Application of cysteine-rich receptor kinase MdCRK26 in apple plants against fungal infection
By overexpressing the MdCRK26 receptor kinase in apple plants, their resistance to various fungal diseases is enhanced, solving the problem of insufficient disease resistance in apples in existing technologies, providing a new method of molecular breeding, and reducing reliance on chemical control.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- CHINA AGRI UNIV
- Filing Date
- 2026-01-21
- Publication Date
- 2026-06-05
AI Technical Summary
Existing technologies lack effective molecular methods to enhance apple plant resistance to various fungal diseases, relying mainly on chemical control, and lack methods for screening and breeding apple varieties with strong disease resistance.
By overexpressing the cysteine-rich receptor kinase MdCRK26 in apple plants, the MdCRK26 gene was introduced into apple tissue culture seedlings and branches using the pFGC5941 vector, thereby enhancing their resistance to fungal infections.
It significantly improves the resistance of apple plants to leaf spot, brown spot, anthracnose leaf blight, ring spot, and rot, providing a new approach to molecular breeding and reducing reliance on chemical control.
Smart Images

Figure CN122146750A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular disease resistance technology, specifically to the application of cysteine-rich receptor kinase MdCRK26 in the resistance of apple plants to fungal infections. Background Technology
[0002] apple( Malus domestica Apple is a globally cultivated and consumed fruit crop, holding an important position in the world fruit market. Apple diseases are a significant factor restricting apple yield and quality in my country. Apple valsa canker, apple ring rot, and early leaf fall diseases (primarily Marssonina leafspot, Alternaria leaf blotch, and Glomerella leafspot) are the three major apple diseases in my country, prevalent and causing severe damage in apple-producing areas. Currently, apple disease control primarily relies on chemical methods. Breeding apple varieties with strong overall disease resistance is an effective way to address this issue. Therefore, screening and identifying proteins in apple plants that play a crucial role in resisting various fungal diseases is extremely important for breeding apple varieties with comprehensive disease resistance. Summary of the Invention
[0003] To address the shortcomings of existing technologies, the present invention aims to provide an application of cysteine-rich receptor kinase MdCRK26 in the resistance of apple plants to fungal infections. This invention, through transient overexpression of cysteine-rich receptor kinase MdCRK26 in apple tissue-cultured seedlings 'Gala-3' and apple 'Gala' branches, found that increased expression of cysteine-rich receptor kinase MdCRK26 enhances the resistance of apples to the aforementioned five diseases. This molecular approach to resisting apple diseases can be beneficial for the prevention and control of various apple diseases and for the molecular breeding of apples.
[0004] To achieve the above objectives, the technical solution adopted by the present invention is as follows: An application of a cysteine-rich receptor kinase MdCRK26 in the resistance of apple plants to fungal infections, characterized in that the application improves the antifungal resistance of apples by overexpressing receptor kinase MdCRK26 in apple plants; The nucleotide sequence of the receptor kinase MdCRK26 is shown in SEQ ID NO.1.
[0005] The fungal infections include: leaf spot, brown spot, anthracnose leaf blight, ring spot, and rot.
[0006] Primers for detecting receptor kinase MdCRK26 expression, characterized in that the sequences of the primers are shown in SEQ ID NO. 2-3.
[0007] A method for improving the resistance of apple plants to fungal infections, characterized by comprising the following steps: Step 1: Insert the receptor kinase MdCRK26 into the two restriction sites of BamHI and NcoI on the pFGC5941 vector, and transform it into E. coli DH5α to obtain a vector overexpressing the MdCRK26 gene. Step 2: Extract plasmids from the MdCRK26 gene overexpression vector obtained in Step 1; Step 3: Transfer the plasmid obtained in Step 2 into Agrobacterium to prepare a transgenic Agrobacterium bacterial solution; Step 4: Transfer the transgenic Agrobacterium tumefaciens solution obtained in Step 3 into apple leaves and branches.
[0008] The fungal infections include: leaf spot, brown spot, anthracnose leaf blight, ring spot, and rot.
[0009] The specific operation process of the above method is as follows: S1: Total RNA was extracted from infected apples using the CTAB method; S2: Reverse transcribe the total RNA extracted in S1 into cDNA; S3: Using the reverse transcription template obtained in S2 and RT-PCR primers, clone the gene described in claim 1; S4: Insert the gene obtained in S3 into the two restriction sites of BamHI and NcoI on the pFGC5941 vector and transform it into E. coli DH5α. S5: Extract plasmids from the overexpression target gene vector constructed in S4; S6: The plasmid extracted in S5 was transferred into Agrobacterium and plated on solid YEP medium containing antibiotics. The plates were incubated upside down at 28°C for 24-48 hours. The antibiotics contained 50 mg / L Kana and 20 mg / L Rif. S7: Select a single spot from the Agrobacterium cultured in S6, add 2 ml of YEP liquid medium containing 50 mg / L Kana and 20 mg / L Rif, and incubate overnight at 28 ℃ and 180 rpm. S8: Take 80 μL of Agrobacterium cultured in S7, add 4 ml of YEP liquid medium containing 50 mg / L Kana, 20 mg / L Rif and 10 μM acetylsyl syringone, and incubate at 28 ℃ and 180 rpm for 12-16 h. S9: Centrifuge the Agrobacterium cultured in S8 at 10,000 rpm for 1 min at room temperature to remove the culture medium; suspend the above bacterial culture in 1-2 ml of suspension by vortexing; take 10 μL of the vortexed bacterial culture and add it to 990 μL of suspension to obtain a bacterial cell suspension, measure its OD600 using a spectrophotometer, adjust the bacterial cell suspension to OD600 = 1.0, and let it stand at room temperature for 2-5 h; the above suspension includes: 10 mM MES-KOH with pH adjusted to 5.2, 10 mM MgCl2, and 100 μM acetylsylgenone; S10: Before using the bacterial solution obtained in S9, vortex or pipette the suspended bacterial cells. Then, use a 1mL syringe without a needle to draw up the bacterial solution, avoiding the leaf veins. After making a small hole in the apple leaf with the needle of the 1mL syringe, inject the bacterial solution into the leaf. Inject 1-2 holes in each leaf. S11: Before use, the bacterial solution obtained from S9 is vortexed or pipetteed to suspend the bacterial cells, mixed 1:1, and then vacuumed to transfer the bacterial solution into the branches. S12: Observe the leaves and branches 4 days after injecting Agrobacterium.
[0010] Application of MdCRK26-rich cysteine receptor kinase in the breeding of transgenic apple plants with resistance to fungal diseases, wherein the receptor kinase MdCRK26 is introduced into apple plants to cultivate apple varieties that overexpress MdCRK26.
[0011] The beneficial effects of the application of the cysteine-rich receptor kinase MdCRK26 in the antifungal infection of apple plants described in this invention are as follows: By transiently overexpressing receptor kinase MdCRK26 on apple tissue culture seedlings 'Gala-3' and 'Gala' apple branches using the pFGC5941 vector, it was found that overexpression of receptor kinase MdCRK26 can enhance the disease resistance of apples and can be used to control various apple diseases and for molecular breeding of apples. Attached Figure Description
[0012] The present invention includes the following figures: Figure 1 Figure 1. Experimental results showing the effect of overexpressing receptor kinase MdCRK26 to enhance the resistance of susceptible apple cultivar 'Gala-3' to apple blotch, apple brown spot, and apple anthracnose leaf blight. Figure 2 Figure 1 shows the experimental results of overexpressing receptor kinase MdCRK26 to enhance the resistance of susceptible apple cultivar 'Gala' to ring rot and apple rot. Detailed Implementation
[0013] The following examples are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, all reagents and materials mentioned in this invention are used in accordance with the conditions recommended in the manufacturer's instructions.
[0014] 1. Extraction of total RNA from plants: (1) The tissue samples of apple 'Hanfu' were rapidly ground in liquid nitrogen; (2) Add 990 μL of preheated CTAB solution and 10 μL of β-mercaptoethanol to the plant tissue, vortex for 30 s and then incubate in a 65°C water bath for 10 min. (3) Add 1000 μL CI (chloroform / isoamyl alcohol volume ratio = 24:1) and mix by inverting the container. (4) 4℃, 12000rpm, 10min; (5) Take 800 μL of supernatant, add an equal volume of CI, and mix by inverting the container. (6) 4℃, 12000rpm, 10min; (7) Take about 650 μL of the supernatant and add 1000 μL of isopropanol; (8) Precipitate at -20℃ for 30 min; (9) 4℃, 12000rpm, 10min; (10) Discard the supernatant and add 1 ml of 75% ethanol to wash the precipitate; (11) 4℃, 12000rpm, 10min; (12) Discard the supernatant, 4℃, 12000rpm, 2min; (13) Aspirate the supernatant and add 40 μL of RNase-free H2O to dissolve the precipitate; (14) Integrity was detected by 1% agarose gel electrophoresis, and RNA concentration was calculated by measuring the absorbance at 260 nm using a UV spectrophotometer.
[0015] 2. Cloning of MdCRK26: (1) Total RNA was extracted from 'Gala-3' using CTAB; (2) Reverse transcription into cDNA; (3) Design RT-PCR primers: F: ATAAAACGATATGTCCTGAGTTTCC; R: CTCTCTCCAACACATGCACCA.
[0016] (4) After PCR, the PCR product fragment size was detected by 1% agarose gel electrophoresis, 0.1% TAE electrophoresis buffer, 70-110 V voltage electrophoresis for about 15 min, ethidium bromide staining, and UV light detection.
[0017] 3. Constructing a vector overexpressing MdCRK26 MdCRK26 was inserted into the BamHI and NcoI restriction sites on the pFGC5941 vector, transformed into E. coli DH5α, and subjected to plasmid picking and sequencing. After confirming the sequence was correct, the plasmid was extracted and transiently expressed.
[0018] The specific steps are as follows: Enzyme digestion reaction system: Green Buffer (Thermo) 4 μL 2 μL each of BamHI and NcoI 20 μL of recovered product DEPC water was added to a final volume of 40 μL. The above reaction system was placed in a 37°C water bath for 24 hours. The recovered products were then analyzed by agarose gel electrophoresis. Fragments of the correct size were selected and recovered using a Novizan recovery kit.
[0019] T4 ligase ligation system: T4 Buffer (Takara) 10μL T4 ligase (Takara) 1 μL 8 μL of recovered product 1 μL of carrier The above reaction system was placed in a metal bath at 16°C, and after 24 hours, 20 μL of the above ligation system was transferred to Escherichia coli DH5α.
[0020] 4. Agarose gel recovery of the target fragment Use the recovery kit, following the instructions in the kit's manual.
[0021] (1) Cut out the agarose containing the target sequence fragment, remove as much excess gel as possible, add 3 gel volumes of Buffer B2, and mix intermittently until the gel block is completely melted.
[0022] (2) Add 200 μL of isopropanol and mix well.
[0023] (3) Transfer the mixture to a column separation and purification column, centrifuge at 12,000 × g for 60 s, and discard the waste liquid in the collection tube.
[0024] (4) Add 300 μl Buffer B2 to the purification column, centrifuge at 12,000× g for 30 s, and discard the waste liquid in the collection tube.
[0025] (5) Add 500 μl Wash Buffer to the purification column, centrifuge at 12,000× g for 30 s, and discard the waste liquid in the collection tube.
[0026] (6) Repeat once.
[0027] (7) After being air-conditioned for 2 minutes, place it in a fume hood and blow it for 5 minutes.
[0028] (8) Take a new 1.5 ml centrifuge tube, place the purification column in the new 1.5 ml centrifuge tube, add 30 μL of TE Buffer preheated at 55 ℃, place at room temperature for 2 min, and centrifuge at 12,000× g for 60 s.
[0029] (9) Discard the adsorption column and store the recovered product in a -20 ℃ refrigerator.
[0030] 5. Escherichia coli DH5α transformation process: Add 10 μL of the ligated vector to 30 μL of *E. coli* DH5α, incubate on ice for 30 min, heat shock at 42 ℃ for 30 s, incubate on ice for 2 min, then add 200 μL of liquid LB medium, place on a shaker at 37 ℃, shake at 200 rpm for 40-60 min, and centrifuge at 10,000 rpm for 1 min at room temperature. Aspirate 200 μL of the supernatant, suspend the bacterial cells in the remaining liquid, spread on LB+Amp solid medium, and incubate overnight at 37 ℃.
[0031] 6. Spot removal: Pick a single colony after overnight culture and place it in 200 μL of LB+Amp liquid medium. Place it on a shaker at 37 ℃ and shake at 200 rpm for 3 h.
[0032] Bacterial PCR: 2 × PCRMix 5 μL 0.5 μL each of F / R (10 μM) 1 μL of bacterial solution Top up the DEPC water to 10 μL The above system was subjected to 35 cycles: 95 °C for 3 min; 95 °C for 1 min; 60 °C for 30 s; 72 °C for 30 s; 72 °C for 10 min; 16 °C for 1 min.
[0033] PCR was performed using 1% agarose gel electrophoresis with 0.1% TAE buffer at 70-110 V for approximately 15 min. Ethidium bromide staining was followed by UV staining to determine the size of PCR product fragments. Bacterial cultures with correctly sized bands were selected and sent to Sangon Biotech (Shanghai) Co., Ltd. Sequencing results were compared using DNAMAN.
[0034] 7. Plasmid extraction (Vazyme, FastPure Plasmid Mini Kit, DC201) (1) Take 1-5 ml of overnight culture (12-16 h), add it to a 2 ml centrifuge tube, and centrifuge at 10000 rpm for 1 min. Discard the culture medium and aspirate the remaining liquid. (2) Add 250 μl of Buffer P1 (RNase A has been added) to the centrifuge tube and vortex to mix. (3) Add 250 μl of Buffer P2 to step 2 and gently mix by inverting the container 8-10 times. (4) Add 350 μl of Buffer P3 to step 3, immediately and gently invert the container 8-10 times, and centrifuge at 12000 rpm for 10 min. (5) Place the FastPure DNA Mini Columns adsorption column into a 2 ml collection tube. Carefully transfer the supernatant from step 4 into the adsorption column using a pipette, and centrifuge at 12000 rpm for 30 seconds. Discard the waste liquid in the collection tube and return the adsorption column to the collection tube; (6) Add 600 μl of Buffer PW2 (diluted with anhydrous ethanol) to the adsorption column. Centrifuge at 12000 rpm for 30 seconds. Discard the waste liquid and return the adsorption column to the collection tube; (7) Repeat step 6; (8) Place the adsorption column back into the collection tube and centrifuge at 12000 rpm for 1 min to dry the adsorption column; (9) Place the adsorption column into a new sterile 1.5 ml centrifuge tube. Add 30-100 μl of Elution Buffer to the center of the membrane on the adsorption column. Incubate at room temperature for 2 min, then centrifuge at 12000 rpm for 1 min to elute the DNA; (10) Discard the adsorption column and store the DNA product at -20°C. 8. Agrobacterium-mediated transformation: (1) Take a tube of prepared competent cells, thaw them completely on ice, and then gently suspend the cells.
[0035] (2) Add 5-10 μL of plasmid overexpressing AamilR292 transgenic fungus, mix gently, and place on ice for 30 min.
[0036] (3) Cold shock in liquid nitrogen for 1 min.
[0037] (4) Heat shock at 37 ℃ for 5 min, then place on ice for 2 min.
[0038] (5) Add 500 μL of YEP liquid medium and incubate at 28 ℃ and 140 rpm for 4-6 h with shaking.
[0039] (6) Centrifuge at 4000 rpm for 3 min at room temperature, remove about 400 μL of supernatant, and suspend the cells in the remaining culture medium.
[0040] (7) Spread the bacteria on solid YEP medium containing antibiotics (50 mg / L Kana, 20 mg / L Rif).
[0041] (8) Invert the plate at 28℃ for 24-48h.
[0042] 9. Overexpression of MdCRK26 in leaves of 'Gala-3' tissue culture seedlings The constructed MdCRK26 plasmid was transformed into Agrobacterium and transiently expressed. After 4 days of culture, the results are shown in the figure. Figure 1 In case A: Four days after the transient expression of the susceptible variety 'Gala-3' by Agrobacterium-mediated translocation, the expression level of MdCRK26 was detected by real-time quantitative PCR, and the expression level of MdCRK26 was found to be significantly increased. Figure 1 China B and Figure 1 In the table, C represents the statistical analysis of leaf phenotype and lesion area of *Gala-3* cultivars with transient expression of the susceptible variety via Agrobacterium-mediated inoculation 4 days after inoculation and 48 hours after inoculation; WT represents cultivars without transient expression of *Gala-3*; EV represents cultivars with transient expression of *Gala-3* via the pFGC5941 vector; and OE-MdCRK26 represents cultivars with transient expression of *Gala-3* via the pFGC5941 vector overexpressing MdCRK26. The results showed that after transient overexpression of MdCRK26, the lesion area on *Gala* leaves significantly decreased after fungal inoculation.
[0043] 10. Overexpression of MdCRK26 in 'Gala' branches The constructed MdCRK26 plasmid was transformed into Agrobacterium and transiently expressed. After 4 days of culture, the results are shown in the figure. Figure 2 In the study of Agrobacterium-mediated transient expression of the susceptible cultivar 'Gala', the expression level of MdCRK26 was significantly increased by quantitative real-time PCR after 4 days. Figure 2In Figures B and C, the phenotypic and lesion area of branches of the susceptible cultivar 'Gala' were statistically analyzed 4 days after inoculation with Agrobacterium-mediated transient expression and 48 hours after inoculation. WT represents branches without transient expression of 'Gala'; EV represents branches with transient expression of 'Gala' using the pFGC5941 empty vector; and OE-MdCRK26 represents branches with transient expression of 'Gala' using the pFGC5941 vector overexpressing MdCRK26. The results showed that after transient overexpression of MdCRK26, the lesion area of 'Gala' branches significantly decreased after fungal inoculation.
[0044] The primers used for real-time PCR as described in items 9 and 10 above are as follows: MdCRK26 quantitative PCR primers: F: GAATTGTGGGGACCTACGGG (SEQ ID NO.2), R: CTCCAACTCCTCCATGCGAA (SEQ ID NO.3).
[0045] Internal control U6 fluorescence quantitative primers: F: 5'-TTGGGGACATCCGATAAAATTG-3', R: 5'-AAAAATTTGGACCATTTCTCG-3'.
[0046] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.
[0047] The contents not described in detail in this specification are existing technologies known to those skilled in the art.
Claims
1. The application of a cysteine-rich receptor kinase MdCRK26 in the antifungal infection of apple plants, characterized in that, The application enhances the overall antifungal infection resistance of apples by overexpressing receptor kinase MdCRK26 in apple plants. The nucleotide sequence of the receptor kinase MdCRK26 is shown in SEQ ID NO.
1.
2. Primers for detecting receptor kinase MdCRK26 expression, characterized in that, The sequences of the primers are shown in SEQ ID NO. 2-3.
3. A method for enhancing the resistance of apple plants to fungal diseases, characterized in that, The receptor kinase MdCRK26 was introduced into apple leaves or branches via Agrobacterium-mediated transformation, resulting in its overexpression in apples. The overexpression of the MdCRK26 receptor kinase can enhance the resistance of apples to fungal pathogens.
4. The application of MdCRK26-rich cysteine receptor kinase in the breeding of transgenic apple plants with resistance to fungal diseases, characterized in that... The application involves introducing the receptor kinase MdCRK26 into apple plants to cultivate apple varieties that overexpress the receptor kinase MdCRK26.