Application of c4 maize zmcip p6 protein and related biological materials in regulating high light response ability of plants

By regulating the expression of ZmClpP6 protein in plants using the CRISPR/Cas9 system, the problems of chloroplast development and photosynthetic efficiency under high light conditions were solved, thereby improving the plant's high light response and resistance.

CN122146674APending Publication Date: 2026-06-05INST OF BOTANY CHINESE ACAD OF SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411769729.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-12-04
Publication Date
2026-06-05

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively regulate the plant's response to high light conditions, leading to an imbalance in energy distribution between photosystem I and photosystem II, decreased photosynthetic efficiency, and increased susceptibility of chloroplast proteins to damage from reactive oxygen species.

Method used

By regulating the content and activity of the ZmClpP6 protein, the gene encoding the ZmClpP6 protein can be knocked out or down using the CRISPR/Cas9 gene editing system, thereby reducing its expression in plants and affecting chloroplast development and reactive oxygen species scavenging capacity.

Benefits of technology

Under high light conditions, it reduces chloroplast development inhibition, increases chlorophyll and carotenoid content, reduces leaf yellowing, and enhances the plant's resistance to high light stress.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The application discloses C4 corn ZmClpP6 protein and application of related biological materials thereof in regulation of high light response capability of plants. ZmClpP6 It is found that: ZmClpP6 The knockout can reduce chlorophyll content, total carotenoid content, catalase activity and copper-zinc SOD enzyme activity of corn under high light conditions, and makes corn leaves appear yellowing phenotype. It is indicated that ZmClpP6 can regulate high light response capability of plants. The application clones ZmClpP6 the gene in corn for the first time and analyzes the biological function thereof, and has important significance for cultivation of high light efficiency plants.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the application of C4 maize ZmClpP6 protein and related biomaterials in regulating the high light response of plants. Background Technology

[0002] Photosynthesis is the most important chemical reaction on Earth. Chloroplasts, as vital organelles for plant photosynthesis, are also crucial sites for amino acid, lipid, and many other chemical reactions. Chloroplasts form from undifferentiated protoplasts exposed to light. Light is a key factor regulating chloroplast development. Light primarily affects chloroplast development by regulating the transcription of chloroplast proteins. Excessive light intensity can cause photodamage or photoinhibition in plants, leading to an imbalance in energy distribution between photosystem I (PSI) and photosystem II (PSII), resulting in a rapid decline in photosynthetic efficiency. To cope with high light levels, plants have evolved various self-protective mechanisms, such as scavenging reactive oxygen species (ROS) in chloroplasts. On one hand, ROS also act as signaling molecules regulating plant growth and development; on the other hand, ROS accumulation can cause protein damage. Clearing ROS-damaged chloroplast proteins depends on the degradation by chloroplast proteases.

[0003] Twenty proteases exist in chloroplasts, among which Clp is an important protease in the chloroplast stroma. Clp protease is an ATP-dependent serine protease complex. The Clp protease reaction center consists of two asymmetric rings, the P ring and the R ring. The P ring is composed of catalytic subunits ClpP3 / 4 / 5 / 6 in a ratio of 1:2:3:1. Clp protease in plastids also plays a role in the entry of chloroplast precursor proteins into the chloroplast, participating in the degradation of misfolded proteins. Understanding the function of Clp protease in C4 maize under high light conditions is crucial for improving photosynthetic efficiency. Summary of the Invention

[0004] The technical problem to be solved by this invention is how to regulate the light response ability of plants. The technical problem to be solved is not limited to the technical subject matter described herein; other technical subjects not mentioned herein will be clearly understood by those skilled in the art through the following description.

[0005] To address the aforementioned technical problems, the present invention first provides the application of ZmClpP6 protein or a substance regulating the content and / or activity of said ZmClpP6 protein in any of the following A1)-A3): A1) Regulate the plant's high light response ability (or high light stress resistance); A2) Cultivate transgenic plants with altered light response (or light stress resistance); A3) Plant breeding; The ZmClpP6 protein is any one of the following (B1)-B4): B1) The amino acid sequence of the protein is shown in sequence 2; B2) A fusion protein with the same function is obtained by attaching a tag to the N-terminus and / or C-terminus of the amino acid sequence shown in Sequence 2; B3) Proteins with the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in Sequence 2. B4) is a protein that has 80% or more of the same amino acid sequence as shown in Sequence 2 and has the same function.

[0006] In the protein described in B2) above, the tag refers to a polypeptide or protein fused with the target protein using in vitro DNA recombination technology for expression, detection, tracing, and / or purification of the target protein. The tag includes, but is not limited to: GST (glutathione thiotransferase) tag protein, His6 tag protein (His-tag), MBP (maltose-binding protein) tag protein, Flag tag protein, SUMO tag protein, HA tag protein, Myc tag protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomer red fluorescent protein), or AviTag tag protein.

[0007] In the protein described in B3) above, the substitution and / or deletion and / or addition of one or more amino acid residues is as follows: substitution and / or deletion and / or addition of no more than 10 amino acid residues, or substitution and / or deletion and / or addition of no more than 9 amino acid residues, or substitution and / or deletion and / or addition of no more than 8 amino acid residues, or substitution and / or deletion and / or addition of no more than 7 amino acid residues, or substitution and / or deletion and / or addition of no more than 6 amino acid residues, or substitution and / or deletion and / or addition of no more than 5 amino acid residues, or substitution and / or deletion and / or addition of no more than 4 amino acid residues, or substitution and / or deletion and / or addition of no more than 3 amino acid residues, or substitution and / or deletion and / or addition of no more than 2 amino acid residues, or substitution and / or deletion and / or addition of no more than 1 amino acid residue.

[0008] In the protein described in B4) above, the identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. The identity includes amino acid sequences that have 80% or higher, or 85% or higher, or 90% or higher, or 91% or higher, or 92% or higher, or 93% or higher, or 94% or higher, or 95% or higher, or 96% or higher, or 97% or higher, or 98% or higher, or 99% or higher identity with the amino acid sequence shown in Sequence 2 of this invention.

[0009] The proteins described in B1), B2), B3), or B4) above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0010] In the above applications, substances that regulate the content and / or activity of the ZmClpP6 protein include substances that increase the content and / or activity of the ZmClpP6 protein or substances that decrease the content and / or activity of the ZmClpP6 protein.

[0011] Furthermore, the substance that enhances the activity of ZmClpP6 protein can be a protein, polypeptide, or small molecule compound that enhances or promotes the function of ZmClpP6 protein.

[0012] The substance that increases the ZmClpP6 protein content can be a substance that promotes ZmClpP6 protein synthesis, inhibits ZmClpP6 protein degradation, or overexpresses ZmClpP6 protein.

[0013] The substance that reduces the activity of ZmClpP6 protein can be a protein, polypeptide, or small molecule compound that inhibits the function of ZmClpP6 protein.

[0014] The substance that reduces the ZmClpP6 protein content may be a substance that inhibits ZmClpP6 protein synthesis, promotes ZmClpP6 protein degradation, or knocks down (reduces) or eliminates the ZmClpP6 protein encoding gene.

[0015] Furthermore, the substance that knocks down (reduces) the ZmClpP6 protein-coding gene can be any nucleic acid molecule that can inhibit or interfere with the expression of the ZmClpP6 protein-coding gene, such as gRNA (e.g., sgRNA), mRNA, siRNA, dsRNA, shRNA, miRNA, antisense RNA, etc.

[0016] The substance that knocks out the ZmClpP6 protein-coding gene can be any substance that prevents the host cell from producing it. ZmClpP6Gene knockout is the production of functional protein products. Specific methods include removing all or part of the coding gene sequence, introducing mutations to prevent the production of functional proteins, removing or altering regulatory components (e.g., promoter editing) to prevent transcription of the coding gene sequence, and blocking translation through binding to mRNA. Typically, knockout occurs at the genomic DNA level, resulting in the cell's offspring permanently carrying the knockout.

[0017] Furthermore, the substance that knocks out the ZmClpP6 protein-coding gene can enable plants to... ZmClpP6 A substance that loses its activity due to gene mutation (the mutation may be a deletion mutation and / or an insertion mutation and / or a base substitution), wherein the mutation may be any method known in the art, such as zinc finger protein ZFN gene editing system, TALENs gene editing system, CRISPR / Cas9 gene editing system, T-DNA insertion, etc.

[0018] In some embodiments, the substance for knocking out the ZmClpP6 protein-coding gene is a CRISPR / Cas9 gene-editing vector that knocks out the ZmClpP6 protein-coding gene. The CRISPR / Cas9 gene-editing vector expresses sgRNA and Cas9 protein targeting the ZmClpP6 protein-coding gene. Preferably, the target sequence of the sgRNA is shown in sequences 3 and 4.

[0019] To address the aforementioned technical problems, this invention also provides novel uses for biomaterials related to the ZmClpP6 protein.

[0020] This invention provides the application of biomaterials related to the ZmClpP6 protein in any of the following A1)-A3): A1) Regulate the plant's high light response ability (or high light stress resistance); A2) Cultivate transgenic plants with altered light response (or light stress resistance); A3) Plant breeding; The biomaterial is any one of the following E1) to E5): E1) The nucleic acid molecule encoding the ZmClpP6 protein mentioned above; E2) Knock down or knock out the nucleic acid molecule encoding the ZmClpP6 protein; E3) An expression cassette containing the nucleic acid molecules described in E1) or E2); E4) A recombinant vector containing the nucleic acid molecule described in E1) or E2), or a recombinant vector containing the expression cassette described in E3); E5) Recombinant microorganisms containing the nucleic acid molecules described in E1) or E2), or recombinant microorganisms containing the expression cassette described in E3), or recombinant microorganisms containing the recombinant vector described in E4).

[0021] In the above applications, the nucleic acid molecule described in E1) is any of the following: F1) The DNA molecule shown in sequence 1; The nucleotide sequences defined by F2 and F1 have 75% or more identity and encode the DNA molecule of the ZmClpP6 protein described above.

[0022] Those skilled in the art can readily mutate the nucleotide sequence encoding the ZmClpP6 protein of this invention using known methods, such as directed evolution and point mutation. Those artificially modified sequences, having characteristics isolated from the present invention... ZmClpP6 Nucleotides with 75% or higher nucleotide sequence identity, provided they encode the ZmClpP6 protein and have the same function, are derived from and equivalent to the sequences of this invention. This identity refers to sequence similarity to natural nucleic acid sequences, including nucleotide sequences with 75% or higher, 80% or higher, 85% or higher, 90% or higher, or 95% or higher nucleotide sequence identity to proteins composed of the amino acid sequence shown in Sequence 2 of this invention. Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0023] The nucleic acid molecule mentioned in E2 above can be gRNA (such as sgRNA), mRNA, siRNA, dsRNA, shRNA, miRNA, or antisense RNA.

[0024] Any of the nucleic acid molecules mentioned above can be DNA, such as cDNA, genomic DNA, or recombinant DNA.

[0025] Any of the nucleic acid molecules mentioned above can be RNA, such as gRNA, mRNA, siRNA, shRNA, sgRNA, miRNA, or antisense RNA.

[0026] The expression cassette described above may include a promoter, the nucleic acid molecule described in E1) or E2) above, and a terminator. Promoters that can be used in this invention include, but are not limited to, constitutive promoters, tissue-, organ-, and development-specific promoters, and inducible promoters. Furthermore, the expression cassette may also include an enhancer sequence.

[0027] The vector mentioned above refers to a vector capable of carrying the nucleic acid molecules described in E1) or E2) into the host cell for amplification and expression. The vector can be a cloning vector or an expression vector, including but not limited to: plasmids, bacteriophages (such as λ phage or M13 filamentous phage, etc.), granules (i.e., Cos plasmids), Ti plasmids, and viral vectors (such as retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, etc.).

[0028] The recombinant vector described above refers to a recombinant DNA molecule constructed by ligating the nucleic acid molecule described in E1) or E2) above with the vector in vitro. Recombinant vectors containing the nucleic acid molecule described in E1) or E2) above can be constructed using existing plant expression vectors. These plant expression vectors include binary Agrobacterium vectors and vectors suitable for plant microbombardment, such as pAHC25, pBin438, pCAMBIA1302, pCAMBIA2300, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa, or pCAMBIA1391-Xb (CAMBIA). The plant expression vector may also contain the 3' untranslated region of the exogenous gene, i.e., containing the polyadenylated signal and any other DNA fragments involved in mRNA processing or gene expression. The polyadenylate signal can guide the addition of polyadenylate to the 3' end of the mRNA precursor. Similar functions exist in the untranslated regions of 3'-terminal transcription of Agrobacterium crown gall-inducing (Ti) plasmid genes (such as the alkaloid synthase gene Nos) and plant genes (such as the soybean storage protein gene). When constructing plant expression vectors using the genes of this invention, enhancers, including translational enhancers or transcriptional enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent region start codons, but they must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The translation control signal and start codons are widely available and can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes. To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector can be processed, such as by adding genes encoding enzymes or luminescent compounds that produce color changes (GUS genes, luciferase genes, etc.) that can be expressed in plants, or antibiotic marker genes (such as those conferring resistance to kanamycin and related antibiotics). nptII Genes that confer resistance to the herbicide phosphinic acid bar Genes that confer resistance to the antibiotic hygromycin hph Genes, and the genes that confer resistance to methotrexate dhfr Genes that confer resistance to glyphosate EPSPSGenes such as herbicide-resistant marker genes or mannose-6-phosphate isomerase genes that provide the ability to metabolize mannose can be used. From a safety perspective, transgenic plants can be directly selected by stress screening without adding any selective marker genes.

[0029] Any of the microorganisms mentioned above can be bacteria, fungi, actinomycetes, protozoa, algae, or viruses. Among them, the bacteria may originate from the genus *Escherichia* (…). Escherichia sp. Erwinia ( ) Erwinia sp. ), Agrobacterium ( Agrobacterium sp. Flavobacterium ( Flavobacterium sp. ), Alcaligenes ( Alcaligenes sp. ), Pseudomonas spp. Pseudomonas sp. ), Bacillus spp. ( Bacillus sp. Examples of bacteria include, but are not limited to, Escherichia coli (E. coli). Escherichia coli Bacillus subtilis ( Bacillus subtilis ) or Bacillus pumilus ( Bacillus pumilus The fungus may be a yeast, and the yeast may be from the genus *Saccharomyces* (such as *Saccharomyces cerevisiae*). Saccharomyces cerevisiae Kluyveromyces (such as Kluyveromyces lactis) Kluyveromyces lactis Pichia genus (such as Pichia pastoris) Pichia pastoris ), genus *Schizosaccharomyces* (such as *Schizosaccharomyces cerevisiae*) Schizosaccharomyces pombe ), Hansenula genus (such as polymorphic Hansenula) Hansenula polymorpha And, but not limited to, these. The fungi may also originate from the genus *Fusarium* (…). Fusarium sp. ), Rhizoctonia spp. Rhizoctonia sp. Verticillium ( Verticillium sp. ), Penicillium ( Penicillium sp. Aspergillus ( ) Aspergillus sp. ), Cephalosporium ( Cephalosporium sp. Actinomycetes may be derived from Streptomyces (…), but are not limited to these. Streptomyces sp. Nocardia ( ) Nocardia sp. Micromonospora ( Micromonospora sp. ), genus *Neurospora* Streptosporangium sp. ), genus Actinomycetes ( Actinoplanes sp. ), thermophilic actinomycetes ( Thermoactinomyces sp. (e.g., but not limited to these). The algae mentioned may come from the genus *Fucus* (…). Fucus sp. ), genus *Cyclocarya* ( Achnanthes sp. ), genus *Codonopsis* ( Amphiprora sp. ), genus Dipterocarpa ( Amphora sp. ), Fiber Algae ( Ankistrodesmus sp. ), genus *Stellaria* ( Asteromonas sp. ), Golden-colored algae ( Boekelovia sp.The viruses mentioned may include, but are not limited to, rotavirus, herpesvirus, influenza virus, adenovirus, etc.

[0030] The recombinant microorganisms mentioned above refer to those obtained by manipulating and modifying the genes of a target microorganism, thereby altering its function. For example, recombinant microorganisms obtained after introducing the aforementioned recombinant vector into a target microorganism. The term "recombinant microorganism" can be understood not only to a specific recombinant microorganism but also to the offspring of such cells. Due to natural, accidental, or intentional mutations and / or alterations, the offspring may not necessarily be completely identical to the original parent cell, but are still included within the scope of recombinant microorganisms.

[0031] In the above applications, regulating the plant's light response capability means either reducing or increasing the plant's light response capability.

[0032] In some implementations, the regulation of plant light response capability refers to reducing the plant's light response capability. Specifically, when the content and / or activity of ZmClpP6 protein in the plant is reduced or absent, chloroplast development is inhibited and the plant's ability to scavenge reactive oxygen species is reduced under high light conditions. Further, when mutations in the ZmClpP6 protein-encoding gene in the plant lead to a reduction or absence of ZmClpP6 protein content, the plant's chlorophyll content decreases, total carotenoid content decreases, leaves exhibit yellowing phenotype, catalase activity decreases, and copper-zinc SOD enzyme activity decreases under high light conditions.

[0033] In the above applications, the purpose of plant breeding is to cultivate plant varieties with increased light response or increased resistance to light stress.

[0034] To address the aforementioned technical problems, the present invention ultimately provides a method for cultivating transgenic plants with reduced light response capabilities.

[0035] The method for cultivating transgenic plants with reduced light response capability provided by the present invention includes the following steps: reducing the content and / or activity of ZmClpP6 protein in the target plant to obtain transgenic plants; the light response capability of the transgenic plants is lower than that of the target plants.

[0036] In the above method, the method for reducing the content and / or activity of ZmClpP6 protein in the target plant is to introduce a substance that knocks out the ZmClpP6 protein encoding gene into the target plant.

[0037] In some embodiments, the substance used to knock out the ZmClpP6 protein-coding gene in plants is a CRISPR / Cas9 gene-editing vector that knocks out the ZmClpP6 protein-coding gene in plants; the CRISPR / Cas9 gene-editing vector expresses sgRNA and Cas9 protein targeting the ZmClpP6 protein-coding gene. Preferably, the target sequence of the sgRNA is shown in sequences 3 and 4.

[0038] In the above method, the lower light response ability of the transgenic plant compared to the target plant is manifested in any one of the following C1)-C5): C1) Under high light conditions, the chlorophyll content of the transgenic plant is lower than that of the target plant; C2) Under high light conditions, the total carotenoid content of the transgenic plant is lower than that of the target plant; C3) Under high light conditions, the leaves of the transgenic plant showed a higher degree of yellowing than those of the target plant; C4) Under high light conditions, the catalase activity of the transgenic plant is lower than that of the target plant; C5) Under high light conditions, the copper-zinc SOD enzyme activity of the transgenic plant is lower than that of the target plant.

[0039] In some implementations, the degree of yellowing of the leaves of the transgenic plant is higher than that of the target plant, specifically in that the leaves of the target plant do not show a yellowing phenotype, while the leaves of the transgenic plant do show a yellowing phenotype.

[0040] In any of the above applications or methods, the chlorophyll content includes chlorophyll a content, chlorophyll b content, and the total content of chlorophyll a and chlorophyll b.

[0041] The total carotenoids include β-carotene, lutein, neolutein, and oxalool.

[0042] In any of the above applications or methods, the hyperblindness condition is a light intensity of at least 800 μmol m. 2 ·s -1 conditions.

[0043] In any of the above applications or methods, the plant may be a dicotyledonous plant or a monocotyledonous plant.

[0044] Furthermore, the plant in question is a monocotyledonous plant.

[0045] Furthermore, the monocotyledonous plant is maize (such as maize inbred line B73-329).

[0046] This invention knocks out the corn ZmClpP6 Discover: ZmClpP6Knockout of ZmClpP6 reduced chlorophyll content, total carotenoid content, catalase activity, and copper-zinc SOD activity in maize under high light conditions, resulting in yellowing of maize leaves. This indicates that ZmClpP6 can regulate the plant's high light response. This invention is the first to clone ZmClpP6 in maize. ZmClpP6 The gene was identified and its biological function was elucidated, which is of great significance for cultivating plants with high light efficiency. Attached Figure Description

[0047] Figure 1 for ZmClpP6 Identification and phenotypic analysis of knockout maize mutants. A represents... ZmClpP6 A schematic diagram of the gene structure and CRISPR / Cas9 target location, along with sequence representations of the gene editing sites. (B represents...) ZmClpP6 Leaf phenotype of the knockout maize mutant. C represents... ZmClpP6 The chlorophyll content in the leaves of the knockout maize mutant was measured. D represents... ZmClpP6 Total carotenoid content in the leaves of knockout maize mutants.

[0048] Figure 2 for ZmClpP6 Knockout maize mutant ZmClpP6 Gene expression level detection. Figure 3 for ZmClpP6 Determination of the activity of reactive oxygen species scavenging enzymes in knockout maize mutants. Detailed Implementation

[0049] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0050] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0051] The Agrobacterium tumefaciens strain EHA105 used in the following examples is described in the literature “Qu LQ, Xing YP, Liu WX, Xu XP, Song YR. (2008) Expression pattern and activity of six glutelin gene promoters in transgenic rice. Journal of Experimental Botany 59: 2417–2424.”, and is publicly available from the Institute of Botany, Chinese Academy of Sciences. This biological material is only for repeating the relevant experiments of this invention and should not be used for other purposes.

[0052] The maize inbred line B73-329 in the following examples is described in the literature “Zhang, J., Zhang, Y., Xing, J. et al. Introducing selective agrochemical manipulation of gibberellinmetabolism into a cereal crop. Nat. Plants 6, 67–72 (2020). https: / / doi.org / 10.1038 / s41477-019-0582-x”, and is publicly available from the Institute of Botany, Chinese Academy of Sciences. This biological material is only for repeating the relevant experiments of this invention and should not be used for other purposes.

[0053] The maize inbred line B73 described in the following examples is described in the literature “Jiao, Y., Peluso, P., Shi, J., Liang, T., Stitzer, MC, Wang, B., ...&Ware, D. (2017). Improved maizereference genome with single-molecule technologies. Nature, 546(7659), 524-527.”, and is publicly available from the Institute of Botany, Chinese Academy of Sciences. This biological material is only for repeating the relevant experiments of this invention and should not be used for other purposes.

[0054] The pYLsgRNA-OsU6a, pYLsgRNA-OsU6b, and pYLCRISPR / Cas9Pubi-B vectors used in the following examples are described in the literature “Ma, X., Zhang, Q., Zhu, Q., Liu, W., Chen, Y., Qiu, R., Wang, B., Yang, Z., Li, H., Lin, Y., Xie, Y., Shen, R., Chen, S., Wang, Z., Chen, Y., Guo, J., Chen, L., Zhao, X., Dong, Z. and Liu, YG (2015) A Robust CRISPR / Cas9 System for Convenient, High-Efficiency MultiplexGenome Editing in Monocot and Dicot Plants. Mol Plant, 8, 1274-1284.”, which are publicly available from the Institute of Botany, Chinese Academy of Sciences. This biological material is only for repeating the relevant experiments of this invention and should not be used for other purposes.

[0055] The universal DNA recovery and purification kit in the following examples is a product of Tiangen Biotech (Beijing) Co., Ltd., catalog number DP214.

[0056] The plant RNA mini-extraction kit in the following examples is a product of Guangzhou Meiji Biotechnology Co., Ltd., catalog number R4151-02.

[0057] In the following embodiments ZmClpP6 The genome sequence of the gene is identified by gene number Zm00001d018413 in the reference genome sequence of the maize V4 version. The reference genome sequence of the maize V4 version can be found on the Phytozome v13 website (https: / / phytozome.jgi.doe.gov / pz / portal.html).

[0058] In the following embodiments ZmClpP6 The CDS sequence of the gene is shown in Sequence 1.

[0059] The amino acid sequence of the ZmClpP6 protein in the following examples is shown in Sequence 2.

[0060] Example 1: Obtaining the ZmClpP6 protein-encoding gene 1. Seeds of maize inbred line B73 were placed in moist vermiculite for absorbing moisture and then placed in an incubator for 72 hours to germinate. Germination conditions were as follows: a light / dark cycle of 16 h / 8 h; a temperature of 28℃ during the light phase and 26℃ during the dark phase; an incubator humidity of 60%; and a light intensity of approximately 150 μmol / m² during the light phase. −2 s −1 Germinated corn seeds were transferred to nutrient soil and cultivated for two weeks. The first fully expanded leaf from the top was taken, flash-frozen in liquid nitrogen, ground, and total RNA was extracted, followed by reverse transcription to obtain cDNA.

[0061] 2. Using the cDNA obtained in step 1 as a template, PCR amplification was performed using primers ZmClpP6-CDS-F / ZmClpP6-CDS-R to obtain the PCR product (i.e., ZmClpP6 CDS sequence). Primer sequences are as follows: ZmClpP6-CDS-F: 5'-ATGGCGTCGCTGTCGTGCG-3'; ZmClpP6-CDS-R: 5'-GTATCTTGTTTCCAGTAAAGC-3'.

[0062] 3. Perform agarose gel electrophoresis on the PCR product obtained in step 2 to separate and purify a fragment of about 900 bp. Ligate this fragment into the T vector (pEASY-Blunt Simple) to obtain the recombinant plasmid and perform sequencing.

[0063] Sequencing results show that: ZmClpP6 The CDS sequence is shown in positions 1-879 of Sequence 1, and the amino acid sequence of the ZmClpP6 protein it encodes is shown in Sequence 2.

[0064] Example 2 ZmClpP6 Preparation of knockout corn materials one, ZmClpP6 Construction of knockout vector References “Ma, Method construction in "RobustCRISPR / Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants. Mol Plant, 8, 1274-1284." ZmClpP6 The specific steps for knocking out the vector are as follows: 1. Target design exist ZmClpP6 Two target sites were designed in the 5'-UTR and the second exon region of the genome sequence, with target sequences AGAAAAGGAAAGCGGTGCGAG (sequence 3) and CGCAACTCCTTGCTTCCCAA (sequence 4).

[0065] 2. Preparation of double-stranded targets containing connectors The adapter primer sequence designed for target 1 is as follows: ZmClpP6-crispr-F: 5'-GCCGAGAAAGGAAAGCGGTGCGAG-3'; ZmClpP6-crispr-R: 5'-AAACCTCGCACCGCTTTCCTTTCT-3'; The adapter primer sequence designed for target 2 is as follows: ZmClpP6-crispr-1F: 5'-GTTGCGCAACTCCTTGCTTCCCAA-3'; ZmClpP6-crispr-1R: 5'-AAACTTGGGAAGCAAGGAGTTGCG-3'.

[0066] Anneal the adapter primer sequence of target 1 to obtain double-stranded target 1 containing the adapter.

[0067] Anneal the adapter primer sequence of target 2 to obtain double-stranded target 2 containing the adapter.

[0068] 3. Preparation of sgRNA expression cassettes containing target 1 and sgRNA expression cassettes containing target 2 1) Enzyme digestion and ligation Each target site was ligated to its corresponding sgRNA vector using a simultaneous enzyme digestion and ligation method to obtain the enzyme digestion and ligation products. The sgRNA vector corresponding to target site 1 was the pYLsgRNA-OsU6a vector; the sgRNA vector corresponding to target site 2 was the pYLsgRNA-OsU6b vector.

[0069] The PCR reaction system is as follows: 2 μL of 10x cutsmart buffer, 0.2 μL of 100 mM ATP, 10-20 ng of sgRNA vector, μL of double-stranded target containing adapter, 0.2 μL of BsaI-HF (20 U / μL), 0.1 μL of T4 DNA ligase (100 U / μL), and ddH2O to bring the volume to 20 μL.

[0070] The PCR setup procedure is as follows: Step 1: Enzyme digestion reaction at 37℃ for 5 min; Step 2: Ligation reaction at 20℃ for 5 min; Repeat steps 1 and 2 five times.

[0071] 2) Single nested PCR reaction Using the enzyme digestion and ligation products as templates, primers OsU6aTP#-F / gR-R and UF / OsU6aTP#-R were used for target 1, and OsU6bTP#-F / gR-R and UF / OsU6bTP#-R were used for target 2. A single nested PCR reaction was performed using high-fidelity DNA polymerase (KOD-Plus-Neo) to obtain the single nested PCR product. The primer sequences are as follows: UF: 5'-CTCCGTTTTACCTGTGGAATCG-3'; gR-R: 5'-CGGAGGAAAATTCCATCCAC-3'; OsU6aTP#-F: 5'-GCCGAGAAAGGAAAGCGGTGCGAG-3'; OsU6aTP#-R: 5'-AAACCTCGCACCGCTTTCCTTTCT-3'; OsU6bTP#-F: 5'-GTTGCGCAACTCCTTGCTTCCCAA-3'; OsU6bTP#-R: 5'-AAACTTGGGAAGCAAGGAGTTGCG-3'.

[0072] The PCR reaction system is as follows (20 μL): 10xKOD buffer 2 μL, 10xdNTP 2 μL, MgSO4 1.2 μL, positive strand primer (OsU6aTP#-F / OsU6bTP#-F / UF) 0.5 μL, negative strand primer (OsU6aTP#-R / OsU6bTP#-R / gR-R) 0.5 μL, enzyme digestion and ligation product 1 μL, KOD-Plus-Neo DNA polymerase 0.5 μL, ddH2O 12.3 μL.

[0073] The PCR reaction program was set as follows: Step 1: Pre-denaturation at 94℃ for 30 min; Step 2: Denaturation at 98℃ for 10 s; Step 3: Annealing at 62℃ for 30 s; Step 4: Extension at 68℃ for 30 s; Step 5: Termination of the extension reaction at 68℃ for 5 min. Steps 2, 3, and 4 were repeated for 35 cycles. 3) Secondary PCR reaction Using a single nested PCR product as a template (a mixture of PCR products from two primer pairs), high-fidelity DNA polymerase was used for PCR amplification with primers Pps-GGL / Pgs-GG2 and Pps-GG2 / Pgs-GGR, respectively, to obtain sgRNA expression cassettes containing target 1 and target 2, respectively. The primer sequences are as follows: Pps-GGL: 5'-TTCAGAGGTCCTCTCGACTAGTATGGAATCGGCAGCAAAGG-3'; Pgs-GG2: 5'-AGCGTGGGTCTCGTCAGGGTCCATCCACTCCAAGCTC-3'; Pps-GG2: 5'-TTCAGAGGTCTCTCTGACACTGGAATCGGCAGCAAAGG-3'; Pgs-GGR: 5'-AGCGTGGGTCTCGACCGACGCGTATCCATCCACTCCAAGCTC-3'.

[0074] The PCR reaction system (50 μL) is as follows: 10xKOD buffer 5 μL, 10xdNTP 5 μL, MgSO4 3 μL, positive strand primer (PPs-GGL or PPs-GG2) 1 μL, antisense strand primer (Pgs-GG2 or Pgs-GGR) 1 μL, OsU6aTP#-F / gR-R PCR product 1 μL, UF / OsU6aTP#-R PCR product 1 μL, KOD-Plus-Neo DNA polymerase 1 μL, and ddH2O to bring the volume to 50 μL.

[0075] 4. ZmClpP6 Preparation of knockout vector 1) Enzyme digestion The sgRNA expression cassette containing target 1, the sgRNA expression cassette containing target 2, and pYLCRISPR / Cas9Pubi-B were digested with BsaI restriction endonuclease to obtain the digestion products of the sgRNA expression cassette containing target 1, the sgRNA expression cassette containing target 2, and pYLCRISPR / Cas9, respectively.

[0076] The enzyme digestion reaction system was as follows (50 μL): 5 μL 10x Cutsmart buffer, 2 μg vector plasmid or expression cassette recovered product, 1.5 μL BsaI-HF (20 U / μL), and ddH2O to bring the total volume to 50 μL. The successfully linearized digested vector and the digested PCR product were recovered by agarose gel electrophoresis, and their concentrations were determined using Nanodrop. 2) Connection The digestion products of the sgRNA expression cassette containing target 1, the digestion products of the sgRNA expression cassette containing target 2, and the pYLCRISPR / Cas9 digestion products were ligated using a ligase to obtain... ZmClpP6 Knock out the carrier.

[0077] The ligation reaction system (20 μL) is as follows: 120-160 ng of pYLCRISPR / Cas9 digestion product, 2 μL of T4-DNA ligase buffer, 0.2 μL of T4-DNA ligase, 20-30 ng of digestion product containing sgRNA expression cassette with target 1, 20-30 ng of digestion product containing sgRNA expression cassette with target 2, and ddH2O to bring the volume to 20 μL.

[0078] Connection reaction conditions: overnight incubation in a metal bath at 16 ℃. ZmClpP6The knockout vector expresses sgRNA containing target 1, sgRNA containing target 2, and Cas9 protein.

[0079] two, ZmClpP6 Obtaining corn knockout materials 1. Obtaining transgenic maize lines The construction in step one ZmClpP6 The knockout vector was transformed into Agrobacterium EHA105 strain, and positive recombinant Agrobacterium was obtained after identification. This positive recombinant Agrobacterium was then transformed into maize inbred line B73-329. The specific transformation steps followed the method described in the literature "Zhu, J., Song, N., Sun, S., Yang, W., Zhao, H., Song, W. and Lai, J. (2016) Efficiency and inheritance of targeted mutagenesis in maize using CRISPR-Cas9. J Genet Genomics, 43, 25-36." T0 generation transgenic maize lines and T1 generation seeds were harvested. After germination of the T1 generation seeds, T1 generation transgenic maize lines were screened by detecting DNA, RNA, and protein levels. T2 generation seeds were then harvested. After germination of the T2 generation seeds, transgenic maize lines were selected based on expression levels for phenotypic analysis. T0 generation represents the current generation of plants transformed from T0 generation; T2 generation represents the seeds produced by self-pollination of T0 generation and the plants that grow from them; T2 generation represents the seeds produced by self-pollination of T1 generation and the plants that grow from them.

[0080] 2. ZmClpP6 Detection of knockout maize mutants 1) ZmClpP6 DNA level detection of knockout maize mutants Take conversion ZmClpP6Total DNA was extracted from leaf materials of transgenic maize and wild-type maize with the vector knocked out. Primers were designed near the target sites, and PCR was performed using high-fidelity DNA polymerase with the extracted DNA as a template. Due to the large distance between the two target sites, two pairs of primers were designed 200-700 bp upstream and downstream of the target sites to amplify the fragments containing the target sites. The fragments were then recovered using a DNA recovery and purification kit. The amplified fragments were gel-extracted and sequenced. The sequencing results were compared with the wild-type sequence. If the sequencing results were consistent with the wild-type sequence, no editing was performed; otherwise, editing was performed, requiring further monoclonal testing to determine homozygosity or heterozygosity. The recovered products from the edited plants were cloned into the T vector (pEASY-Blunt Simple) and transformed into E. coli. More than 10 plaques were selected for monoclonal testing. If the editing patterns of these monoclonals were consistent, the organism was homozygous; otherwise, it was heterozygous.

[0081] The primer sequences for target 1 amplification are as follows: ZmClpP6-target1-F:5'-ATCTATAGGCTCTTGACG-3'; ZmClpP6-Target1-R:5'-ACTTACAAGATGCGATGG -3'; The primer sequences for target 2 amplification are as follows: ZmClpP6-400BP-F: 5'-TGCTGAGGGCATGGAACG-3'; ZmClpP6-crispr1kb-R:5'-GTCATACAATTGCCAGCAGCC-3'.

[0082] Two were obtained in the end. ZmClpP6 The homozygous knockout lines of maize mutants were named ZmclpP6-KO-L1 and ZmclpP6-KO-L2, respectively.

[0083] Sequencing identification ZmClpP6 The only difference in the genome sequence between the knockout maize mutant homozygous line ZmclpP6-KO-L1 and the maize inbred line B73-329 is in ZmClpP6 A 4 bp deletion occurred in the genome sequence, and the deleted fragment is located at... ZmClpP6 Positions 17-20 of the genome sequence.

[0084] Sequencing identification ZmClpP6 The difference in genome sequence between the knockout maize mutant homozygous line ZmclpP6-KO-L2 and the maize inbred line B73-329 lies in... ZmClpP6 A 4 bp deletion and a 1 bp deletion occurred in the genome sequence. The deleted fragment is located at...ZmClpP6 The deleted base is located at positions 20-23 of the genome sequence. ZmClpP6 The 799th position of the genome sequence.

[0085] different ZmClpP6 Sequencing results of homozygous knockout maize mutant lines are as follows: Figure 1 As shown.

[0086] 2) ZmClpP6 RNA level detection of knockout maize mutants qRT-PCR analysis ZmClpP6 Knockout maize mutant ZmClpP6 Gene expression level 。 The specific steps are as follows: Take ZmClpP6 From knockout maize mutant and wild-type maize leaf materials, total RNA was extracted from the leaves using a plant RNA mini-extraction kit from Guangzhou Meiji Biotechnology Co., Ltd. cDNA was then synthesized using an Invitrogen reverse transcription kit with Oligo d(T) as primers to obtain leaf cDNA. ZmClpP6 qRT-PCR analysis was performed using the specific quantitative detection primers ZmClpP6-RT-F / R to analyze maize. Actin The gene was used as an internal control, and the primers were actin-RT-F / R. Confirmation. ZmClpP6 Does the expression level decrease? The primer sequences are as follows: ZmClpP6-RT-F: 5'-GACAGGTTGGAGAAACCATCTA-3'; ZmClpP6-RT-R: 5'-GGCCTCTGAAGAAGACATGAA-3'; actin-RT-F: 5'-CCTATCGTATGTGACAATGGCACT-3'; actin-RT-R: 5'-GCCTCATCACCTACGTAGGCAT-3'.

[0087] The results are as follows Figure 2 As shown, the results indicate that, compared to the wild type, ZmclpP6-KO-L1... ZmClpP6 The relative expression level of the gene was 0.1, while that of ZmclpP6-KO-L2 was... ZmClpP6 The relative gene expression level was 0.05. (Two) ZmClpP6 Knockout strains ZmClpP6 Gene expression levels were significantly decreased. (Selection) ZmClpP6The knockout homozygous maize mutant lines ZmclpP6-KO-L1 (hereinafter referred to as KO-L1 or KO1) and ZmclpP6-KO-L2 (hereinafter referred to as KO-L2 or KO2) were used for the following phenotypic analysis.

[0088] Example 3: The effect of ZmClpP6 protein on maize's high light response. one, ZmClpP6 Knockout causes corn leaves to turn yellow and reduces pigment content. 1. Phenotypic observation Test material: Wild-type maize (WT), ZmClpP6 Knockout homozygous maize mutant lines KO-L1 (also known as KO1) and KO-L2 (also known as KO2).

[0089] Experimental method: Seeds of the test material were taken, and after germination, they were planted in high light (light intensity approximately 800-1000 μmol m²). -2 s -1 Under these conditions, phenotypic observations were conducted when the plants had grown for approximately 15 days.

[0090] The results are as follows Figure 1 As shown in Figure B, the results indicate that compared to WT, ZmClpP6 Both the knockout maize mutant homozygous lines KO-L1 and KO-L2 exhibited yellowing phenotypes in their leaves.

[0091] 2. Pigment content detection Test material: Wild-type maize (WT), ZmClpP6 Knockout homozygous maize mutant lines KO-L1 (also known as KO1) and KO-L2 (also known as KO2).

[0092] Experimental method: Seeds of the test material were taken, and after germination, they were planted in high light (light intensity approximately 1000 μmol / m²). -2 s -1Under these conditions, the contents of chlorophyll a, chlorophyll b, and total carotenoids (including β-carotene, xanthophyll, neoxanthophyll, and chlorophyll) in the leaves were measured when the plants were about 30 days old. The determination of chlorophyll a and chlorophyll b contents followed the method described in the literature “Arnon, DI (1949). Copper enzymes in isolated chloroplasts. Polyphenoloxidase in Beta vulgaris. Plant physiology, 24(1), 1.” The determination of total carotenoid content followed the method described in the literature “Lichtenthaler HK. 1987. Chlorophylls and carotenoids: pigments of photographic biomembranes. Methods in Enzymology 148: 350–382.”

[0093] ZmClpP6 The results of pigment content detection in knockout maize mutants are as follows: Figure 1 C and Figure 1 As shown in D, where... Figure 1 C represents the chlorophyll content detection results in the leaves of KO1 knockout plants grown under high light conditions. Figure 1 D represents the total carotenoid content in the leaves of KO1 knockout plants grown under high light conditions. The results showed that the contents of chlorophyll a, chlorophyll b, and chlorophyll a+b in the leaves of WT plants were 1.20 mg / g, 1.03 mg / g, and 2.23 mg / g, respectively. ZmClpP6 The contents of chlorophyll a, chlorophyll b, and chlorophyll a+b in the leaves of the knockout maize mutant were 0.56 mg / g, 0.28 mg / g, and 0.84 mg / g, respectively. Additionally, ZmClpP6 The total carotenoid content in the leaves of the knockout maize mutant was 0.61 mg / g, while the total carotenoid content in the leaves of the WT plant was 0.24 mg / g.

[0094] two, ZmClpP6 Knockout reduces the reactive oxygen species scavenging capacity of corn. Test material: Wild-type maize (WT), ZmClpP6 The knockout maize mutant homozygous line KO-L1 (also known as KO1).

[0095] Experimental method: Seeds of the test material were taken, and after germination, they were planted in 800-1000 μmol / m³ water. 2 ·s -1Under illumination, after approximately 30 days of growth, the activities of catalase (CAT), total SOD, copper-zinc SOD, and manganese SOD were measured using a Solarbiotech catalase (CAT) activity assay kit (ammonium molybdate method) and a superoxide dismutase (SOD) typing activity assay kit (WST method). CAT enzymes can decompose hydrogen peroxide into water and oxygen; the level of CAT enzyme activity reflects the cell's ability to scavenge hydrogen peroxide. The main function of SOD (superoxide dismutase) is to catalyze the dismutation reaction of superoxide anion free radicals, converting them into hydrogen peroxide and oxygen, thereby scavenging free radicals and protecting cells from oxidative damage. Copper-zinc SOD enzymes are normally found in the cytoplasm and chloroplasts and are crucial for maintaining the cellular antioxidant balance and protecting normal photosynthesis.

[0096] The results are as follows Figure 3 As shown, the results are as follows: ZmClpP6 The total SOD enzyme activity and manganese SOD enzyme activity of the knockout maize mutant materials were not significantly different from those of the WT group. Figure 3 A, Figure 3 C). ZmClpP6 The CAT enzyme activity and copper-zinc SOD activity of the knockout maize mutant material were significantly lower than those of the WT (wt). Figure 3 B. Figure 3 D).

[0097] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. The use of ZmClpP6 protein or substances regulating the content and / or activity of said ZmClpP6 protein in any of the following A1)-A3): A1) Regulating the plant's high light response ability; A2) Cultivating transgenic plants with altered light response capabilities; A3) Plant breeding; The ZmClpP6 protein is any one of the following (B1)-B4): B1) The amino acid sequence of the protein is shown in sequence 2; B2) A fusion protein with the same function is obtained by attaching a tag to the N-terminus and / or C-terminus of the amino acid sequence shown in Sequence 2; B3) Proteins with the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in Sequence 2. B4) is a protein that has 80% or more of the same amino acid sequence as shown in Sequence 2 and has the same function.

2. Use of biomaterials related to the ZmClpP6 protein of claim 1 in any of the following A1)-A3): A1) Regulating the plant's high light response ability; A2) Cultivating transgenic plants with altered light response capabilities; A3) Plant breeding; The biomaterial is any one of the following E1) to E5): E1) A nucleic acid molecule encoding the ZmClpP6 protein as described in claim 1; E2) Knock down or knock out the nucleic acid molecule encoding the ZmClpP6 protein as described in claim 1; E3) An expression cassette containing the nucleic acid molecules described in E1) or E2); E4) A recombinant vector containing the nucleic acid molecule described in E1) or E2), or a recombinant vector containing the expression cassette described in E3); E5) Recombinant microorganisms containing the nucleic acid molecules described in E1) or E2), or recombinant microorganisms containing the expression cassette described in E3), or recombinant microorganisms containing the recombinant vector described in E4); The ZmClpP6 protein is any one of the following (B1)-B4): B1) The amino acid sequence of the protein is shown in sequence 2; B2) A fusion protein with the same function is obtained by attaching a tag to the N-terminus and / or C-terminus of the amino acid sequence shown in Sequence 2; B3) Proteins with the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in Sequence 2. B4) is a protein that has 80% or more of the same amino acid sequence as shown in Sequence 2 and has the same function.

3. The application according to claim 2, characterized in that: E1) The nucleic acid molecule is any one of the following: F1) The DNA molecule shown in sequence 1; The nucleotide sequence defined by F2) has 75% or more identity with F1) and is a DNA molecule encoding the ZmClpP6 protein.

4. The application according to any one of claims 1-3, characterized in that: The plant is a dicotyledonous plant or a monocotyledonous plant.

5. A method for cultivating transgenic plants with reduced light response, comprising the following steps: reducing the content and / or activity of the ZmClpP6 protein as described in claim 1 in the target plant to obtain the transgenic plant; wherein the light response of the transgenic plant is lower than that of the target plant.

6. The method according to claim 5, characterized in that: The method for reducing the content and / or activity of the ZmClpP6 protein as described in claim 1 in the target plant is to introduce a substance that knocks down or eliminates the ZmClpP6 protein encoding gene into the target plant.

7. The method according to claim 6, characterized in that: The substance used to knock out the ZmClpP6 protein-coding gene is a CRISPR / Cas9 gene editing vector that knocks out the ZmClpP6 protein-coding gene; the CRISPR / Cas9 gene editing vector expresses sgRNA and Cas9 protein targeting the ZmClpP6 protein-coding gene.

8. The method according to claim 7, characterized in that: The target sequence of the sgRNA is shown in Sequence 3 and Sequence 4.

9. The method according to any one of claims 5-8, characterized in that: The lower light response capability of the transgenic plant compared to the target plant is manifested in any one of the following C1)-C5): C1) Under high light conditions, the chlorophyll content of the transgenic plant is lower than that of the target plant; C2) Under high light conditions, the total carotenoid content of the transgenic plant is lower than that of the target plant; C3) Under high light conditions, the leaves of the transgenic plant showed a higher degree of yellowing than those of the target plant; C4) Under high light conditions, the catalase activity of the transgenic plant is lower than that of the target plant; C5) Under high light conditions, the copper-zinc SOD enzyme activity of the transgenic plant is lower than that of the target plant.

10. The application according to any one of claims 5-9, characterized in that: The plant is a dicotyledonous plant or a monocotyledonous plant.