A pigeon tyrosine-related protein 1 gene mutant and application thereof

By using the c.891delT mutant of the pigeon TYRP1 gene, and employing eye color or feather color as sex identification markers, combined with KASP technology, the problem of sex identification in white-feathered meat pigeons has been solved. This achieves early, equipment-free, and highly efficient sex identification, which is suitable for large-scale breeding.

CN122146724APending Publication Date: 2026-06-05SHANGHAI ACAD OF AGRI SCI

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
SHANGHAI ACAD OF AGRI SCI
Filing Date
2026-04-23
Publication Date
2026-06-05

Smart Images

  • Figure CN122146724A_ABST
    Figure CN122146724A_ABST
Patent Text Reader

Abstract

The application relates to a pigeon TYRP1 Mutant of a gene and application thereof, and belongs to the technical field of molecular biology. The nucleotide sequence of the mutant is shown as SEQ ID NO. 1. The application utilizes TYRP1 A frame shift mutation c.891delT (p.T297fs) of the gene has a double phenotype effect, so that it is possible to use eye color as a gender identification marker of white-feathered pigeons, and a bottleneck in application of feather color self-alternation technology in mainstream white-feathered breeds is broken.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular biology, and more particularly to a pigeon TYRP1 Mutants of genes and their applications. Background Technology

[0002] Pigeon farming is an important and distinctive poultry industry in my country, with an annual output of hundreds of millions of pigeons. Currently, the mainstream pigeon breeds are predominantly white-feathered, such as the White King Pigeon and the White Carnu Pigeon, which are highly favored in the market due to their aesthetically pleasing carcasses and the absence of colored feather root residue. However, this presents a fundamental limitation to the application of sex-selective breeding systems based on feather color—in pure white-feathered populations, it is impossible to distinguish males from females based on feather color differences. Traditional sex determination methods (cloacal observation and CHD gene molecular identification) suffer from low efficiency, high cost, and complex operation, making them unsuitable for the needs of modern, large-scale farming. Therefore, developing a sex-selective technology that is independent of feather color and applicable to white-feathered pigeons is of great significance for promoting the quality and efficiency of the pigeon industry. Summary of the Invention

[0003] The purpose of this invention is to provide a pigeon TYRP1 Mutants of genes and their applications. This invention utilizes... TYRP1 A frameshift mutation c.891delT (p.T297fs) in the gene has a dual phenotypic effect, making it possible to use eye color as a sex identification marker for white-feathered pigeons, thus breaking through the bottleneck of the application of feather color self-identification technology in mainstream white-feathered breeds.

[0004] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides a pigeon TYRP1 A mutant of the gene, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0005] Preferably, the nucleotide sequence of the mutant is similar to that of a pigeon. TYRP1 Compared to other genes, it has the c.891delT mutation.

[0006] This invention provides the application of the mutant in the preparation of products for identifying the sex of pigeons.

[0007] This invention provides a primer set for identifying the sex of pigeons, the sequences of which are shown in SEQ ID NO.3~5.

[0008] Preferably, the primer sequence SEQ ID NO.3 is the forward primer sequence for recognizing the wild-type allele, SEQ ID NO.4 is the forward primer sequence for recognizing the mutant allele, and SEQ ID NO.5 is the reverse primer sequence.

[0009] Preferably, all forward primers are linked to fluorescent labels, with the forward primer sequence for wild-type alleles linked to FAM and the forward primer sequence for mutant alleles linked to HEX.

[0010] The present invention also provides a kit for identifying the sex of pigeons, comprising the aforementioned primer set.

[0011] This invention also provides a method for determining the sex of pigeons, comprising the following steps: (1) Extract genomic DNA from the pigeons to be tested; (2) Perform real-time PCR amplification using the primer set or the kit described above; (3) Genotype is determined based on fluorescence signal. When only HEX fluorescence signal is detected, it indicates that the sample is a deletion homozygote. When only FAM fluorescence signal is detected, it indicates that the sample is a wild-type homozygote. When both fluorescence signals are detected, it indicates that the sample is a heterozygote.

[0012] This invention also provides a method for breeding sex-differentiated strains of white-feathered meat pigeons and colored-feathered meat pigeons. The method for breeding sex-differentiated strains of white-feathered meat pigeons is as follows: genotyping of white-feathered breeding pigeons is performed using the primer set or the kit described above; homozygous males (- / -) and females (-) with c.891delT mutation are selected as paternal lines, and homozygous males (+ / +) and females (+) with wild-type mutation are selected as maternal lines; the c.891delT mutant males (Z... - Z - ) and wild-type females (Z + W) crossbreeding to obtain F1 generation, eye color was observed at 6-12 days of age; all pigeons with dark brown eyes were male (Z) + Z - All red-eyed pigeons are female (Z) - W); The method for sexing colored-feathered pigeons is as follows: Genotypic screening of gray-feathered breeding pigeons is performed using the primer set or the kit described above; homozygous males (- / -) and females (-) with the c.891delT mutation are selected as paternal lines, and homozygous males (+ / +) and females (+) with wild-type mutations are selected as maternal lines; c.891delT mutant males (Z... - Z - ) and wild-type females (Z + W) crossbreeding yielded F1 generation; observing feather color, all of the grayish-blue pigeons were male (Z) + Z - All the silver ones are female pigeons (Z) - W).

[0013] This invention also provides pigeons TYRP1Application of the c.891delT mutation in the gene in determining the sex of pigeons.

[0014] The present invention has the following technical effects and advantages: 1. The invention discovers TYRP1 The (tyrosinase-associated protein 1) gene is a key enzyme in the melanin synthesis pathway, which not only participates in feather pigment deposition but also affects the production of melanin in the iris. TYRP1 A frameshift mutation in the gene c.891delT (p.T297fs) has a dual phenotypic effect: ① In a colored plumage genetic background, this mutation changes blue-gray feathers to silver-gray; ② In a white plumage genetic background, this mutation leads to a lack of melanin deposition in the iris, causing 6-12 day old chicks to exhibit red eyes (pigment deficiency), while unmutated individuals have dark brown eyes. This discovery makes it possible to use eye color as a sex marker for white-feathered pigeons, breaking through the bottleneck in the application of plumage color self-identification technology in mainstream white-feathered breeds.

[0015] 2. This invention is the first to discover that the c.891delT mutation can lead to a lack of pigment deposition in the iris of white-feathered pigeons (red eyes), making eye color a sex identification marker for white-feathered pigeons, thus solving the fundamental problem that mainstream white-feathered meat pigeon breeds cannot apply feather color self-identification technology.

[0016] 3. This invention discovers that this mutation affects both feather color and eye color, and can be applied to the breeding of different strains of colored pigeons (based on feather color) as well as to the breeding of different strains of white pigeons (based on eye color), thus having extremely high versatility and commercial value.

[0017] 4. The technical solution of this invention can achieve early identification: the red-eye phenotype can be identified by the naked eye in 6-12 day old pigeons without any instruments or equipment. It can obtain sex information several weeks earlier than traditional methods, which is convenient for early grouping, feeding and management optimization.

[0018] 5. The technical solution of this invention has strong functionality: c.891delT is a frameshift mutation (p.T297fs) that directly leads to abnormality of TYRP1 protein, has a clear biological basis, stable phenotype, and clear genetic law.

[0019] 6. The detection method established by this invention based on KASP technology is suitable for genotype screening of large-scale breeding populations, providing technical support for the breeding of breeding lines. Attached Figure Description

[0020] Figure 1 The scatter plot shows the KASP genotyping of the c.891delT mutant, where blue represents FAM fluorescence (wild-type allele), green represents HEX fluorescence (mutant allele), and red represents FAMHEX (heterozygous). Figure 2 To breed white-feathered meat pigeons through sex-separate hybridization; Figure 3 This is a phenotypic diagram of eye color in pigeons with the c.891delT mutation against a white background, where A represents male pigeons (Z). + Z - ), the iris is dark brown; B is the female pigeon (Z) - W), the iris is red (due to lack of pigment); Figure 4 To breed colored-feathered meat pigeons through sex-separate hybridization; Figure 5 This is a feather color phenotype diagram of the c.891delT mutation against a gray background, where A represents the male pigeon (Z). + Z - ), grayish-brown feathers; B is the female pigeon (Z) - W), silver feathers. Detailed Implementation

[0021] This invention provides a pigeon TYRP1 A mutant of the gene, the nucleotide sequence of which is shown in SEQ ID NO.1, specifically: TGTTTATGTGGTTTAGAACATGTTGCAGGACCCCTCCTTTGGACTGCCCTACTGGAATTTTGCAACAGGACAAAACACCTGTGATATCTGCACAGATGACTTGATGGGAGCTAGAAGCAATTTTGATGTCTCCCTTATCAGCCAGAACTCAATATTCTCTCAGTGGCGAGTGATATGCGAAAATATAGAAGACTATGAAA CTTGGGAACCATCTGTAACAGTAAGTATGACTGATGGAAGATATTTGATGAAAAAAATCCTTTTAATAAATAAATAGAATAATTTATATTGCAATGGCTTTTCCCAGACAAAAAGTCTTAAAATTGTTTTTGAATAGTCTTGATCCAAGTTTCATCAGTCTTCTGAGATAGTACATACTTATCACCTGTCTTGCAG.

[0022] In this invention, the nucleotide sequence of the mutant is similar to that of a pigeon. TYRP1 Compared to the gene, it has the c.891delT mutation, which is located in TYRP1A single-base T deletion mutation, c.891delT, in the third exon of the gene causes a frameshift and premature termination of the amino acid sequence after threonine 297 (p.T297fs); wild-type pigeons containing the c.891delT site... TYRP1 The gene fragment sequence is shown in SEQ ID NO.2, specifically as follows: TGTTTATGTGGTTGAACATGTTGCAGGACCCCTCCTTTGGACTGCCCTACTGGAATTTTGCAACAGGACAAAACACCTGTGATATCTGCACAGATGACTTGATGGGAGCTAGAAGCAATTTTGATGTCTCCCTTATCAGCCAGAACTCAATATTCTCTCAGTGGCGAGTGATATGCGAAAATATAGAAGACTATGAAAC TTTGGGAACCATCTGTAACAGTAAGTATGACTGATGGAAGATATTTGATGAAAAAAATCCTTTTAATAAATAAATAGAATAATTTATATTGCAATGGCTTTTCCCAGACAAAAAGTCTTAAAATTGTTTTTGAATAGTCTTGATCCAAGTTTCATCAGTCTTCTGAGATAGTACATACTTATCACCTGTCTTGCAG. Among them pigeon TYRP1 The mutation site of the gene mutant is located in wild-type pigeons. TYRP1 The 202nd position of the gene fragment sequence SEQ ID NO.2, i.e., the 202nd position "T" of the sequence SEQ ID NO.2, is deleted.

[0023] This invention provides the application of the mutant in the preparation of products for identifying the sex of pigeons.

[0024] This invention provides a primer set for identifying the sex of pigeons, the sequences of which are shown in SEQ ID NO.3~5, specifically: SEQ ID NO.3: 5'-GAAGGTGACCAAGTTCATGCTCTTACTGTTACAGATGGTTCCCAAA-3'; SEQ ID NO.4: 5'-GAAGGTCGGAGTCAACGGATTCTTACTGTTACAGATGGGTTCCCAAG-3'; SEQ ID NO. 5: 5'-ATTCTCTCAGTGGCGAGTGATATG-3'.

[0025] In this invention, the primer sequence SEQ ID NO.3 is the forward primer sequence for recognizing the wild-type allele, with a T base at its 3' end; SEQ ID NO.4 is the forward primer sequence for recognizing the mutant allele, with a T-deleted sequence at its 3' end; and SEQ ID NO.5 is the reverse primer sequence.

[0026] In this invention, all forward primers are linked to fluorescent labels, wherein the forward primer sequence for wild-type alleles is linked to FAM, and the forward primer sequence for mutant alleles is linked to HEX.

[0027] The present invention also provides a kit for identifying the sex of pigeons, comprising the aforementioned primer set.

[0028] This invention also provides a method for determining the sex of pigeons, comprising the following steps: (1) Extract genomic DNA from the pigeons to be tested; (2) Perform real-time PCR amplification using the primer set or the kit described above; (3) Genotype is determined based on fluorescence signal. When only HEX fluorescence signal is detected, it indicates that the sample is a deletion homozygote. When only FAM fluorescence signal is detected, it indicates that the sample is a wild-type homozygote. When both fluorescence signals are detected, it indicates that the sample is a heterozygote.

[0029] This invention also provides a method for breeding sex-differentiated strains of white-feathered meat pigeons and colored-feathered meat pigeons. The method for breeding sex-differentiated strains of white-feathered meat pigeons is as follows: genotyping of white-feathered breeding pigeons is performed using the primer set or the kit described above; homozygous males (- / -) and females (-) with c.891delT mutation are selected as paternal lines, and homozygous males (+ / +) and females (+) with wild-type mutation are selected as maternal lines; the c.891delT mutant males (Z... - Z - ) and wild-type females (Z + W) crossbreeding to obtain F1 generation, eye color was observed at 6-12 days of age; all pigeons with dark brown eyes were male (Z) + Z - All red-eyed pigeons are female (Z) - W); The method for sexing colored-feathered pigeons is as follows: Genotypic screening of gray-feathered breeding pigeons is performed using the primer set or the kit described above; homozygous males (- / -) and females (-) with the c.891delT mutation are selected as paternal lines, and homozygous males (+ / +) and females (+) with wild-type mutations are selected as maternal lines; c.891delT mutant males (Z... - Z - ) and wild-type females (Z + W) crossbreeding yielded F1 generation; observing feather color, all of the grayish-blue pigeons were male (Z) + Z - All the silver ones are female pigeons (Z) - W).

[0030] In this invention, when breeding sex-differentiating strains of white-feathered pigeons, a c.891delT mutant male (- / -) and a wild-type female (+) are crossbred. The resulting chicks can be sexed based on eye color at 6-12 days old, without the need for specialized equipment. When breeding sex-differentiating strains of colored-feathered pigeons, the male and female parents are crossbred. After hatching, the chicks can be distinguished by feather color, with the female (Z...)... - W) carries the missing allele and exhibits silver feathers; males (Z) + Z - It carries at least one wild-type allele, which is characterized by gray plumage.

[0031] This invention also provides pigeons TYRP1 Application of the c.891delT mutation in the gene in determining the sex of pigeons.

[0032] In this invention, the pigeon TYRP1 The c.891delT mutation in the gene, in a colored feather genetic background, causes the gray feathers to turn silver-gray; in a white feather genetic background, the mutation results in a lack of melanin deposition in the iris, causing 6-12 day old chicks to have red eyes (pigment deficiency), while unmutated individuals have dark brown eyes.

[0033] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0034] Example 1

[0035] c.891delT mutation typing method based on KASP technology

[0036] KASP primer design: based on wild-type pigeons TYRP1A specific forward primer 5'-GAAGGTGACCAAGTTCATGCTCTTACTGTTACAGATGGTTCCCAAA-3' (SEQ ID NO.3) was designed based on the gene fragment sequence SEQ ID NO.2 using the FAM tag. A specific forward primer 5'-GAAGGTCGGAGTCAACGGATTCTTACTGTTACAGATGGTTCCCAAG-3' (SEQ ID NO.4) was designed based on the mutant sequence SEQ ID NO.1 using the HEX tag. A universal reverse primer 5'-ATTCTCTCAGTGGCGAGTGATATG-3' (SEQ ID NO.5) was designed based on the HEX tag.

[0037] Genomic DNA was extracted from 123 white-feathered European pigeons, 60 silver king pigeons, and 40 gray king pigeons using the blood genomic DNA extraction kit (DP304) from Tiangen Biotech (Beijing) Co., Ltd. Real-time quantitative PCR amplification was performed using the KASP primer set. The amplification system (10 μL) consisted of: 5 μL 2×KASP Master mix, 0.15 μL Allele X primer (SEQ ID NO.3), 0.15 μL Allele Y primer (SEQ ID NO.4), 0.4 μL Common primer (SEQ ID NO.5), 10–100 ng DNA template, and ddH2O to a final volume of 10 μL. The amplification program was as follows: 94℃ for 15 min (hot start); 94℃ for 20 s, 61℃→55℃ (-0.6℃ / cycle) for 60 s, 10 cycles; 94℃ for 20 s, 55℃ for 60 s, 30 cycles; 37℃ for 1 min (endpoint fluorescence reading). The results are shown in Table 1, Table 2 and... Figure 1 .

[0038] Table 1 White Pigeon Group

[0039] Table 2. Gray Feather and Silver Feather Groups

[0040] As shown in Tables 1 and 2, the c.891delT mutation exhibits stable sex-linked inheritance characteristics in both genetic backgrounds, and the phenotype (red eyes / dark brown eyes, silver feathers / gray feathers) is completely linked to the genotype.

[0041] Depend on Figure 1 It can be seen that the FAM signal (blue) indicates that the wild-type female (Z) + W) → Dark brown eyes / gray feathers; HEX signal (green): Mutant male (Z - Z - ) or female (Z- W) → Red-eyed / Silver-gray feathers; FAMHEX dual signal (red): Heterozygous male (Z + Z - → Dark brown eyes / gray feathers.

[0042] Example 2: Breeding of sex-separated breeding lines for white-feathered meat pigeons (eye color marking)

[0043] A European white-feathered pigeon population was selected, and genotyping was performed using the KASP method described in Example 1. The paternal line (red-eyed paternal line) was used to screen for c.891delT mutant females (Z). - W) and homozygous mutant males (Z) - Z - ), forming the red-eyed core group. Maternal lineage (dark brown-eyed paternal lineage): selecting wild-type homozygous males (Z). + Z + ) and wild-type females (Z + W), forming a dark brown eye core group. Utilizing the Z-chromosome-linked recessive inheritance pattern, the c.891delT mutant male (Z - Z - ) and wild-type females (Z + W) Crossbreeding to obtain F1 generation; observe eye color at 6-12 days of age. See the technical route below. Figure 2 See the phenotypic diagram for eye color observation. Figure 3 .

[0044] Depend on Figure 3 It can be concluded that all pigeons with dark brown eyes are male (Z). + Z - All red-eyed pigeons are female (Z) - W).

[0045] Example 3: Breeding of sex-separated colored-feathered pigeons (feather color marking)

[0046] Gray and silver-feathered pigeons were selected, and genotyping was performed using the KASP method described in Example 1. Heterozygotes (+ / -) were eliminated through targeted breeding, and silver-feathered male pigeons (- / -) were crossbred with gray-feathered female pigeons (+) to obtain the F1 generation. Feather color was observed. The technical route is described in [link to technical details]. Figure 4 See the phenotypic diagram for feather color observation. Figure 5 .

[0047] Depend on Figure 5 It can be seen that all the gray-feathered pigeons are male (Z). + Z - All the silver ones are female pigeons (Z) - W). As can be seen, by using the method of the present invention, the sex of commercial pigeon chicks can be distinguished based on feather color after they hatch and grow feathers.

[0048] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A mutant of the pigeon TYRP1 gene, characterized in that, The nucleotide sequence of the mutant is shown in SEQ ID NO.

1.

2. The mutant according to claim 1, characterized in that, The mutant's nucleotide sequence has the c.891delT mutation compared to the pigeon TYRP1 gene.

3. The application of the mutant according to claim 1 or 2 in the preparation of products for identifying the sex of pigeons.

4. A primer set for identifying the sex of pigeons, characterized in that, The sequences of the primer set are shown in SEQ ID NO.3~5.

5. The primer set according to claim 4, characterized in that, The primer sequence SEQ ID NO.3 is the forward primer sequence for recognizing the wild-type allele, SEQ ID NO.4 is the forward primer sequence for recognizing the mutant allele, and SEQ ID NO.5 is the reverse primer sequence.

6. The primer set according to claim 5, characterized in that, All forward primers were linked to fluorescent labels, with the forward primer sequence for wild-type alleles linked to FAM and the forward primer sequence for mutant alleles linked to HEX.

7. A kit for determining the sex of pigeons, characterized in that, Includes the primer set as described in any one of claims 4 to 6.

8. A method for determining the sex of pigeons, characterized in that, Includes the following steps: (1) Extract genomic DNA from the pigeons to be tested; (2) Perform real-time PCR amplification using the primer set described in any one of claims 4 to 6 or the kit described in claim 7; (3) Genotype is determined based on fluorescence signal. When only HEX fluorescence signal is detected, it indicates that the sample is a deletion homozygote. When only FAM fluorescence signal is detected, it indicates that the sample is a wild-type homozygote. When both fluorescence signals are detected, it indicates that the sample is a heterozygote.

9. A method for breeding sex-differentiating strains of white-feathered and colored-feathered meat pigeons, characterized in that, The method for sexing white-feathered pigeons is as follows: Genotyping of white-feathered breeding pigeons is performed using the primer set described in any one of claims 4-6 or the kit described in claim 7; homozygous males (- / -) and females (-) with the c.891delT mutation are selected as paternal lines, and homozygous males (+ / +) and females (+) with wild-type mutations are selected as maternal lines; c.891delT mutant males (Z... - Z - ) and wild-type females (Z + W) crossbreeding to obtain F1 generation, eye color was observed at 6-12 days of age; all pigeons with dark brown eyes were male (Z) + Z - All red-eyed pigeons are female (Z) - W); The method for sexing colored-feathered pigeons is as follows: Genotyping of gray-feathered pigeons is performed using the primer set described in any one of claims 4-6 or the kit described in claim 7; homozygous males (- / -) and females (-) with the c.891delT mutation are selected as paternal lines, and homozygous males (+ / +) and females (+) with wild-type mutations are selected as maternal lines; c.891delT mutant males (Z... - Z - ) and wild-type females (Z + W) crossbreeding yielded F1 generation; observing feather color, all of the grayish-blue pigeons were male (Z) + Z - All the silver ones are female pigeons (Z) - W).

10. Application of the c.891delT mutation in the pigeon TYRP1 gene in determining the sex of pigeons.