Medicine for relieving 3-mcpd gestational toxicity and preparation method thereof

Abstract

The application provides a drug for relieving 3-chloro-1,2-propanediol (3-MCPD) toxicity during pregnancy and a preparation method thereof, and belongs to the technical field of detoxification or toxicity relieving drugs. Specifically, the effective component of the drug for relieving 3-MCPD toxicity during pregnancy is taurine. The application also provides an oral liquid for relieving 3-MCPD toxicity during pregnancy, which comprises taurine, L-arginine, sorbitol, citric acid, potassium sorbate, and the rest is deionized water. The application reverses the placental vascular aging induced by 3-MCPD, restores the taurine metabolic homeostasis, down-regulates the expression of aging-related proteins, and improves the vascular generation function, so as to effectively protect the placental vascular integrity and function, and prevent the fetal growth restriction caused by the exposure of environmental pollutants during pregnancy. The drug for relieving 3-MCPD toxicity during pregnancy has low cost and good effect, and provides a safe and effective intervention means for maternal and infant health.

Description

Technical Field

[0001] This invention belongs to the field of detoxification or toxicity-relieving drugs, specifically relating to a drug for relieving pregnancy toxicity of 3-MCPD and its preparation method. Background Technology

[0002] 3-Chloro-1,2-propanediol (3-MCPD) is a typical contaminant generated during food processing, primarily originating from oil refining, fermentation of condiments such as soy sauce, and chlorine-containing disinfectant treatments. It is widely present in edible oils, condiments, and baked goods. Studies have shown that 3-MCPD exhibits multi-organ toxicity, including nephrotoxicity, reproductive toxicity, and neurotoxicity. In particular, maternal exposure to 3-MCPD during pregnancy can cross the placental barrier and affect fetal development, leading to adverse pregnancy outcomes such as low birth weight, increased malformation rates, and abnormal neurodevelopment, posing a serious threat to maternal and infant health. Currently, interventions for 3-MCPD toxicity during pregnancy are extremely limited, and there are no dedicated protective agents available clinically. Therefore, developing safe and effective toxicity antagonists is of significant public health importance.

[0003] L-arginine is an organic compound with the molecular formula C6H2O. 14 N4O2 is a non-essential amino acid for adults, but its production rate in the body is relatively slow. It is an essential amino acid for infants and young children and has a certain detoxification effect.

[0004] Taurine, an essential sulfur-containing amino acid analogue, is widely found in animal tissues and seafood, exhibiting significant antioxidant, anti-inflammatory, and anti-apoptotic activities. However, taurine is highly water-soluble, rapidly absorbed in the gastrointestinal tract, but metabolized quickly, resulting in limited bioavailability. Furthermore, its slightly bitter taste leads to poor palatability in directly prepared oral solutions, affecting compliance in pregnant women. In addition, taurine in traditional oral solution formulations is susceptible to degradation by light and temperature, resulting in insufficient stability. Currently, there are no studies on using taurine for 3-MCPD pregnancy toxicity intervention, or combining taste-enhancing and encapsulation techniques to improve palatability and stability. Therefore, this invention aims to fill this technological gap. Summary of the Invention

[0005] In view of this, the present invention proposes a drug to alleviate the pregnancy toxicity of 3-MCPD, with taurine and L-arginine as the main active ingredients, and sorbitol, citric acid and potassium sorbate as other ingredients.

[0006] Based on the above-mentioned active ingredients, the present invention also provides an oral solution for alleviating pregnancy toxicity of 3-MCPD, wherein the oral solution for alleviating pregnancy toxicity of 3-MCPD includes taurine and the remainder is deionized water.

[0007] The concentration of taurine is 2.0~10.0 mg / mL.

[0008] The oral liquid also includes L-arginine, sorbitol, citric acid, and potassium sorbate.

[0009] The concentrations of L-arginine, sorbitol, citric acid, and potassium sorbate are 0-15.0 mg / mL, 0-3.0 mg / mL, 0-2.0 mg / mL, and 0-1.0 mg / mL, respectively.

[0010] This invention also provides a method for preparing the above-mentioned oral solution for alleviating pregnancy toxicity of 3-MCPD, comprising the following steps:

[0011] (1) Heat deionized water to 40~55℃, add taurine and L-arginine respectively, stir to dissolve, and obtain a mixed aqueous solution of taurine and arginine;

[0012] (2) Add sorbitol and citric acid in sequence, and continue stirring until completely dissolved. Adjust the pH of the solution to 3.5-4.0.

[0013] (3) After cooling to room temperature, add potassium sorbate, stir evenly, filter through 100~300 mesh filter cloth to remove impurities; aseptically fill, sterilize, and cool to obtain the finished product.

[0014] The taurine may be a taurine-β-cyclodextrin encapsulated compound.

[0015] The method for preparing the taurine-β-cyclodextrin encapsulated material is as follows:

[0016] (1) Take 10g of β-cyclodextrin, add 50mL of deionized water, heat to 60℃ and stir to dissolve, to obtain a saturated β-cyclodextrin aqueous solution;

[0017] (2) Dissolve 2.5g of taurine in 10mL of deionized water at a mass ratio of 1:4 to 1:4, and slowly add it dropwise to the above β-cyclodextrin aqueous solution. Stir at 60℃ for 2 hours.

[0018] (3) Cool to 4°C and refrigerate for 12 hours. Filter and collect the precipitate. Dry under vacuum at 60°C for 4 hours. Pulverize and pass through an 80-mesh sieve to obtain taurine-β-cyclodextrin encapsulated material.

[0019] Beneficial effects

[0020] This invention uses L-arginine and taurine, supplemented with citric acid and preservatives, and is formulated into an oral solution. It is specifically designed to help improve fetal growth restriction caused by maternal exposure to 3-MCPD. The components work synergistically, with a clear mechanism and stable compatibility.

[0021] In terms of mechanism, sorbitol, as a basic excipient, mainly functions as a solvent, sweetener, and osmotic pressure regulator, improving amino acid solubility and formulation stability, and enhancing palatability to improve compliance. L-arginine, through the synthesis of nitric oxide, dilates placental blood vessels, increases uteroplacental blood flow, and addresses placental hypoperfusion, one of the core causes of fetal growth restriction (FGR). Taurine compensates for insufficient fetal amino acid synthesis, exerts a cell-protective effect, assists in enhancing placental nutrient transport function, and protects fetal neural and overall development. In terms of efficacy, this formula, through the synergistic effect of multiple components, effectively improves placental function and nutrient supply, alleviates placental hypoperfusion, and specifically intervenes in the pathogenesis of FGR. Simultaneously, sorbitol and L-arginine have excellent compatibility, strong formulation stability, and a pleasant taste, allowing for oral supplementation to continuously provide the necessary nutrients for both mother and fetus, helping to reduce the risk of fetal growth restriction, promote normal fetal growth and development, and meet the nutritional intervention needs during pregnancy.

[0022] This invention is the first to systematically verify the damage mechanism of 3-MCPD on the maternal oxidative stress system, placental barrier function and fetal development during pregnancy, providing a clear target for subsequent toxicity intervention and filling the detailed gap in the study of 3-MCPD toxicity during pregnancy.

[0023] Safe and effective antagonistic effect: Experiments have shown that it can significantly improve adverse pregnancy outcomes caused by 3-MCPD by enhancing the body's antioxidant capacity and inhibiting cell apoptosis.

[0024] Studies have found that L-arginine can alleviate cellular damage caused by 3-MCPD to some extent. Its possible mechanism of action lies in the fact that L-arginine can regulate oxidative stress responses in the body, enhance the activity of antioxidant enzymes, and reduce the production of free radicals, thereby mitigating oxidative damage induced by 3-MCPD. Simultaneously, L-arginine can also affect intracellular signaling pathways, promoting cell repair and regeneration, and improving cellular dysfunction caused by 3-MCPD exposure.

[0025] Excellent palatability and high compliance: The bitterness of taurine oral solution has been improved by adding natural flavoring agents (sorbitol and citric acid). According to sensory evaluation, the palatability score reached 8.6 out of 10, which solved the problem of poor palatability of traditional preparations. It is especially suitable for pregnant women.

[0026] High stability and high bioavailability: After using β-cyclodextrin encapsulation technology, the degradation rate of taurine under light and high temperature conditions was reduced by more than 60%, and the encapsulated product was slowly released in the gastrointestinal tract, prolonging the action time of taurine. The bioavailability was increased by 52% compared with the unencapsulated group, further enhancing the intervention effect.

[0027] The preparation process is simple and the cost is low: the oral liquid preparation and encapsulation process both use conventional equipment, are easy to operate, and the raw materials are readily available, making them suitable for industrial production and with broad market application prospects.

[0028] The oral solution of this invention is simple and convenient to take. With reasonable dosage and course of treatment, it can effectively alleviate the pregnancy toxicity of 3-MCPD, reduce the occurrence of adverse pregnancy outcomes, and provide strong protection for maternal and infant health. Attached Figure Description

[0029] Figure 1. Effects of different doses of 3-MCPD on the body weight and fetal growth and development of pregnant rats. (A) Body weight of pregnant rats; (B) Food intake of pregnant rats; (C) Water intake of pregnant rats; (D) Fetal body weight; (E) Fetal length; (F) Rate of fetal growth restriction (FGR%).

[0030] Where FGR= ×100% Growth restriction standard: 90% of the average weight of each litter of fetuses in the control group. If the weight is less than this number, it is considered that the fetus is in growth restriction.

[0031] Figure 2. Effects of different doses of 3-MCPD exposure on placental injury, including: (A) placental weight; (B) placental diameter; (C) placental hematoxylin and eosin staining (H&E) images showing blood sinuses and the percentage of blood sinus area (%) and the vascular index marker CD34 immunohistochemical staining; (D) percentage of placental labyrinth area to total placental area (%); (E) ratio of labyrinth (LZ) cross-sectional thickness to basal layer cross-sectional thickness; (F) blood sinus area ratio; (G) number of CD34-positive vessels in the placental labyrinth; (H) placental VEGF protein level detected by Western blotting; (I) VEGF / β-Actin quantification results; (JL) human umbilical vein endothelial cells (HUVEC) cells exposed to different concentrations of 3-MCPD (2.5... (mM and 5mM) were treated for 24 h for in vitro tube formation experiments; (J) Representative diagram of in vitro tube formation; (K) Total tube length; (L) Number of branch points; (M) SA-β-Gal staining to detect placental labyrinth aging; (N) Percentage of SA-β-Gal positive area; (O) Immunoblotting to detect placental p16 and p21 protein expression; (PQ) Quantitative results of p16 and p21 with β-Actin.

[0032] Figure 3The effects of different doses of 3-MCPD on HUVEC cells treated for 24 h were investigated. (A) Cell viability of HUVEC cells after treatment with different doses of 3-MCPD was detected by CCK8 assay; (B) HUVEC cell senescence was detected by SA-β-Gal staining; (C) Number of SA-β-Gal positive cells was detected; (D) Expression of VEGF, p16, and p21 proteins in HUVEC cells was detected by Western blotting; (E) Quantitative results of VEGF / β-Actin; (FG) Quantitative results of p16 and p21 / β-Actin were obtained.

[0033] Figure 4 Transcriptome sequencing of placenta exposed to 3-MCPD during pregnancy, including (A) PCA plot; (B) volcano plot; (C) KEGG enrichment pathway; (D) GSEA showing that taurine metabolism was significantly downregulated in the high-dose group compared with the control group; (E) heatmap of taurine and hypothalamic acid metabolic pathways; (F) expression level of Fmo1 mRNA in placenta; (G) expression level of Fmo4 mRNA in placenta; (H) expression level of Fmo5 mRNA in placenta; (I) taurine content in placenta; (J) expression level of Fmo1 mRNA in HUVEC cells; (K) taurine content in HUVEC cells.

[0034] Figure 5 Effects of exogenous taurine supplementation on 3-MCPD-treated HUVEC cells; (A) SA-β-Gal staining to detect cell senescence; (B) Number of SA-β-Gal positive cells; (C) Immunoblotting to detect VEGF, p16, and p21 protein expression in HUVEC cells; (DF) Quantitative results of p16, p21, and VEGF / β-Actin; (G) Representative diagram of in vitro tube formation experiment; (H) Total tube length; (I) Number of branch points. Detailed Implementation

[0035] The present invention will be described in detail below with reference to examples. All methods and techniques are conventional.

[0036] In this invention, 3-MCPD (99% purity) and taurine (99% purity) were purchased from Sigma-Aldrich; cell culture-related reagents (ECM medium, fetal bovine serum, etc.) were purchased from ScienCell; SA-β-Gal staining kit, taurine ELISA kit, and immunohistochemistry and Western blotting-related antibodies (CD34, VEGF, p16, p21, etc.) were purchased from Beyotime, Kelu Biotechnology, Abcam, and CST, respectively.

[0037] The methods for measuring the various indicators in this invention are as follows.

[0038] ICR mice (8 weeks old; males weighing 36-38 g, females weighing 28-32 g) were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. Mice were housed in a standard environment (temperature 22±2℃, relative humidity 50±5%, 12h light / dark cycle) with free access to food and water. The animals were fed a compound feed for growth and reproduction (purchased from Beijing Keao Xieli Feed Co., Ltd.). After one week of acclimatization, they were mated together at a female-to-male ratio of 2:1. The vulvar plug was examined the following morning; the day the plug was found was designated as day 0 of gestation (GD0). Pregnant mice were randomly divided into three groups: a control group given saline, and experimental groups given 15 or 30 mg / kg body weight / day of 3-MCPD (107271, Sigma-Aldrich), with 17-21 mice in each group. From GD0 to GD17, different concentrations of 3-MCPD were administered daily morning by gavage at 1% of body weight. During the experiment, pregnant mice were handled gently, and their weight and food intake were recorded daily.

[0039] At gestational age GD18, pregnant mice were anesthetized via intraperitoneal injection (2.5% tribromoethanol). Fetal weight, crown-rump length, placental weight, and diameter were recorded. Maternal blood, placental tissue, and fetal serum were collected and stored at -80°C for further experiments. All animal experiments were conducted in accordance with the guidelines established by the Society for Laboratory Animal Science and the Laboratory Animal Science Center of Anhui Medical University.

[0040] If the average fetal weight in the treatment group is less than 90% of the average fetal weight in the control group, then the mouse fetus is considered to have growth restriction.

[0041] Calculate the fetal growth restriction rate for each litter: divide the number of fetuses with fetal growth restriction in each litter by the total number of live fetuses in each litter, then multiply by 100%.

[0042] HUVECs were purchased from Nanjing Senbeijia Biotechnology Co., Ltd. This cell line was cultured in ECM (ScienCell, USA) medium supplemented with 5% fetal bovine serum, 1% endothelial growth factor, and 1% penicillin / streptomycin, and maintained in a 37℃, 5% CO2 incubator. Experiment 1: To establish a senescence model of HUVECs induced by 3-MCPD, cells were treated with 3-MCPD for 24 h. Experiment 2: To investigate the intervention effect of taurine (T0625, Sigma-Aldrich) on 3-MCPD-induced vascular senescence, HUVECs were co-treated with 3-MCPD and taurine for 24 h.

[0043] Cell viability was assessed using a CCK8 (BS350B, Biosharp, China) instrument. HUVECs were seeded at a density of 8000 cells per well in 96-well plates. For the 3-MCPD treatment groups, cells were incubated with different concentrations of 3-MCPD (0-100 mM) for 24 h. For the taurine treatment groups, cells were co-incubated with different concentrations of taurine (0, 5, 10, 20, 40, 80, and 160 mM) and 3-MCPD (5 mM) for 24 h. The supernatant was discarded, and 110 µL of CCK8 working solution (10 µL CCK8:100 µL ECM) was added, followed by incubation at 37°C for 4 h. Finally, cell viability was assessed according to the CCK8 manufacturer's instructions.

[0044] Placental tissue was immersed in 4% paraformaldehyde, fixed on a shaker at room temperature for 24 h, and then preserved in 70% ethanol at 4 °C. After embedding, 5 μm sections from the center of the placenta were collected onto glass slides, baked at 60 °C for 30 min, dehydrated in a gradient of xylene and ethanol, and stained with hematoxylin and eosin (H&E). Six pregnant mice were randomly selected from each group, and one placenta was taken from each mouse for histological examination. The labyrinth zone (LZ) and sinusoidal development were observed by randomly selecting microscopic fields of placental tissue using an Olympus microscope. The area and thickness of the labyrinth zone and the area of ​​the sinusoids were analyzed using ImageJ (Media Cybernetics, USA) software.

[0045] Paraffin-embedded placental tissue was dewaxed by baking at 60°C for 30 min, and then hydrated sequentially with xylene and graded ethanol (100%–30%). After antigen retrieval, sections were soaked in 0.01 M sodium citrate solution and boiled for 5 min (repeated 6 times), then blocked with sheep serum for 30 min, and incubated overnight with CD34 (1:200) at 4°C. The sections were then washed and incubated at 37°C for 20 min using a rabbit anti-immunohistochemistry kit (SP0021, Solarbio, China) according to the manufacturer's instructions. A chromogenic reaction was performed using a diaminobenzidine chromogenic kit (ZLI-9019; OriGene, China), and counterstained with Harris-Mayer hematoxylin. The number of CD34-positive vessels was counted and the average number of positive vessels was calculated using ImageJ software.

[0046] Total protein was extracted from mouse placenta and HUVECs using RIPA lysis. Protein content was determined using a BCA assay kit (23225, Thermo). After separation by 12.5% ​​SDS-PAGE, the total protein was transferred to a PVDF membrane. The PVDF membrane was incubated with 5% skim milk powder at room temperature for 1 h, then incubated overnight at 4°C with primary antibodies against VEGF (1:1000, ab51745, Abcam), p16 (1:1000, ab51243, Abcam), p21 (1:1000, ab109199, Abcam), and β-actin (1:5000, 60008-1-lg, Proteintech). After washing with TBS containing 0.05% Tween-20, the membrane was incubated with secondary antibodies (goat anti-rabbit IgG or goat anti-mouse IgG) (BL1600A, Biosharp, China) at room temperature for 1–2 h. Finally, the protein was developed using the Bio-Rad ChemiDoc™ Touch imaging system. β-actin was used as an internal control for sample loading, and ImageJ software was used to analyze the grayscale values ​​of the target proteins to calculate the relative quantification of each protein.

[0047] The activity of the senescent cell marker SA-β-Gal was detected using a senescent cell histochemical staining kit (C0602, Beyotime biotechnology, China). A simplified procedure was as follows: frozen sections of HUVECs and mouse placenta were thawed at room temperature for 30 min, fixed for 15 min, washed with PBS, and then incubated overnight at 37°C with staining solution. Images of SA-β-Gal positive staining were captured using an Olympus microscope.

[0048] The endothelial tube-forming ability of HUVECs was assessed using a tube formation assay. First, 100 μL of matrix gel (HY-K6002, MCE, USA) was added to the bottom of a pre-cooled 24-well plate and incubated at 37°C for 30 min. Then, 15 × 10⁶ cells were seeded into each well. 4 Cells were cultured in plates at 37°C with 5% carbon dioxide for 6 hours. The plates were then observed directly under a microscope. ImageJ software was used to analyze the total network length and number of branch points of the vascular cells.

[0049] Total RNA was extracted from mouse placenta in the control and 3-MCPD-H groups using Trizol™ reagent, with four replicates in each group. RNA purity and concentration were assessed using a NanoDrop 2000 spectrophotometer via the A260 / A280 ratio, and integrity (RIN > 8.0) was confirmed using an Agilent 2100 bioanalyzer. After ribosomal RNA removal, sequencing libraries were constructed using the VAHTS Universal V5 RNA Sequencing Kit (Vazyme), and paired-end (150 bp) sequencing was performed on an Illumina NovaSeq 6000 platform. Raw reads were normalized to kilobase fragments per million mapped reads (FPKM). Differential gene expression analysis was performed using DESeq software, with |log2FoldChange| > 1.2 and p < 0.05 as the criteria for differentially expressed genes (DEGs). Functional enrichment analysis was performed on Gene Ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG), and Gene Set Enrichment Analysis (GSEA) using clusterProfiler.

[0050] The taurine content in mouse placental tissue and HUVECs was detected using a taurine ELISA kit (ELK8229, ELK Biotechnology). Mouse placental tissue was homogenized in cooled PBS and centrifuged at 4°C and 12000 xg for 10 min. The supernatant was collected. Following the manufacturer's instructions, 50 μL of the supernatant was dispensed for taurine content determination using a microplate reader at 450 nm.

[0051] Mouse placental tissue and HUVECs were lysed using TRLzol (15596026, Thermo), and total RNA was extracted using 1-bromo-3-chloropropane (BCP) and isopropanol. After centrifugation at 4°C and 15000 xg for 10 min, the RNA precipitate was washed three times with cooled 75% ethanol. Total RNA was reverse transcribed into cDNA using an RT reverse transcription kit (Takara, RR037A). Real-time quantitative PCR was performed using the TB Green® Premix Ex Taq™ II kit (Takara, RR820A). Gene-specific primer sequences are detailed in Table 1.

[0052] Table 1: Primers for real-time RT-PCR

[0053] Genes Sequences (5′-3′) Species 18s F: TAACCCGTTGAACCCCATTR: CATCCAATCGGTAGTAGCG Mouse Fmo1 F:AAACAAGCATAGCGGGTTTGR:ATCCGGTTTTGCGTTGATAG Mouse Fmo4 F:CGGAGCAGCTCATTAAAAGGR:CTGAGTGAGCTCGTCCATGT Mouse Fmo5 F:TGCCCTCACAAAGTGAAATGR:GCTGGCTGTCCACATACCTT Mouse 18s F:CGGCTACCACATCCAAGGAAR:GCTGGAATTACCGCGGCT Human Fmo1 F:GTGGGGTGGAGCTTGTGAATAR:CCAAGGTCATCGCTCCTCTC Human

[0054] All data are expressed as mean ± standard error (SEM). After normality testing, one-way ANOVA was performed between the treatment and control groups. If a significant difference was found, the Dunnett-t test was performed. When data did not conform to a normal distribution, the nonparametric Kruskal-Wallis test was used. Statistical analysis and graph creation were performed using GraphPad Prism 10.0 software (GraphPad, USA). The significance level was set at P < 0.05.

[0055] The protective effect of taurine was verified through in vitro experiments.

[0056] HUVEC cells were purchased from Nanjing Senbeijia Biotechnology Co., Ltd. The cell line was cultured in ECM (ScienCell, USA) medium supplemented with 5% fetal bovine serum, 1% endothelial growth factor, and 1% penicillin / streptomycin, and maintained in a 37°C, 5% CO2 incubator.

[0057] Cell viability was assessed using a CCK8 assay (BS350B, Biosharp, China) to screen for suitable concentrations. HUVECs were seeded at a density of 8000 cells per well in 96-well plates. For the 3-MCPD treatment group, cells were incubated with different concentrations of 3-MCPD (0-100 mM) for 24 h. For the taurine treatment group, cells were co-incubated with different concentrations of taurine (0, 5, 10, 20, 40, 80, and 160 mM) and 3-MCPD (5 mM) for 24 h.

[0058] Placental development was assessed using hematoxylin and eosin (H&E) staining. The procedure was briefly as follows: Fresh placental tissue was immersed in 4% paraformaldehyde and fixed on a shaker at room temperature for 24 hours. After fixation, the tissue was dehydrated via a gradient of ethanol and embedded in paraffin, with sections 5 μm thick. Six pregnant mice were randomly selected from each group, and one placenta was harvested from each mouse for histological examination. The labyrinthine zone (LZ) and sinusoidal development were observed using randomly selected microscopic fields of placental tissue under an Olympus microscope. Image J (MediaCybernetics, USA) software was used to analyze parameters such as the area and thickness of the labyrinthine zone and the area of ​​the sinusoids.

[0059] Angiogenesis was assessed using a tube formation assay to detect the endothelial-like angiogenesis capacity of HUVEC cells. First, 100 μL of matrix gel (HY-K6002, MCE, USA) was added to the bottom of a pre-chilled 24-well plate and allowed to solidify at 37°C for 3 h. Then, 150,000 cells were seeded into each well. The culture plates were incubated at 37°C with 5% CO2 for 4 h. Subsequently, the cells were observed directly under a microscope. ImageJ software was used to analyze the total length of the tubule network and the number of branching points.

[0060] Total protein was extracted from mouse placenta and HUVECs using RIPA lysis. Protein content was determined using a BCA assay kit (Thermo, 23225). After separation by 12.5% ​​SDS-PAGE, the total protein was transferred to a PVDF membrane. The PVDF membrane was incubated with 5% skim milk powder at room temperature for 1 h, followed by incubation with primary antibodies against VEGF, p16, p21, and β-actin, respectively. After washing with TBS containing 0.05% Tween-20, the membrane was incubated with secondary antibodies (goat anti-rabbit IgG or anti-mouse IgG) (BL1600A, Biosharp, China) at room temperature for 1–2 h. Finally, the images were developed using a Bio-Rad ChemiDoc™ Touch imaging system. β-actin was used as an internal control, and the grayscale values ​​of the target proteins were analyzed using ImageJ software to calculate the relative quantification of each protein.

[0061] Staining was performed using the SA-β-Gal staining kit (C0602, Beyotime biotechnology, China). A simplified procedure was as follows: frozen sections of HUVECs and mouse placenta were fixed at room temperature for 15 min, washed with PBS, and then incubated overnight at 37°C with staining solution. Staining images were captured using an Olympus microscope.

[0062] The taurine content in mouse placental tissue and HUVECs was detected using a taurine ELISA kit. Mouse placental tissue was homogenized in cooled PBS and centrifuged at 4°C and 12000 xg for 10 min. The supernatant was collected. Following the manufacturer's instructions, 50 μL of the supernatant was collected for taurine content detection. The taurine content was measured at 450 nm using a microplate reader.

[0063] Example 1

[0064] This embodiment explores the harmful effects of 3-MCPD on pregnancy from different aspects, and the specific methods are as follows.

[0065] First, an 8-week-old female ICR mouse model of 3-MCPD gestational toxicity was established by exposing the mice to 3-MCPD. The results are as follows: Figure 1 As shown, different dose groups had no significant effects on the weight, diet, and water intake of pregnant mice. In the 3-MCPD exposure group, fetal weight and length were significantly reduced, and the incidence of fetal growth restriction (FGR) was significantly increased, by 16.05%. These results indicate that 3-MCPD exposure during pregnancy induces fetal growth restriction.

[0066] Secondly, the effects of 3-MCPD exposure during pregnancy on the placenta were further investigated, and the results were as follows: Figure 2As shown, there was no significant difference in placental weight and diameter among different dose groups. Morphological analysis of the placenta using H&E staining revealed that the 3-MCPD-H group showed a significant decrease in the percentage of placental labyrinth area to total placental area, labyrinth thickness, and labyrinth sinus area. Furthermore, immunohistochemical examination of the placental vascular development marker CD34 showed a significant reduction in the number of CD34-positive vessels compared to the control group. This result further confirms a significant downregulation of the expression of the important placental angiogenesis marker (VEGF). Simultaneously, SA-β-Gal staining of the placenta showed that 3-MCPD significantly increased the percentage of SA-β-Gal-positive area in the placenta. Further analysis indicated that, compared to the control group, the expression levels of aging-related proteins p16 and p21 were significantly upregulated in the placenta exposed to 3-MCPD. These in vivo results demonstrate that 3-MCPD exposure during pregnancy leads to placental vascular damage and aging.

[0067] Third, an in vitro 3-MCPD exposure model was established to observe the effects at the cellular level, and the results were as follows: Figure 3 As shown, after 24 hours of treatment with different concentrations of 3-MCPD, HUVEC cell viability decreased in a dose-dependent manner when the 3-MCPD concentration exceeded 1 mM. To avoid excessive cell death, exposure doses of 2.5 mM and 5 mM were selected for subsequent experiments. An in vitro angiogenesis model was established to evaluate the effect of 3-MCPD on angiogenesis. Angiogenesis experiments were performed on Matrigel gels to observe the effect of 3-MCPD on HUVEC cell angiogenesis. When cells were treated with 5 mM of 3-MCPD, the total length and number of branching points of HUVEC cells were significantly reduced. Then, SA-β-Gal staining of HUVEC cells showed a significant increase in the number of SA-β-Gal positive cells in 3-MCPD-treated HUVECs, and the expression of senescence-related proteins p16 and p21 was also significantly upregulated. The results indicate that 3-MCPD exposure leads to senescence of vascular cells.

[0068] Based on the above data, it is indicated that exposure to 3-MCPD during pregnancy induces placental vascular aging, leading to fetal growth restriction.

[0069] Example 2

[0070] This embodiment provides a rescue experiment for the developmental toxicity of taurine against 3-MCPD.

[0071] Experiment 1: To further investigate the mechanism by which 3-MCPD induces placental vascular aging, transcriptome analysis was performed on the placentas of the GD18 control group and the 3-MCPD-H group using RNA sequencing technology. The results are as follows: Figure 4As shown, principal component analysis (PCA) revealed significant differences between the 3-MCPD-H group and the control group. A total of 422 differentially expressed genes were identified in the volcano plot, including 129 upregulated genes and 293 downregulated genes. Among the top 20 KEGG-enriched pathways, taurine and hypotaurine metabolic pathways were closely related to aging. GSEA showed that, compared with the control group, taurine and hypotaurine metabolic pathways in the placenta showed a significant negative enrichment after 3-MCPD exposure. The heatmap of taurine and hypotaurine metabolic pathways also showed that most genes were downregulated. Fmo1 is a key enzyme in the conversion of hypotaurine to taurine. Further verification of Fmos mRNA levels in the placenta revealed a dose-dependent significant downregulation of Fmo1 mRNA expression after 3-MCPD exposure during pregnancy. Furthermore, taurine content in the placenta was significantly reduced after 3-MCPD exposure. In addition, taurine content was significantly decreased and Fmo1 mRNA expression was downregulated in 3-MCPD-treated HUVEC cells. These results indicate that 3-MCPD mediates vascular aging by downregulating taurine levels through low Fmo1 expression.

[0072] Experiment 2: To study the intervention effect of taurine on 3-MCPD-induced vascular aging, the specific method is as follows: HUVECs were treated with 3-MCPD (5mM) and taurine (5mM) for 24h.

[0073] Experimental results show that exogenous taurine supplementation can improve angiogenesis and cellular senescence in cells treated with 3-MCPD. For example... Figure 2 As shown, exogenous taurine supplementation significantly decreased the number of SA-β-Gal positive cells after 3-MCPD treatment of HUVEC cells. Furthermore, taurine significantly downregulated the levels of senescence proteins (p16 and p21) in 3-MCPD-treated HUVEC cells. In addition, taurine supplementation rescued 3-MCPD-induced angiogenesis impairment. In taurine-supplemented HUVEC cells, the disruption of the total length and branch number of the vascular cell network induced by 3-MCPD was significantly reduced. These results indicate that taurine supplementation improves cellular angiogenesis and cellular senescence induced by 3-MCPD exposure.

[0074] Example 3

[0075] This embodiment provides an oral liquid containing taurine, L-arginine, and 3-MCPD, natural flavoring agents, to improve palatability. The specific method is as follows:

[0076] A 3-MCPD detoxification oral solution has the following formula: taurine 10.0 mg / mL, L-arginine 5.0 mg / mL, sorbitol 0.5 mg / mL, citric acid 1.5 mg / mL, potassium sorbate 0.3 mg / mL, and the remainder is deionized water.

[0077] The preparation method of 3-MCPD detoxification oral solution is as follows:

[0078] (4) Heat deionized water to 40~55℃, add taurine and L-arginine respectively, stir and dissolve for 30 min to obtain a taurine-arginine mixed aqueous solution;

[0079] (5) Add sorbitol and citric acid in sequence, and continue stirring for 20 minutes until completely dissolved. Adjust the pH of the solution to 3.5-4.0.

[0080] (6) After cooling to room temperature, add potassium sorbate, stir evenly, and filter through a 100-300 mesh filter cloth to remove impurities;

[0081] (7) Aseptically fill into brown oral liquid bottles, sterilize at 100°C for 15 minutes, and obtain the finished product after cooling.

[0082] Palatability evaluation: The sensory evaluation results of volunteers showed that the bitterness score of the oral liquid was 2.3 (significantly lower than the 6.8 score of the group without flavoring agent), the sweetness coordination score was 8.5, the overall acceptability score was 8.6, and the palatability was good.

[0083] The first group consisted of 10-12 ICR mice (8 weeks old; males weighing 36-38 grams and females weighing 28-32 grams). During the GD0-GD17 period, different concentrations of 3-MCPD were administered by gavage at 1% of body weight every morning.

[0084] The second group consisted of 10-12 ICR mice (8 weeks old; males weighing 36-38 grams and females weighing 28-32 grams). During the GD0-GD17 period, different concentrations of 3-MCPD were administered by gavage at 1% of body weight every morning, and at the same time, the above-mentioned 3-MCPD detoxification oral solution was administered by gavage at 1% of body weight every 6 hours.

[0085] The third group consisted of 10-12 ICR mice (8 weeks old; males weighing 36-38 grams and females weighing 28-32 grams). They were fed normally according to the specific implementation method.

[0086] The incidence of fetal growth restriction (FGR) was measured after feeding. The results showed that, compared with the third group, the incidence of FGR in the first group was 20%–81%, and the incidence of FGR in the second group was 8%–39%.

[0087] Therefore, it can be seen that the 3-MCPD detoxification oral solution provided in this embodiment has a significant detoxification effect.

[0088] Based on the principle, this embodiment also provides several other formulations.

[0089] Formula 1: Taurine 10.0 mg / mL, L-arginine 5.0 mg / mL, sorbitol 0.5 mg / mL, citric acid 1.5 mg / mL, potassium sorbate 0.3 mg / mL, with the remainder being deionized water.

[0090] Formula 2: Taurine 8.0 mg / mL, L-arginine 10.0 mg / mL, citric acid 2.0 mg / mL, potassium sorbate 1.0 mg / mL, with the remainder being deionized water.

[0091] Formula 3: Taurine 5.0 mg / mL, Sorbitol 3.0 mg / mL, Citric Acid 0.5 mg / mL, Potassium Sorbitate 0.1 mg / mL, with the remainder being deionized water.

[0092] Formula 4: Taurine 3.0 mg / mL, L-arginine 6.0 mg / mL, sorbitol 3.0 mg / mL, potassium sorbate 0.3 mg / mL, with the remainder being deionized water.

[0093] Formula 5: Taurine 2.0 mg / mL, L-arginine 15.0 mg / mL, sorbitol 0.2 mg / mL, citric acid 1.0 mg / mL, with the remainder being deionized water.

[0094] Example 4

[0095] This embodiment uses the saturated aqueous solution method to encapsulate taurine with β-cyclodextrin, optimizes process parameters, and prepares an encapsulated oral solution. The specific method is as follows:

[0096] Encapsulation process: (1) Take 10g of β-cyclodextrin, add 50mL of deionized water, heat to 60℃ and stir to dissolve, to obtain a saturated β-cyclodextrin aqueous solution; (2) Dissolve 2.5g of taurine in 10mL of deionized water at a mass ratio of 1:4 to 1:4, slowly add it dropwise to the above β-cyclodextrin aqueous solution, and stir at 60℃ for 2h; (3) Cool to 4℃ and refrigerate for 12h, filter to collect the precipitate, vacuum dry at 60℃ for 4h, pulverize and pass through an 80-mesh sieve to obtain taurine-β-cyclodextrin encapsulated material.

[0097] Evaluation of embedding effect: HPLC analysis showed an embedding rate of 82.5%; scanning electron microscopy showed that the embedded material consisted of regular spherical particles with smooth surfaces and no obvious taurine crystals attached.

[0098] Preparation of encapsulated oral solution: 2.5g of the above-mentioned taurine-β-cyclodextrin encapsulant (containing 0.5g of taurine), 1.0g of L-arginine, 0.5g of sorbitol, 1.5g of citric acid, and 0.3g of potassium sorbate were added to deionized water and brought to a final volume of 1L. The mixture was then sterilized and filled according to the preparation method in Example 3 to obtain the encapsulated oral solution.

[0099] Stability evaluation: After being placed at 45℃ and under light for 30 days, the taurine residue rate in the encapsulated oral solution was 89.2%, which was significantly higher than the 58.6% in the unencapsulated oral solution, indicating that the encapsulation technology can significantly improve the stability of taurine.

[0100] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A use of taurine, characterized in that: Taurine is used to prepare drugs that alleviate pregnancy toxicity of 3-MCPD.

2. The use of taurine according to claim 1, characterized in that: The taurine in question is an oral taurine solution with a concentration of 2.0~10.0 mg / mL.

3. The use of taurine according to claim 1, characterized in that: The taurine was encapsulated with β-cyclodextrin.

4. An oral solution for alleviating pregnancy toxicity of 3-MCPD, characterized in that: The oral solution for alleviating pregnancy toxicity of 3-MCPD includes taurine, with the remainder being deionized water.

5. The oral solution for alleviating pregnancy toxicity of 3-MCPD according to claim 4, characterized in that: The concentration of taurine is 2.0~10.0 mg / mL.

6. The oral solution for alleviating pregnancy toxicity of 3-MCPD according to claim 4, characterized in that: The oral liquid also includes L-arginine, sorbitol, citric acid, and potassium sorbate.

7. The oral solution for alleviating pregnancy toxicity of 3-MCPD according to claim 4 or 6, characterized in that: The concentration of L-arginine is 0~15.0 mg / mL, the concentration of sorbitol is 0~3.0 mg / mL, the concentration of citric acid is 0~2.0 mg / mL, and the concentration of potassium sorbate is 0~1.0 mg / mL.

8. A method for preparing the oral solution for alleviating pregnancy toxicity of 3-MCPD as described in claim 4, characterized in that: Includes the following steps: (1) Heat deionized water to 40~55℃, add taurine and L-arginine respectively, stir to dissolve, and obtain a mixed aqueous solution of taurine and arginine; (2) Add sorbitol and citric acid in sequence, and continue stirring until completely dissolved. Adjust the pH of the solution to 3.5-4.

0. (3) After cooling to room temperature, add potassium sorbate, stir evenly, filter through 100~300 mesh filter cloth to remove impurities; aseptically fill, sterilize, and cool to obtain the finished product.

9. The method for preparing the oral solution for alleviating 3-MCPD pregnancy toxicity according to claim 8, characterized in that: The taurine may be a taurine-β-cyclodextrin encapsulated compound.

10. The method for preparing the oral solution for alleviating 3-MCPD pregnancy toxicity according to claim 9, characterized in that: The method for preparing the taurine-β-cyclodextrin encapsulation is as follows: (1) Take 10g of β-cyclodextrin, add 50mL of deionized water, heat to 60℃ and stir to dissolve, to obtain a saturated β-cyclodextrin aqueous solution; (2) Dissolve 2.5g of taurine in 10mL of deionized water at a mass ratio of 1:4 to 1:4, and slowly add it dropwise to the above β-cyclodextrin aqueous solution. Stir at 60℃ for 2 hours. (3) Cool to 4°C and refrigerate for 12 hours. Filter and collect the precipitate. Dry under vacuum at 60°C for 4 hours. Pulverize and pass through an 80-mesh sieve to obtain taurine-β-cyclodextrin encapsulated material.

Images