Application of overexpression of cysk gene in improving soluble protein content of leguminous forage
By overexpressing the Escherichia coli cysK gene in alfalfa, the soluble protein content of leguminous forage leaves was successfully increased, solving the problem of the lack of effective molecular breeding targets in existing technologies and achieving a high protein content.
Patent Information
- Application Number
- CN202610242274.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-28
- Publication Date
- 2026-06-05
Smart Images

Figure CN122146754A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology and relates to the application of O-acetylserine thiol lyase family genes, specifically involving the overexpression of... cysK Application of genes in increasing the soluble protein content of leguminous forage. Background Technology
[0002] The information disclosed in this background section is intended only to enhance understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.
[0003] Leguminous forage grasses are an important source of protein feed, and the protein content of their leaves directly affects feed quality. Breeding high-protein varieties is one of the core goals of genetic improvement, and increasing the soluble protein content in leaves is of great significance for enhancing plant metabolic activity and nutritional value. However, effective molecular breeding targets are currently lacking.
[0004] In plant sulfur metabolism pathways, O-acetylserine thiol lyase (OASTL) catalyzes the synthesis of cysteine, an amino acid that is a precursor to many sulfur-containing organic compounds (such as glutathione and phytoalexins) and participates in important physiological processes such as redox balance and stress response. Previous studies have successfully increased the levels of cysteine and glutathione in model plants such as tobacco by heterologous overexpression of OASTL homologs from different species (e.g., spinach, yeast, and soybean), indicating the potential application of this enzyme in metabolic engineering. However, current understanding of this type of gene, especially… cysK There are no reports on whether and how genes affect the overall accumulation of soluble proteins in the leaves of leguminous forage grasses. Summary of the Invention
[0005] To address the shortcomings of existing technologies, the objective of this invention is to provide overexpression... cysK The application of genes in improving the soluble protein content of leguminous forages: This invention involves overexpressing *Escherichia coli* in alfalfa. cysK The gene significantly increases the soluble protein content of its leaves by approximately 28%. This invention is the first to utilize Escherichia coli derived from prokaryotes. cysK The successful application of genes to the quality improvement of leguminous forage grasses has overcome the technical barrier of distant species kinship, providing new genetic resources and efficient technical approaches for breeding new varieties of leguminous forage grasses with high protein and high nutritional value, which is of great significance for promoting the sustainable development of the grass animal husbandry industry.
[0006] To achieve the above objectives, the technical solution of the present invention is as follows:
[0007] The first aspect of the invention provides overexpression cysKApplication of genes in increasing the soluble protein content of leguminous forage grasses; The cysK The gene sequence is shown in SEQ ID NO.2.
[0008] In some embodiments of the present invention, the legume forage includes any one or more of alfalfa and clover.
[0009] In some embodiments of the present invention, the application is to increase the soluble protein content in the leaves of leguminous forage grasses.
[0010] A second aspect of the invention provides the same as described in the first aspect. cysK Applications of gene-related biomaterials, wherein the application is any one of the following: A1) Application in increasing the soluble protein content of leguminous forage; A2) Application in leguminous forage breeding.
[0011] In some embodiments of the present invention, the biomaterial is any one of B1) to B3) below: B1) An expression cassette containing a nucleic acid molecule with a nucleotide sequence as shown in SEQ ID NO.2; B2) Recombinant vectors containing nucleic acid molecules with nucleotide sequences as shown in SEQ ID NO.2; B3) A recombinant microorganism containing a nucleic acid molecule with a nucleotide sequence as shown in SEQ ID NO.2, or a recombinant microorganism containing the expression cassette described in B1), or a recombinant microorganism containing the recombinant vector described in B2), wherein the microorganism is Agrobacterium.
[0012] A third aspect of the present invention provides a method for increasing the soluble protein content of leguminous forage, the method comprising overexpressing in leguminous forage... cysK Genes that are overexpressed cysK Transgenic leguminous forage lines containing the gene; cysK The gene sequence is shown in SEQ ID NO.2.
[0013] In some embodiments of the present invention, the method includes: constructing a plant overexpression vector containing the nucleotide sequence shown in SEQ ID NO.2, introducing the plant overexpression vector into leguminous forage plant cells, and obtaining overexpression. cysK Genetically modified legume forage lines.
[0014] In some embodiments of the present invention, the plant overexpression vector is pB7WG2D- cysK .
[0015] In some embodiments of the present invention, the legume forage includes any one or more of alfalfa and clover.
[0016] In a fourth aspect, the present invention provides a legume forage containing the exogenous inserted gene shown in SEQ ID NO.2.
[0017] The beneficial effects of this invention are as follows: This invention utilizes Escherichia coli... cysK After gene optimization (shown in SEQ ID NO.2), heterologous overexpression in alfalfa successfully achieved positive regulation of soluble protein content in leguminous forage leaves for the first time. Experimental results showed that overexpression of this gene significantly increased the soluble protein content in leaves by approximately 28% (a figure far exceeding that of existing alfalfa varieties), effectively overcoming the technical barriers to functional expression of prokaryotic genes in higher plants, especially in distantly related leguminous forages. This provides a novel and feasible solution for directly utilizing microbial gene resources to improve the nutritional quality of forage, creatively expanding the gene selection range and technical pathways for breeding high-protein forages. Attached Figure Description
[0018] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.
[0019] Figure 1 This is a phylogenetic tree analysis based on the OASTL protein sequence. Among them: AtOASTL Arabidopsis thaliana OASTL Family genes. MtOASTL Tribulus terrestris alfalfa OASTL Gene. MsOASTL Alfalfa OASTL Gene. GmOASTL Soybeans OASTL Gene. cysK Escherichia coli OASTL Gene.
[0020] Figure 2 Wild-type (left) and overexpression cysK The transgenic alfalfa strain with the gene on the right.
[0021] Figure 3 DNA-level PCR identification of transgenic alfalfa lines. Wherein: Marker: DNA molecular weight standard; Plasmid: positive plasmid control; WT: wild type; OE: transgenic line. Results showed that DNA overexpression was detected. cysK Alfalfa plants that are positive for the gene.
[0022] Figure 4In transgenic alfalfa lines cysK RT-PCR analysis of gene transcription levels. Among them: Actin Genes were used as internal controls. Results showed that in the OE-5 strain... cysK Higher gene expression levels were observed, and the corresponding strains were selected for subsequent experiments.
[0023] Figure 5 The results show the determination of soluble protein content in leaves of wild-type (WT) and transgenic line (OE-5). Data are presented as mean ± standard deviation (n=3). The results indicate a significant difference compared to WT (p<0.05). The results show that, compared to wild-type, overexpression... cysK The transgenic alfalfa plants showed an approximately 28% increase in soluble protein content. This indicates that... cysK Genes play a significant role in improving the protein content of leguminous forage. Detailed Implementation
[0024] To enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific drawings and embodiments. The examples described below are merely preferred embodiments of the present invention. It should be noted that the following description is only for explaining the present invention and is not intended to limit the present invention in any way. Any simple modifications, equivalent changes and modifications made to the embodiments based on the technical essence of the present invention shall fall within the scope of the technical solution of the present invention.
[0025] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, such as those described in "Molecular Cloning: A Laboratory Manual" (Sambrook and Russell, 2001).
[0026] Unless otherwise specified, the materials, reagents, strains, vectors, etc. used in the following examples are all commercially available.
[0027] 10×N6 large salt mother liquor (1L): MgSO4·7H2O 1.85 g, KNO3 28.3 g, (NH4)2SO4 4.63 g, CaCl2·2H2O 1.66 g, KH2PO4 4 g.
[0028] 1000×SH trace salt stock solution (100mL): MnSO4·H2O 1 g, H3BO3 500 mg, ZnSO4·7H2O 100 mg, KI 100 mg, Na2MoO4·2H2O 10 mg, CuSO4·5H2O 20 mg, CaCl2·6H2O 10 mg.
[0029] 1000×SH Organic Mother Liquor (100mL): Nicotinic acid 500 mg, pyridoxine hydrochloride 500 mg, thiamine hydrochloride 500 mg.
[0030] 50×EDTA iron salt mother liquor (500mL): NaFe·EDTA 3.487 g.
[0031] The formulation of SH3a medium (1L) is as follows: 50 mL of 10×N6 macrosalt stock solution, 1 mL of 1000×SH microsalt stock solution, 1 mL of 1000×SH organic stock solution, 5 mL of 50×EDTA iron salt stock solution, 100 mg of inositol, 30 g of sucrose, 2 mL of 2,4-D (2 mg / mL), 0.5 mL of 6-BA (1 mg / mL), and pH adjusted to 5.8. 4 g of plant gel was added to the solid medium.
[0032] The formulation of SH9 medium (1L) is as follows: 50 mL of 10×N6 macro-salt stock solution, 1 mL of 1000×SH micro-salt stock solution, 1 mL of 1000×SH organic stock solution, 5 mL of 50×EDTA iron salt stock solution, 100 mg of inositol, 20 g of sucrose, and pH adjusted to 5.8. 7 g of agar is added to the solid medium.
[0033] The MSBK medium (1L) formulation is as follows: MURASHIGE & SKOOG (MS) BASAL MEDIUM (M519) (PhytoTechnology Laboratories™) 4.43 g, kinetin (1 mg / mL) 1 mL, 6 Add 0.5 mL of BA (1 mg / mL), 30 g of sucrose, and adjust the pH to 5.8. Add 3 g of plant gel to the solid culture medium.
[0034] The formulation of 1 / 2 MS medium (1L) is as follows: 2.215 g MURASHIGE & SKOOG (MS) BASAL MEDIUM (M519) (PhytoTechnology Laboratories™), 12 g sucrose, pH adjusted to 5.8. 7 g agar is added to the solid medium.
[0035] Example 1: Phylogenetic Tree Analysis Searching for Arabidopsis thaliana on the Tair website OASTL Gene( AtOASA1 The corresponding CDS and protein sequences were downloaded. Homologous genes from alfalfa, soybean, and Escherichia coli were BLASTed on the NCBI website and phylogenetic analysis was performed in MEGA7.
[0036] Example 2: Overexpression of Escherichia coli cysK Obtaining genetically modified alfalfa plants 2.1 Overexpression of pB7WG2D- cysK Carrier construction The image shown in SEQ ID NO. 1 was obtained through the bioinformatics website NCBI. cysK The CDS coding sequence of the gene. This was obtained through the alfalfa codon optimization website OPTIMIZER. cysK The CDS sequence was optimized to obtain the optimized CDS sequence as shown in SEQ ID NO. 2. SEQ ID NO. 2 was synthesized by Qingke Company for subsequent experiments. Primers were designed based on this coding sequence. cysK -F (ATGTCCAAGATTTTCGAAGA) and cysK -R (TCATTGTTGGAGTTCTTTCTC). Utilizing Gateway technology to... cysK The gene CDS sequence was ligated into the pB7WG2D vector, transformed into *E. coli* competent cells DH5α, positive clones were identified, and sequencing was performed. The obtained overexpression vector pB7WG2D- cysK Transformed with Agrobacterium LBA9402, identified positive clones, and stored at -80℃ for later use.
[0037] cysK The CDS coding sequence of the gene is as follows: ATGAGTAAGATTTTTGAAGACAACTCGCTGACTATCGGTCATACGCCGCTGGTTCGACTGAACCGTATCGGTAACGGACGCATTCTGGCGAAGGTAGAATCACGCAACCCGAGCTTTAGCGTCAAATGCCGTATCGGTGCCAATATGATTTGGGATGCCGAAAAACGTGGTGTGCTGAAACCGGGTATTGAACTGGTTGAACCGACCAGCGGTAACACCGGTATTGCCCTTGCCTACGTTGCTGCCGCGCGCGGTTACAAGCTGACCCTGACGATGCCGGAAACGATGAGTATTGAGCGTCGTAAGCTGCTGAAAGCGCTGGGTGCAAATCTGGTGCTGACTGAAGGCGCAAAAGGCATGAAGGGCGCGATTCAGAAAGCAGAAGAAATTGTTGCCAGCAATCCGGAAAAATTCCTGCTGCTTCAGCAATTCAGTAACCCGGCTAACCCGGAAATTCACGAAAAAACCACCGGCCCGGAAATCTGGGAAGACACCGATGGTCAGGTGGATGTGTTTATCTCCGGCGTTGGCACCGGCGGTACGCTGACCGGCGTTTCCCGTTATATCAAAGGAACCAAAGGCAAAGCGGATTTGATCACCGTTGCCGTAGAACCGACAGATTCTCCGGTCATCGCTCAGGCGTTGGCGGGTGAAGAACTCAAGCCTGGCCCACATAAAATTCAGGGCATTGGCGCTGGTTTCATTCCGGGCAACCTCGATCTGAAACTGATTGATAAAGTGGTCGCCATCACTAACGACGAGGCTATCTCTACCGCGCGTCGCTTGATGGAAGAAGAAGGTATTCTGGCAGGTATCTCTTCAGGAGCCGCGGTTGCTGCCGCGCTTAAACTCCAGGAAGATGAAACCTTTACCAATAAGAATATAGTGGTTATTCTACCGTCATCGGGTGAGCGTTATCTGAGCACTGCACTGTTTGCCGATCTCTTTACTGAGAAAGAACTGCAACAGTAA(SEQ IDNO.1)。
[0038] After optimization cysK The CDS coding sequence of the gene is as follows: ATGTCCAAGATTTTCGAAGATAATTCTCTCACTATTGGTCACACTCCATTGGTTCGTCTTAACCGTATTGGAAACGGTCGTATCTTGGCTAAGGTTGAGTCAAGAAACCCTTCATTTAGTGTGAAGTGTCGTATTGGTGCAAACATGATCTGGGATGCTGAGAAGAGAGGTGTGTTGAAGCCTGGTATTGAGTTGGTTGAGCCAACTTCCGGTAATACTGGTATTGCTCTCGCTTATGTTGCTGCTGCTAGAGGTTACAAACTCACTCTTACAATGCCTGAGACAATGTCTATCGAACGTCGTAAGTTGTTGAAGGCTCTTGGTGCTAATCTTGTGCTTACTGAAGGTGCTAAGGGAATGAAGGGAGCTATTCAGAAGGCTGAAGAGATTGTGGCAAGCAATCCAGAGAAGTTTCTGCTTCTTCAACAGTTCTCAAATCCAGCTAACCCTGAGATTCACGAGAAAACCACTGGACCTGAGATTTGGGAAGATACTGATGGTCAAGTTGATGTGTTCATCTCTGGTGTTGGTACTGGTGGTACTCTTACTGGTGTTTCTCGTTACATCAAGGGTACTAAGGGTAAAGCTGATCTTATTACTGTTGCAGTTGAACCTACTGATTCACCTGTGATTGCTCAAGCTCTTGCAGGTGAAGAGTTGAAACCTGGTCCACATAAGATCCAAGGTATTGGAGCTGGTTTCATACCTGGAAATCTCGATCTTAAGCTGATCGATAAGGTTGTTGCTATCACCAATGACGAAGCTATTAGCACAGCTAGACGTCTTATGGAAGAAGAGGGTATTCTTGCTGGTATCTCATCTGGTGCTGCTGTAGCTGCTGCTTTGAAACTCCAAGAAGATGAAACCTTCACCAACAAGAACATCGTTGTGATTCTGCCTTCTTCAGGTGAAAGATACCTCAGCACTGCTTTGTTTGCTGATCTCTTTACCGAGAAAGAACTCCAACAATGA(SEQ IDNO.2)。
[0039] 2.2 Agrobacterium-mediated genetic transformation of alfalfa rooting The Agrobacterium bacteria obtained in step 2.1 and stored at -80℃ were streaked onto YEP solid medium (containing 100 mg / L rifampin and 50 mg / L kanamycin) and incubated upside down at 28℃ for 2 days. Single colonies were selected for colony PCR identification. Positive single colonies were selected and inoculated onto YEP liquid medium supplemented with rifampin and kanamycin and incubated overnight until OD500 reached. 600 Centrifuge at 0.8, 28℃, 4000 rpm for 15 min, discard the supernatant, and dilute the bacteria to OD using conversion buffer. 600 It is 0.2, for backup.
[0040] Preparation of explants. Take the 3rd to 5th fully expanded compound leaves from the apical bud of alfalfa as explants. After collection, disinfect them in a clean bench with bleach containing 0.1% Triton X 100 and 10% sodium hypochlorite (the active ingredient is 0.5% sodium hypochlorite) for 15 min, and then rinse them 3 times with sterile water before use.
[0041] Infection and co-culture of Agrobacterium. Explants were placed on sterile filter paper, the infection solution was blotted off, and then placed on co-culture medium and incubated in the dark at 22°C for 3 days.
[0042] Callus induction and differentiation. Leaves from the culture medium were transferred to sterile Erlenmeyer flasks and washed 3-4 times with sterile water for 1-2 minutes each time. The last wash was with sterile water containing cephalosporin. The leaves were then blotted dry on sterile filter paper and spread evenly on SH3a solid medium containing the appropriate selection antibiotic. The medium was incubated at 22°C for 16 h light / 8 h dark, subcultured every 2 weeks for a total of 3 times. Subsequently, the callus was transferred to MSBK solid medium containing the selection antibiotic PPT (3 mg / L) and cephalosporin 500 mg / L to induce shoot differentiation, incubated at 22°C for 16 h light / 8 h dark for 3 weeks. Embryogenic callus was then transferred to SH9 solid medium containing the selection antibiotic PPT (3 mg / L) and cephalosporin 200 mg / L to continue inducing shoot differentiation, incubated at 22°C for 16 h light / 8 h dark for 3 weeks. Cultured in the dark for 3 weeks, subcultured every 3 weeks until regenerated seedlings are produced; transfer the regenerated seedlings to 1 / 2 MS solid medium for rooting, subcultured every 3-4 weeks, cultured at 22℃, 16 h light / 8 h dark, and transplanted into soil after rooting.
[0043] Example 3: DNA Identification of Overexpression cysK Transgenic alfalfa lines Identification of alfalfa regenerated seedlings. Genomic DNA was extracted from a small leaf of the regenerated seedling and then detected by PCR. The plasmid pB7WG2D- was used. cysKThe vector served as a positive control, and the primers were 35S-F and cysK -R was used for PCR amplification. This confirmed the acquisition of E. coli overexpressing the bacteria. cysK Transgenic plants containing the gene. The enzyme used in PCR was DNA Polymerase (catalog number: AP111) from Beijing TransGen Biotechnology Co., Ltd. 01), For specific usage instructions, please refer to the instruction manual.
[0044] The primer sequences are: 35S-F: GCACAATCCCACTATCCTTC (SEQ ID NO.3); cysK -R:TCATTGTTGGAGTTCTTTCTC (SEQ ID NO. 4).
[0045] Example 4: RT-PCR detection of overexpression cysK Gene expression levels in transgenic alfalfa lines RNA and cDNA were extracted from the above wild-type and transgenic plants and subjected to reverse DNA extraction using primers 35S-F and... cysK -R is used for RT-PCR detection.
[0046] The internal references used are MsActin-F and MsActin-R.
[0047] Primer sequences: MsActin-F: ACTCACACCGTCACCAGAATCC (SEQ ID NO.5); MsActin-R:TCAATGTGCCTGCCATGTATGT (SEQ ID NO. 6).
[0048] See results Figure 4 .Depend on Figure 4 It can be seen that the OE-5 strain has a higher expression level, and the corresponding strain was selected for subsequent experiments.
[0049] Example 5: Overexpression cysK Analysis of soluble protein content in transgenic alfalfa lines E. coli obtained through genetic engineering cysK Genes were transformed into alfalfa using Agrobacterium LBA9402, and finally, E. coli overexpressing in an alfalfa background were screened. cysK Transgenic alfalfa lines were developed. The soluble protein content of the transgenic plants was determined using the Beyotime BCA protein concentration assay kit (enhanced version). The average values of three biological replicates were analyzed using a t-test. Results are shown below. Figure 5The results showed that the soluble protein content of the transgenic line (OE-5) was significantly higher than that of the wild type (WT) (p<0.05), with an average increase of approximately 28%. This indicates that... cysK Genes play a significant role in improving the protein content of leguminous forage.
[0050] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. Overexpression cysK Application of genes in increasing the soluble protein content of leguminous forage grasses; The cysK The gene sequence is shown in SEQ ID NO.
2.
2. The application as described in claim 1, characterized in that, The legume forage grasses include any one or more of alfalfa and clover.
3. The application as described in claim 1, characterized in that, The application aims to increase the soluble protein content in the leaves of leguminous forage grasses.
4. As described in claim 1 cysK The application of gene-related biomaterials is characterized by, The application is any one of the following: A1) Application in increasing the soluble protein content of leguminous forage; A2) Application in leguminous forage breeding.
5. The application as described in claim 4, characterized in that, The biomaterial is any one of B1) to B3) below: B1) An expression cassette containing a nucleic acid molecule with a nucleotide sequence as shown in SEQ ID NO.2; B2) Recombinant vectors containing nucleic acid molecules with nucleotide sequences as shown in SEQ ID NO.2; B3) A recombinant microorganism containing a nucleic acid molecule with a nucleotide sequence as shown in SEQ ID NO.2, or a recombinant microorganism containing the expression cassette described in B1), or a recombinant microorganism containing the recombinant vector described in B2), wherein the microorganism is Agrobacterium.
6. A method for increasing the soluble protein content of leguminous forage, characterized in that, The method involves overexpression in leguminous forage grasses. cysK Genes that are overexpressed cysK Transgenic leguminous forage lines containing the gene; cysK The gene sequence is shown in SEQ ID NO.
2.
7. The method as described in claim 6, characterized in that, include: A plant overexpression vector containing the nucleotide sequence shown in SEQ ID NO.2 was constructed, and the plant overexpression vector was introduced into leguminous forage plant cells to obtain overexpression. cysK Genetically modified legume forage lines.
8. The method as described in claim 7, characterized in that, The plant overexpression vector was pB7WG2D- cysK .
9. The method as described in claim 6, characterized in that, The legume forage grasses include any one or more of alfalfa and clover.
10. A legume forage grass, characterized in that, It contains the exogenous inserted gene shown in SEQ ID NO.2.