Gene therapy for Deschoenz syndrome
By targeting SBDS gene mutations with pegRNA and ngRNA and combining them with a lead editing system, iPSCs and HSPCs models were constructed, solving the problem of inaccurate gene mutation replication in existing technologies and achieving effective gene correction of SDS and restoration of hematopoietic stem cell function.
Patent Information
- Application Number
- CN202610621735.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-05-08
- Publication Date
- 2026-06-02
AI Technical Summary
Existing CRISPR/Cas9 technology has difficulty accurately replicating specific gene mutations in patients with Deutsche syndrome (SDS), which limits the authenticity of disease models and their therapeutic applications. Furthermore, allogeneic hematopoietic stem cell transplantation carries the risks of limited donor availability and complications.
By using pegRNA and ngRNA sequences to target SBDS gene mutation sites, and combining them with a lead editing system (such as PEmax or PE6) for in vitro and in vivo editing, iPSCs and HSPCs models were constructed to achieve precise correction of the SBDS gene.
The effectiveness of gene correction was validated in iPSCs and HSPCs models, and in vivo validation showed that the edited hematopoietic stem cells could restore normal function, providing a basis for the clinical treatment of SDS.
Smart Images

Figure CN122128309A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of clinical medical technology, and in particular to gene therapy methods for Deschosen syndrome. Background Technology
[0002] Shwachman-Diamond Syndrome (SDS) is a common inherited bone marrow failure syndrome (IBMFS) caused by mutations in the SBDS gene, an autosomal recessive genetic disorder. Patients are clinically characterized by exocrine pancreatic insufficiency, progressive bone marrow failure, and an increased predisposition to myeloid malignancies; neutropenia is the most common and clinically significant hematological abnormality.
[0003] Currently, CD34 in the bone marrow of SDS patients + The proportion of hematopoietic stem cells is significantly low, making it difficult to directly obtain sufficient primary cells from patients for pathogenesis research and treatment exploration. In existing cell model construction methods, the SBDS gene deletion caused by traditional CRISPR / Cas9 technology cannot accurately replicate specific compound heterozygous mutation types present in patients (such as c.183_184TA>CT and c.258+2T>C), limiting the realism and application value of disease models.
[0004] In terms of treatment, current clinical methods mainly rely on allogeneic hematopoietic stem cell transplantation, but this method is limited by factors such as the limited availability of donors and the high risk of transplantation-related complications. Therefore, establishing cell models that can accurately reflect the gene mutation characteristics of patients and developing novel gene correction strategies that do not rely on exogenous donor cells are of great significance for the basic research and clinical translation of SDS.
[0005] Therefore, this invention is proposed. Summary of the Invention
[0006] To address the aforementioned technical problems, this invention provides a gene therapy method for SDS. This invention provides highly efficient pegRNA / ngRNA sequences and their application methods, validating the effectiveness of gene correction at multiple levels both in vitro and in vivo, thus laying a technical foundation for the clinical treatment of SDS.
[0007] In order to achieve the objective of this invention, the following technical solution is adopted: The present invention provides pegRNA, the nucleotide sequence of which is shown in SEQ ID NO.1 or SEQ ID NO.2.
[0008] The pegRNA targets the SBDS gene.
[0009] Furthermore, the mutation site of the SBDS gene is selected from the c.258+2T>C mutation or the c.183_184TA>CT mutation; When the SBDS gene mutation site is c.258+2T>C, the nucleotide sequence of the pegRNA is shown in SEQ ID NO.1; when the SBDS gene mutation site is c.183_184TA>CT, the nucleotide sequence of the pegRNA is shown in SEQ ID NO.2.
[0010] The present invention also provides a DNA molecule encoding the above-described pegRNA.
[0011] The present invention also provides a biomaterial, wherein the biomaterial is any one of the following: (1) Contains the aforementioned DNA molecular expression cassette; (2) A recombinant vector containing the DNA molecule, or a recombinant vector containing the expression cassette of (1); (3) A transgenic cell line containing the DNA molecule described above, or a transgenic cell line containing the recombinant vector described in (2); (4) Recombinant bacteria containing the DNA molecule, or recombinant bacteria containing the expression cassette of (1), or recombinant bacteria containing the recombinant vector of (2).
[0012] The use of any one of the following: the pegRNA, the DNA molecule, or the biological material described above: (1) Application in the specific identification or targeting of SBDS gene mutation sites; (2) Its application in the preparation of drugs for the treatment of Diane-Schönlein syndrome; (3) Application in the preparation of a pilot editing system for the treatment of Das-Schönlein syndrome; (4) Application in in vitro lead editing of the SBDS gene.
[0013] The present invention also provides a pilot editing system, comprising at least one of the following: (1) the pegRNA mentioned above; (2) The biological material specifically includes a DNA molecular expression cassette; (3) The biological materials mentioned above specifically include recombinant vectors of expression cassettes.
[0014] Furthermore, the lead editing system also includes ngRNA, the nucleotide sequence of which is shown in SEQ ID NO.3 or SEQ ID NO.4.
[0015] When the pegRNA sequence is SEQ ID NO.1, the nucleotide sequence of the ngRNA is as shown in SEQ ID NO.3; when the pegRNA sequence is SEQ ID NO.2, the nucleotide sequence of the ngRNA is as shown in SEQ ID NO.4.
[0016] Furthermore, the pilot editing system also includes a pilot editor protein or nucleic acid encoding the pilot editor protein.
[0017] Furthermore, the lead editing protein is PEmax or PE6.
[0018] The present invention also provides an application of the pre-editing system described in any of the above claims, wherein the application is any one of the following: (1) Application in the specific identification or targeting of SBDS gene mutation sites; (2) Application in the treatment of Dietrich-Schönlein syndrome; (3) Application in the preparation of drugs for Dassler-Schönlein syndrome; (4) Application in in vitro lead editing of SBDS gene mutation sites.
[0019] This invention also provides an in vitro method for lead editing of SBDS gene mutation sites, which involves lead editing using the aforementioned pegRNA, DNA molecules, biological materials, or lead editing systems.
[0020] Furthermore, the pilot editing includes: in vitro pilot editing, in vivo pilot editing, or a combination thereof.
[0021] This invention also provides a method for constructing an induced pluripotent stem cell (iPSC) model, comprising the following steps: S1. Resuscitate bone marrow mononuclear cells from patients carrying the SBDS compound heterozygous mutations of c.183_184TA>CT and c.258+2T>C, and culture the cells. S2. OCT4, SOX2, c-MYC, and KLF4 were introduced into the cells obtained in S1 by electroporation, and then cultured in the feeder cells under low oxygen conditions. S3. Change the medium every two days, and select cells that form cell clone spheres for passage culture and identification.
[0022] This invention also provides a method for constructing a hematopoietic stem and progenitor cell (HSPC) model, comprising the following steps: Sa, Isolation of CD34 from bone marrow or peripheral blood of healthy donors+ Hematopoietic stem cells are cultured. Sb, SBDS gene mutations were constructed using an adenine base editor system; Sc, The product obtained from Sb is introduced into cells obtained from Sa via electroporation; The model's performance was validated by evaluating editing efficiency, SBDS expression, neutrophil-directed differentiation, and overall model performance.
[0023] Furthermore, the Sb specifically includes: Sb-1, synthesizes adenine base editor mRNA or adenine base editor ribonucleoprotein; Sb-2, Design and synthesize sgRNA targeting the c.258+2T>C site of the SBDS gene, the nucleotide sequence of which is shown in SEQ ID NO.5; Sb-3. The adenine base editor mRNA or adenine base editor ribonucleoprotein is mixed with sgRNA and incubated to form a ribonucleoprotein complex.
[0024] SEQ ID NO.5 TGTTACCCACCTGCTTACA The present invention has the following technical effects: The efficacy of the lead editing system in treating SDS in vitro was identified in both iPSCs and HSPCs models. In vivo, the therapeutic effect of lead editing on SDS was also identified by transplanting the edited hematopoietic stem cells, laying the foundation for clinical translation. Attached Figure Description
[0025] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.
[0026] Figure 1The study included screening of highly efficient pegRNAs / ngRNAs for PE editing to correct SBDS mutations. A represented screening of pegRNA libraries for correcting the c.183_184CT>TA mutation in the SBDS gene; B represented screening of pegRNA libraries for correcting the c.258+2C>T mutation; C represented validation of highly efficient pegRNAs for c.183_184CT>TA in the SBDS gene; D represented validation of highly efficient pegRNAs for c.258+2C>T in the SBDS gene; E represented the optimal ngRNA pairing between c.183_184CT>TA and highly efficient pegRNAs in the SBDS gene using the PE3max system; and F represented the optimal ngRNA pairing between c.258+2C>T and highly efficient pegRNAs in the SBDS gene using the PE3max system. Figure 2 : Identification results of SDS-iPSCs differentiating into the hematopoietic system; Figure 3 : Evaluation of the efficacy of PE gene editing therapy for SDS in patient-derived iPSC models, where A represents CD34 induced by iPSC differentiation. + Statistical counting of colonies from multiple hematopoietic lineages in cells; B represents flow cytometry analysis of CD34 in iPSC-induced differentiation. + Cells on day 12 of differentiation into neutrophils; Figure 4 : Evaluation of the efficacy of PE gene editing therapy for SDS in a patient-derived HSPCs model, where A is the flow cytometry analysis of cells from HSPCs on day 12 of differentiation into neutrophils; B is the fold increase of each cell population from HSPCs on day 12 of differentiation into neutrophils. Figure 5 ABE editor builds SBDS c.258+2T>C HSPCs model, where A represents the efficiency of introducing the SBDS c.258+2T>C mutation through ABE editing; B represents the mRNA expression of SBDS after ABE editing; C represents the protein expression of SBDS after ABE editing; and D represents the flow cytometry analysis of HSPCs differentiated into neutrophils on day 12 after ABE editing. Figure 6 Identification of multilineage hematopoietic reconstitution and differentiation capacity in HSPCs after PE gene editing, where A represents wild-type healthy donors (WT HSPCs); B represents the SBDS mutant model (SBDS). c.258+2T>C HSPCs); C represents the PE-edited corrected SBDS mutation model. c.258+2T>C Human cell chimerism and multilineage reconstitution in the bone marrow of immunodeficient NOG mice 16 weeks after HSPC transplantation. Detailed Implementation
[0027] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of this invention, and not all of them. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.
[0028] The following is a detailed explanation using specific embodiments: Example 1: High-efficiency screening and identification of pegRNA / ngRNA 1.1 Construction and preliminary screening of pegRNA library For the two mutation sites c.258+2T>C and c.183_184TA>CT in the SBDS gene, pegRNAs with different primer binding sites and reverse transcription template pairings were designed and pegRNA libraries were constructed. Each oligo contained a pegRNA sequence and its target site.
[0029] 293T cells stably expressing PE2 editors were infected with a library virus. 48 hours post-infection, puromycin was added for selection over 5 days. Cells were collected, genomic DNA was extracted, and PCR primers designed flanking the target site were used for amplification. The amplified products were subjected to next-generation sequencing to screen for the 8 pegRNAs with the highest editing efficiency. Figure 1 AB).
[0030] 1.2 Validation of Highly Efficient pegRNA A stable 293T cell line expressing SBDS gene mutations (carrying either c.258+2T>C or c.183_184TA>CT mutations) was constructed. The PEmax plasmid was co-transfected into these cell lines with preliminarily selected candidate pegRNAs (eight per site). Transfection was performed using liposome transfection reagent. Genomic DNA was extracted from cells 72 hours after transfection, and the editing efficiency of each pegRNA was analyzed by Sanger sequencing. Results showed that the pegRNA with the highest editing efficiency for the c.258+2T>C site (…) Figure 1 CD).
[0031] 1.3 Optimized screening of ngRNA In the PE3max system, multiple ngRNAs were designed for the most efficient pegRNAs screened at each site. PEmax, pegRNA, and ngRNA were co-transfected into the 293T cell line stably expressing mutant SBDS, and the pegRNA / ngRNA with the highest editing efficiency was screened. Figure 1EF), used to subsequently evaluate the correction effect of PE editing on pathogenic mutations of SBDS in disease models. Indels refer to insertion / deletion mutations generated near the correction site. The smaller the value, the lower the likelihood of additional mutations introduced by PE editing, and the safer PE editing treatment. Figure 1 C- Figure 1 As can be seen from F, the Indels value is extremely small, almost touching the X-axis, indicating the safety of PE treatment.
[0032] Finally, a pegRNA corrected for the c.258+2C>T site was obtained. SEQ ID NO.1 ACTGAAATCTGTAAGCAGGCGTTTAAGAGCTAAGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTCGAGAGAGTGGCACCGAGTCGGTGCTCCCACCTGCTTACAGATCGCGGTTTCTATCTAGTTACGCGTTAAACCAACTAGAATTTTTT ngRNA targeting the c.258+2C>T site for correction SEQ ID NO.3 TACGTTATAAATGGTTATTAGTTTAAGAGCTAAGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTCGAGAGAGTGGCACCGAGTCGGTGCTTTTTTTT pegRNA corrected for c.183_184CT>TA site SEQ ID NO.2 CTTCTTGGCAACCTGACCTTGTTTAAGAGCTAAGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTCGAGAGAGTGGCACCGAGTCGGTGCTAATGTTTCTAAAGGTCAGGTTGCGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAATTTTTT ngRNA corrected for c.183_184CT>TA site SEQ ID NO.4 GAAGATCTCATCAGTGCGTTGTTTAAGAGCTAAGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTCGAGAGAGTGGCACCGAGTCGGTGCTTTTTTTT Example 2: Functional validation of PE editing in an SDS patient-derived iPSCs model 2.1 Preparation of SDS-iPSCs Bone marrow mononuclear cells from SDS patients carrying the compound heterozygous mutations c.183_184TA>CT and c.258+2T>C were resuscitated and cultured in DMEM medium containing 10% fetal bovine serum for 3 days. Four reprogramming factors—OCT4, SOX2, c-MYC, and KLF4—were introduced into the cells via electroporation using a Lonza U008 electroporator. After electroporation, the cells were seeded onto fibroblast feeder layers and cultured in a hypoxic incubator (5% O2, 5% CO2, 37°C). The medium was changed every 2 days. After 10-12 days of culture, distinct cell clones were observed. Morphologically typical clones were selected and passaged for 2-3 generations. The presence of SBDS deletion was detected by RT-qPCR and Western blotting. Differentiation was induced to determine the cells' ability to differentiate into hematologic systems, confirming the acquisition of SDS iPSCs.
[0033] The obtained SDS-iPSCs were divided into 6×10 3 Cells / well were seeded in 12-well plates coated with vitronectin and cultured for 1 day in STEMdiffAPEL2 medium containing 3 μM CHIR99021, 4 ng / mL activin A, 10 ng / mL BMP4, and 10 μM ROCK inhibitor. On day 2, the medium was replaced with STEMdiffAPEL2 medium containing 40 ng / mL VEGF and cultured for 1 day. On day 3, FGF2 was added to a final concentration of 40 ng / mL without changing the original medium, and the plates were cultured until day 6. Flow cytometry analysis of CD34 was performed. + CD43 + CD45 + Cell ratio, experimental results as follows Figure 2 As shown.
[0034] 2.2 Functional Verification PEmax (the PEmax and PE6c coding sequences used in this embodiment were synthesized by Anshengda Biotechnology Co., Ltd., and the plasmid was constructed by ourselves), pegRNA, and ngRNA were delivered in plasmid form along with BCL-XL (disclosed in patent CN108103027B) to SDS-iPSCs via electrotransfer. The iPSCs before and after editing were directed to differentiate into hematopoietic stem cells, and CD34 was obtained by flow cytometry sorting. + After cells, further colony formation experiments were conducted ( Figure 3 A) and neutrophil differentiation experiment ( Figure 3 B), to examine whether the colony-forming ability and the proportion of mature neutrophils corrected by PE editing are restored compared with healthy donors (HD), and to assess the rescue ability of PE editing to correct SBDS gene mutations for disease phenotype.
[0035] Example 3: Functional validation of PE editing in HSPCs derived from SDS patients 3.1 Cell Isolation and Culture CD34 was obtained from bone marrow samples of SDS patients by immunomagnetic bead sorting. + HSPCs are cultured to obtain pre-cultured SDS HSPCs.
[0036] 3.2 PE Editing and Delivery The PE editing system—PE6c, pegRNA, ngRNA, and Vpx—was delivered as mRNA (using the HiScribe® T7 mRNA Kit with CleanCap® Reagent AG (NEB, USA)) to patient-derived HSPCs via electrotransfer. Neutrophil differentiation assays were then performed to assess whether the proportion of mature neutrophils was restored, evaluating the rescue capability of PE editing in correcting SBDS gene mutations for the disease phenotype. Figure 4 ).
[0037] 3.3 SBDS c.258+2T>C HSPCs model construction ABE8e protein was purified using a prokaryotic expression system. An sgRNA targeting the c.258+2T>C site of the SBDS gene (TGTTACCCACCTGCTTACA) was designed and synthesized. ABE8e and sgRNA were mixed at a 1:3 molar ratio and incubated to form a ribonucleoprotein complex. SBDS was obtained by electroporation into healthy donor-derived HSPCs. c.258+2T>CHSPCs were electroporated using a Lonza EO-100 electroporator. Genotyping, RT-qPCR, and Western blot analysis were performed on the electroporated cells to evaluate SBDS. c.258+2T>C Missing level of SBDS in HSPCs ( Figure 5 AC, and evaluated the model's ability to simulate the neutrophil-deficient phenotype in SDS patients through neutrophil differentiation experiments. Figure 5 D).
[0038] 3.3 Functional Verification PE6, pegRNA, ngRNA, and Vpx were delivered as mRNA to the constructed SBDS via electrotransfer. c.258+2T>C HSPCs were used to transplant edited cells into immunodeficient mice irradiated with 1.5 Gy via tail vein injection. Bone marrow was harvested 16 weeks later, and flow cytometry analysis was used to assess the multilineage reconstitution and differentiation capacity of PE-edited cells correcting the SBDS gene mutation compared to healthy donors. The therapeutic effect of PE editing was evaluated in vivo. The experimental results are as follows: Figure 6 A- Figure 6 As shown in Figure C, it can be seen from the graph that, compared with the healthy control group, SBDS c258+2T >C HSPC implantation capacity is severely impaired, human CD45 + The cell chimerism rate was only 0.02%, and the lineage distribution also showed significant abnormalities. Figure 6 AB); however, after being corrected by Prime Editing, human CD45 + Cell chimerism was increased to 49.1%, approaching the physiological level of healthy donor grafts (70.2%). The corrected HSPCs achieved stable multi-lineage reconstruction, and their lineage distribution was similar to that of the healthy donor control group. Figure 6 AC).
[0039] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the technical solutions of the embodiments of the present invention.
Claims
1. pegRNA, characterized by, The nucleotide sequence of the pegRNA is shown in SEQ ID NO.1 or SEQ ID NO.
2.
2. A DNA molecule, characterized by, The DNA molecule encodes the pegRNA as described in claim 1.
3. A biomaterial, characterized in that, The biomaterial is any one of the following: (1) Containing the DNA molecular expression cassette as described in claim 2; (2) A recombinant vector containing the DNA molecule of claim 2, or a recombinant vector containing the expression cassette of (1); (3) A transgenic cell line containing the DNA molecule of claim 2, or a transgenic cell line containing the recombinant vector of (2); (4) Recombinant bacteria containing the DNA molecule of claim 2, or recombinant bacteria containing the expression cassette of (1), or recombinant bacteria containing the recombinant vector of (2).
4. The use of any one of the following: the pegRNA of claim 1, the DNA molecule of claim 2, or the biological material of claim 3: (1) Application in the specific recognition or targeting of SBDS genes; (2) Its application in the preparation of drugs for the treatment of Diane-Schönlein syndrome; (3) Application in the preparation of a pilot editing system for the treatment of Das-Schönlein syndrome; (4) Application in in vitro lead editing of the SBDS gene.
5. A pilot editing system, characterized in that, Includes at least one of the following: (1) The pegRNA according to claim 1; (2) The biomaterial of claim 3 specifically includes the DNA molecular expression cassette of claim 2; (3) The biomaterial of claim 3 specifically includes a recombinant vector containing the DNA molecule of claim 2.
6. The pilot editing system according to claim 5, characterized in that, The lead editing system also includes ngRNA, the nucleotide sequence of which is shown in SEQ ID NO.3 or SEQ ID NO.
4.
7. The pilot editing system according to claim 5, characterized in that, The pilot editing system also includes a pilot editor protein or a nucleic acid encoding the pilot editor protein.
8. The pilot editing system according to claim 7, characterized in that, The lead editor protein is PEmax or PE6.
9. The application of the pilot editing system according to any one of claims 5-8, characterized in that, The application is any one of the following: (1) Application in the specific identification or targeting of SBDS gene mutation sites; (2) Application in the preparation of drugs for Das-Schönlein syndrome; (3) Application in in vitro lead editing of SBDS gene mutation sites.
10. An in vitro lead editing method targeting SBDS gene mutation sites, characterized in that, The method includes the step of performing a pilot editing using the pegRNA of claim 1, the DNA molecule of claim 2, the biological material of claim 3, or the pilot editing system of any one of claims 5-8.
Citation Information
Patent Citations
A method for high-efficiency blood cell reprogramming while simultaneously achieving gene editing
CN108103027B
PegRNA of targeted TRPV4 gene, pilot editing system and application of pegRNA and pilot editing system
CN119220536A
Methods and compositions for editing SBDS gene
US20250179464A1