisomerase was 0.5:1), and the concentration of manganese sulfate was 3 mM.

[0071] Following the above process for preparing the reaction system, reaction systems 1 to 10 were configured, wherein crude enzyme solution 1 to crude enzyme solution 10 prepared in Example 4 were added to reaction systems 1 to 10 respectively.

[0072] Reaction systems 1 through 10 were reacted at 37°C for 12 hours to obtain conversion solutions. The conversion rate of D-chiral inositol was determined by high-performance liquid chromatography (HPLC). The results are shown in Table 5.

[0073] Detection conditions for high performance liquid chromatography: Column: 4.6×250 mm amino column with a particle size of 5 μm; Mobile phase: acetonitrile and 50 mM ammonium acetate aqueous solution in a volume ratio of 75:25; Column temperature: 30℃; Flow rate: 1.0 mL / min; Detector: differential refractive index detector.

[0074] Conversion rate calculation method: Conversion rate (%) = (mass of D-chiral inositol generated ÷ total mass of initially added inositol) × 100%.

[0075] Table 5. Conversion rates of D-chiral inositol prepared from different crude enzyme solutions The results above show that the present invention mutates specific sites of wild-type inositol dehydrogenase and wild-type ketoisomerase, thereby increasing the enzyme activity of inositol dehydrogenase and ketoisomerase, and thus significantly improving the conversion rate of D-chiral inositol, a product of the reaction of muscle inositol to chiral inositol.

[0076] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. An enzyme preparation for catalyzing the synthesis of D-chiral inositol, characterized in that, The enzyme preparation has enzymatic activity that catalyzes the reaction of muscle inositol to produce D-chiral inositol. The enzyme preparation includes inositol dehydrogenase and ketoisomerase, and the amino acid sequence of the inositol dehydrogenase is shown in any of the following: (1) The amino acid sequence shown in SEQ ID NO.23; (2) The amino acid sequence shown in SEQ ID NO.24; (3) The amino acid sequence shown in SEQ ID NO.25; and / or, The amino acid sequence of the ketoisomerase is shown in any of the following: (1) The amino acid sequence shown in SEQ ID NO.29; (2) The amino acid sequence shown in SEQ ID NO.30; (3) The amino acid sequence shown in SEQ ID NO.

31.

2. The enzyme preparation according to claim 1, characterized in that, The enzyme activity ratio of the inositol dehydrogenase to the ketoisomerase is 0.5:(0.5~2).

3. The enzyme preparation according to claim 1, characterized in that, The method for modifying the enzyme activity of inositol dehydrogenase includes the following methods: (1) The amino acid sequence shown in SEQ ID NO.23 is obtained by changing the N to Q of the 123rd amino acid in the amino acid sequence shown in SEQ ID NO.1; (2) The amino acid sequence shown in SEQ ID NO.24 is obtained by mutating amino acid Y to W at position 285 of the amino acid sequence shown in SEQ ID NO.1; (3) The amino acid sequence shown in SEQ ID NO.25 is obtained by changing the N to Q amino acid at position 123 of the amino acid sequence shown in SEQ ID NO.1 and changing the Y to W amino acid at position 285.

4. The enzyme preparation according to claim 1, characterized in that, The method for modifying the enzyme activity of the keto isomerase includes the following methods: The amino acid sequence shown in SEQ ID NO.29 is obtained by mutating amino acid R to K at position 33 of the amino acid sequence shown in SEQ ID NO.3; The amino acid sequence shown in SEQ ID NO.30 is obtained by mutating amino acid E to D at position 239 of the amino acid sequence shown in SEQ ID NO.3; The amino acid sequence shown in SEQ ID NO.31 is obtained by changing the amino acid at position 33 from R to K, and simultaneously changing the amino acid at position 239 from E to D.

5. A method for preparing an enzyme preparation, used to prepare the enzyme preparation according to any one of claims 1 to 4, characterized in that, Includes the following steps: A recombinant strain containing both an inositol dehydrogenase encoding gene and a ketoisomerase encoding gene was constructed. The recombinant strain was fermented and cultured to induce the expression of inositol dehydrogenase and ketoisomerase.

6. The preparation method according to claim 5, characterized in that, Includes the following steps: Recombinant strains containing both inositol dehydrogenase and ketoisomerase genes were seed cultured to obtain seed liquid. The seed culture was inoculated into the fermentation medium at an inoculation rate of 1% to 5% by volume for fermentation culture. When the dissolved oxygen level rose, feeding was started, and the culture was continued until the OD reached 50%. 600 When the OD value reaches 65-75, add an inducing agent for induction culture until the OD value reaches 65-75. 600 The value stops increasing, and fermentation broth is obtained; The fermentation broth is centrifuged to collect the bacterial cells. After the bacterial cells are resuspended, the cells are broken up, centrifuged again, and the supernatant is collected to obtain the crude enzyme solution of the enzyme preparation.

7. The preparation method according to claim 6, characterized in that, The seed culture involves inoculating the recombinant strain into LB liquid medium and culturing it with shaking at 30℃~40℃ and 200rpm~300rpm for 5h~6h to obtain a seed culture; and / or, The fermentation culture temperature is 30℃~40℃, and the air volume is 0.5m³ / h. 3 / h~1m 3 / h, rotation speed of 200rpm~400rpm, pressure of 0.01MPa~0.05MPa, pH value of 6.5~7.5, dissolved oxygen content of 15%~35%; and / or, The induction culture temperature is 25℃~35℃, the inducer is L-arabinose, and the final concentration of the inducer is 1g / L~5g / L.

8. The use of the enzyme preparation according to any one of claims 1 to 4, characterized in that, The applications include catalyzing the reaction of muscle inositol to produce D-chiral inositol.

9. A method for preparing D-chiral inositol, characterized in that, Add muscle inositol and NAD to a 25mM~50mM buffer solution. + The crude enzyme solution containing metal ions and enzyme preparations is used to make the concentration of muscle inositol in the reaction system 50g / L~100g / L, and NAD+. + The concentration of the enzyme is 0.5mM~1mM, the concentration of the metal ions is 2mM~5mM, and the enzyme activity of the crude enzyme preparation is 5U / ml~25U / ml.

10. The preparation method according to claim 9, characterized in that, The metal ions include manganese ions, magnesium ions, or zinc ions; and / or, The buffer solution includes PBS buffer, Tris-HCl buffer, or HEPE buffer; and / or, The reaction temperature is 30℃~37℃, and the pH value is 7~9.