Use of rice oslhca3 gene and application in breeding virus-resistant rice

By overexpressing the OsLHCA3 gene in rice, the RSV motor protein NSvc4 was recruited to the chloroplast using the OsLHCA3 protein, interfering with its interaction with the host protein OsREM1.4. This solved the resistance problem of rice stripe virus disease and achieved efficient enhancement of RSV resistance and safe application of the disease-resistant gene.

CN122146765APending Publication Date: 2026-06-05NINGBO UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-25
Publication Date
2026-06-05

AI Technical Summary

Technical Problem

There is a lack of effective genetic resources for resistance to rice stripe virus in existing technologies, and traditional disease-resistant breeding has not conducted in-depth research on the resistance mechanism of rice stripe virus (RSV), making it difficult to inhibit virus movement by interfering with the interaction between viral motility proteins and host proteins.

Method used

By overexpressing the OsLHCA3 gene in rice, the OsLHCA3 protein recruits the RSV motor protein NSvc4 to chloroplasts, interfering with its interaction with the host protein OsREM1.4 and inhibiting the intercellular movement function of NSvc4.

Benefits of technology

It significantly enhanced rice's resistance to RSV, reduced disease symptoms, ensured rice growth, and did not produce adverse agronomic traits, providing a safe and effective disease-resistant gene resource.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122146765A_ABST
    Figure CN122146765A_ABST
Patent Text Reader

Abstract

This invention provides rice OsLHCA3 The uses of genes and their application in breeding virus-resistant rice, the above OsLHCA3 The nucleotide sequence of the gene is shown in SEQ ID NO.1. This invention utilizes transgenic technology to achieve overexpression in rice. OsLHCA3 This gene can significantly enhance rice's resistance to RSV. The mechanism lies in... OsLHCA3 The protein recruits the RSV motility protein NSvc4 to chloroplasts, interfering with the interaction between NSvc4 and the host protein OsREM1.4, thereby inhibiting the intercellular motility function of NSvc4. This invention provides a new gene resource for RSV-resistant rice breeding and has important application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of plant genetic engineering and plant disease control technology, specifically relating to rice. OsLHCA3 The uses of genes and their application in breeding virus-resistant rice. Background Technology

[0002] Rice is one of the world's most important food crops, with more than half of the global population relying on it as a staple food. Rice stripe virus (RSV) causing rice stripe leaf blight is a major disease in rice production, seriously threatening food security. Long-distance movement and intercellular movement of the virus within the plant are key steps in its successful infection and spread. The RSV motility protein NSvc4 plays a crucial role in the virus infection process. This protein can be located in the chloroplasts and plasmodesmata of rice cells, interacting with related proteins within the host cells to overcome the intercellular barrier and complete the spread and infection of the virus within the host. It is a core factor in the RSV pathogenic mechanism.

[0003] Currently, breeding disease-resistant varieties is the most economical and effective means of controlling rice stripe virus (RSV). Traditional disease-resistant breeding mainly relies on the discovery and utilization of disease-resistant genes, but resources of resistance genes against RSV are relatively scarce, and research on resistance mechanisms is not in-depth. With the development of molecular biology and genetic engineering technologies, improving rice resistance to RSV through genetic engineering has become an important research direction. However, there are very few reports on strategies for enhancing antiviral capabilities by using host genes to regulate the function of viral motility proteins, especially the mechanism of inhibiting viral motility by interfering with the interaction between viral motility proteins and host proteins.

[0004] The light-harvesting complex (LHC) is a crucial component of the plant photosynthetic system, primarily responsible for capturing light energy and transferring it to reaction centers. LHC family proteins are encoded by nuclear genes and function within chloroplasts. Recent studies have revealed that some LHC family proteins, in addition to their role in photosynthesis, also play important roles in plant responses to biotic stress. However, the function of LHC family proteins in plant antiviral immunity, particularly their mechanism of regulating viral infection through direct interaction with viral proteins, remains largely unexplored. Therefore, identifying and utilizing LHC family genes with antiviral functions is of significant theoretical and practical importance for breeding new RSV-resistant rice varieties. Summary of the Invention

[0005] This invention provides rice OsLHCA3 The uses of genes and their application in breeding virus-resistant rice, the above OsLHCA3The nucleotide sequence of the gene is shown in SEQ ID NO.1. This invention utilizes transgenic technology to achieve overexpression in rice. OsLHCA3 This gene can significantly enhance rice's resistance to RSV. The mechanism lies in... OsLHCA3 The protein recruits the RSV motor protein NSvc4 to the chloroplast, interfering with the interaction between NSvc4 and the host protein OsREM1.4, thereby inhibiting the intercellular movement function of NSvc4.

[0006] On one hand, the present invention provides the use of a gene in breeding rice resistant to rice stripe virus, said gene comprising OsLHCA3 Genes, the ones mentioned OsLHCA3 The gene sequence is shown in SEQ ID NO.1.

[0007] On the other hand, the present invention provides a recombinant expression vector comprising a nucleotide sequence as shown in SEQ ID NO. 1, and the nucleotide sequence being operatively linked to a 35S promoter.

[0008] In some methods, the recombinant expression vector can be constructed by using a LIC (Ligation-Independent Cloning) strategy, which involves transmitting dATP-treated... OsLHCA3 The target gene fragment was directionally ligated into the linearized pCV-cMyc binary vector treated with dTTP. The ligation product was annealed and transformed into *E. coli*. After sequencing verification, the recombinant expression vector pCV-cMyc-, containing the sequence shown in SEQ ID NO.1 and driven by the 35S promoter, was obtained. OsLHCA3 .

[0009] Furthermore, this invention provides a product containing pCV-cMyc- OsLHCA3 The engineered bacteria is Agrobacterium tumefaciens EHA105.

[0010] In some methods, the engineered bacteria convert the recombinant expression vector pCV-cMyc- using electroporation. OsLHCA3 The bacteria were obtained by introducing Agrobacterium EHA105 competent cells and were identified as positive by PCR.

[0011] In another aspect, the present invention provides a transgenic rice cell, wherein the genome of the transgenic rice cell integrates the nucleotide sequence shown in SEQ ID NO.1, and the nucleotide sequence is overexpressed.

[0012] In some methods, the transgenic rice cells are injected with the recombinant expression vector pCV-cMyc- via Agrobacterium-mediated transformation. OsLHCA3 It was obtained by transforming rice callus tissue and screening with hygromycin.

[0013] Furthermore, the present invention provides a transgenic rice plant obtained by the regeneration of the aforementioned transgenic rice cells, and the plant contains... OsLHCA3 Gene overexpression.

[0014] Furthermore, the present invention provides a method for cultivating rice resistant to rice stripe virus, comprising the following steps: (1) Cloning rice as shown in SEQ ID NO.1 OsLHCA3 Gene; (2) Construct a recombinant expression vector containing the gene; (3) Transform the recombinant expression vector into Agrobacterium; (4) Transform rice callus tissue with the aforementioned Agrobacterium; (5) Screening and obtaining transgenic rice plants.

[0015] In some methods, the gene clone described in step (1) can be obtained by amplifying rice cDNA using RT-PCR, with primers as shown in SEQ ID NO.2~3.

[0016] In some methods, the construction of the recombinant expression vector in step (2) employs a LIC strategy to ligate the target gene into the pCV-cMyc vector, obtaining a recombinant vector pCV-cMyc- driven by the 35S promoter. OsLHCA3 .

[0017] In some methods, the Agrobacterium transforming in step (3) is introduced into Agrobacterium tumefaciens EHA105 using electroporation transformation.

[0018] In some methods, the transformation of callus in step (4) is performed using Agrobacterium-mediated genetic transformation.

[0019] In some methods, the screening in step (5) uses hygromycin resistance screening combined with PCR detection for positive identification.

[0020] Furthermore, this invention provides a method for improving rice's resistance to rice stripe virus by enhancing the rice's... OsLHCA3 The gene expression level recruits the rice stripe virus motility protein NSvc4 to chloroplasts, interferes with the interaction between NSvc4 and OsREM1.4, restores the palmitoylation level of OsREM1.4, and restores callosin deposition at plasmodesmata, thereby inhibiting the intercellular motility function of NSvc4.

[0021] Furthermore, the present invention provides OsLHCA3 Application of the encoded protein in inhibiting the function of rice stripe virus motility protein NSvc4.

[0022] Furthermore, the present invention provides OsLHCA3 Application of proteins in the preparation of transgenic plants resistant to rice stripe virus.

[0023] Furthermore, the present invention provides OsLHCA3 The application of the protein as an antagonist of the rice stripe virus motility protein NSvc4, which inhibits the intercellular motility function of NSvc4 by recruiting NSvc4 to chloroplasts.

[0024] The beneficial effects of this invention include: 1. This invention utilizes overexpression in rice OsLHCA3 The gene was used to obtain transgenic rice with high resistance to rice stripe virus (RSV). After RSV inoculation, the incidence rate, viral coat protein and viral RNA accumulation were significantly lower than those of the wild-type control group, effectively reducing disease symptoms and ensuring rice growth.

[0025] 2. This invention discovers and verifies OsLHCA3 The new function of proteins OsLHCA3 By recruiting the viral motility protein NSvc4 to chloroplasts and interfering with its interaction with the host protein OsREM1.4, the palmitoylation level of OsREM1.4 and callose deposition at plasmodesmata are restored, ultimately inhibiting the intercellular motility function of NSvc4. This mechanism has opened new avenues for research on crop antiviral activity.

[0026] 3. Discovery of this invention OsLHCA3 The fact that the gene enhances disease resistance in rice without producing adverse agronomic traits indicates that... OsLHCA3 Genes are a safe and effective disease-resistant gene resource, and have extremely high application value in breeding new RSV-resistant rice varieties. Attached Figure Description

[0027] Figure 1 Example 1: Construction and mass spectrometry analysis of NSvc4 non-positional chloroplast mutant; Figure 2 Subcellular localization of candidate protein Niben101Scf01328g01012.1 and BiFC analysis with NSvc4 for Example 1; Figure 3 Subcellular localization of candidate protein Niben101Scf12868g00008.1 and BiFC analysis with NSvc4 for Example 1; Figure 4 Subcellular localization of candidate protein Niben101Scf00117g02019.1 and BiFC analysis with NSvc4 for Example 1; Figure 5Subcellular localization of candidate protein Niben101Scf05688g08010.1 and BiFC analysis with NSvc4 for Example 1; Figure 6 Subcellular localization of candidate protein Niben101Scf05349g01011.1 and BiFC analysis with NSvc4 for Example 1; Figure 7 Subcellular localization of candidate protein Niben101Scf02842g00014.1 and BiFC analysis with NSvc4 for Example 1; Figure 8 Subcellular localization of candidate protein Niben101Scf01548g00002.1 and BiFC analysis with NSvc4 for Example 1; Figure 9 Subcellular localization of candidate protein Niben101Scf01209g04002.1 and BiFC analysis with NSvc4 for Example 1; Figure 10 Subcellular localization of candidate protein Niben101Scf03138g01010.1 and BiFC analysis with NSvc4 for Example 1; Figure 11 Subcellular localization of candidate protein Niben101Scf01934g04020.1 and BiFC analysis with NSvc4 for Example 1; Figure 12 Subcellular localization of candidate protein Niben101Scf03572g02005.1 and BiFC analysis with NSvc4 for Example 1; Figure 13 Subcellular localization of candidate protein Niben101Scf00197g02006.1 and BiFC analysis with NSvc4 for Example 1; Figure 14 Subcellular localization of candidate protein Niben101Scf00480g00002.1 and BiFC analysis with NSvc4 for Example 1; Figure 15 Subcellular localization of candidate protein Niben101Scf18639g00026.1 and BiFC analysis with NSvc4 for Example 1; Figure 16 Phylogenetic tree analysis for Example 1; Figure 17 Example 1 AtLHCA3 , NbLHCA3 as well as OsLHCA3 Nucleotide sequence alignment; Figure 18 Example 1 AtLHCA3 , NbLHCA3 as well as OsLHCA3 Amino acid sequence alignment; Figure 19 Example 1: RSV on rice phenotype and OsLHCA3 The impact of expression; Figure 20 Example 3 contains OsLHCA3 Gene expression vector pCV-cMyc- OsLHCA3 Structural diagram; Figure 21 The pCV-cMyc empty vector spectrum is shown in Example 3. Figure 22 Example 5 OsLHCA3 Molecular biological detection and developmental phenotype of genetically modified rice; Figure 23 For Example 6 OsLHCA3 Analysis of RSV resistance in genetically modified rice; Figure 24 Example 7 OsLHCA3 Impact on NSvc4-Remorin interaction; Figure 25 Example 7 OsLHCA3 Effect on OsREM1.4 palmitoylation level; Figure 26 Example 7 OsLHCA3 Interfering with NSvc4 inhibits the process of callosity accumulation; Figure 27 Example 7 OsLHCA3 It interferes with the intercellular movement function of NSvc4. Detailed Implementation

[0028] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be noted that the embodiments described below are intended to facilitate the understanding of the present invention and do not limit it in any way. They are only used to help explain the content of the present invention in a convenient and clear manner.

[0029] Example 1: Rice OsLHCA3 Gene screening and identification Rice stripe virus (RSV) is the main pathogen causing rice stripe leaf blight. Its motility protein NSvc4 is located in chloroplasts, which is crucial for the intercellular movement of the virus. In this embodiment, liquid chromatography-tandem mass spectrometry (LC-MS / MS) was used to identify the Nicotiana benthamiana protein that interacts with NSvc4, in order to elucidate the possible mechanism of NSvc4-chloroplast interaction.

[0030] First, construct as Figure 1 The NSvc4 non-positioning chloroplast truncation mutant shown in Figure A is NSvc4. m (Amino acids 1-73 missing) were used as a control for subsequent analysis. Figure 1 As shown in B, confocal observation revealed that NSvc4 m -GFP mutants could not localize to chloroplasts. Subsequently, using the transient expression system of Nicotiana benthamiana, NSvc4 and NSvc4 were expressed... m GFP was expressed in *Tobacco Benedict* leaves. After 48 hours, three samples were enriched using GFP magnetic beads. The total enriched protein was extracted and identified by SDS-PAGE. After Coomassie Brilliant Blue staining, the target gel pieces were removed for LC-MS / MS protein identification and analysis. Figure 1 As shown in C, through analysis, in GFP, NSvc4, and NSvc4 m 139, 431, and 246 proteins were identified in the expression context, respectively.

[0031] To identify chloroplast-related proteins that interact with NSvc4, using GFP as a control, this invention investigates NSvc4-GFP and NSvc4... m Differential protein analysis was performed on the two GFP samples, identifying a total of 14 differentially expressed proteins, as shown in Table 1. These proteins were present only in the NSvc4-GFP immunoprecipitation but not in the NSvc4 samples. m -GFP antibody immunoprecipitation.

[0032] Table 1 NSvc4-GFP, NSvc4 m -GFP differential chloroplast protein In Table 1, Accession refers to the Accession number of the protein in the database; Coverage refers to the coverage of identified peptide sequences; # Peptides refers to the number of different peptides identified, with a higher number reflecting higher protein abundance; #PSMs refers to the number of peptides matched to secondary spectra; # Unique Peptides refers to the number of characteristic peptides of the protein; #AAs refers to the number of amino acids in the protein; MW [kDa] refers to the molecular weight of the protein; calc pI refers to the theoretical isoelectric point of the protein; emPAI refers to the emPAI quantitative value, which is an approximation of the relative quantification of the protein; Score Sequest HT refers to the protein matching score, with a higher score indicating higher reliability.

[0033] To screen candidate proteins that specifically interact with NSvc4, this study performed subcellular localization and bimolecular fluorescence complementation (BiFC) analysis on 14 tobacco chloroplast-related proteins identified in Table 1. The results are as follows: Figures 2-15As shown, among the 14 candidate proteins examined, each protein exhibited different localization patterns in *Tobacco Benedict* mesophyll cells, and their interaction strengths with NSvc4 varied significantly. The protein encoded by gene ID Niben101Scf01328g01012.1 (later named NbLHCA3) was clearly located in the chloroplast, and the BiFC fluorescence signal produced when co-expressed with NSvc4 was the strongest, indicating that its interaction with NSvc4 was the most specific and stable. Based on these screening results, this protein was selected for further in-depth investigation.

[0034] According to the annotations, the protein is a chlorophyll a / b binding protein of the LHC (Light-harvesting Complex) family encoded by a nuclear gene. Previously, our laboratory performed a phylogenetic analysis of the LHC family genes in *Nicotiana benthamiana* and *Arabidopsis thaliana* based on their amino acid sequences. Based on this, we found that *Niben101Scf01328g01012.1* is most closely related to *AtLHCA3*. Figure 16 As shown. Therefore, this protein is named NbLHCA3 Subsequently, the homologous protein LOC_Os05g10390.1 in rice was found in the rice genome database (http: / / rice.uga.edu / index.shtml) and named it... OsLHCA3 (Oryza sativa Light-HarvestingChlorophyll a / b binding protein 3), whose nucleotide sequence is shown in SEQ ID NO.1.

[0035] Subsequently, as Figure 17 As shown, OsLHCA3 , NbLHCA3 and AtLHCA3 Nucleotide sequences were compared, revealing a sequence homology of 64%–88%, indicating high homology. Meanwhile, as... Figure 18 As shown, AtLHCA3 , NbLHCA3 and OsLHCA3 The amino acid sequences were compared, and the sequence homology was 72%–88%.

[0036] For preliminary verification OsLHCA3 The correlation between RSV infection and the presence of RSV in rice leaves was investigated using quantitative real-time PCR. OsLHCA3 Changes in transcriptional levels. For example... Figure 19 As shown in A and 19B, after infection with RSV, the growth and development of rice are severely affected, exhibiting stunted growth and delayed development, with discontinuous yellow-white spots forming on the leaves. Figure 19As shown in C, RSV infection in rice induces upregulation of its expression, up by approximately 2.5 to 3 times.

[0037] Example 2 OsLHCA3 Cloning of genes Total RNA extraction from rice The plant samples selected for this invention were from Nipponbare rice. RNA was extracted from the plant samples using Trizol (Invitrogen TRIzol Reagent, 15596026). The specific experimental procedures are as follows: (1) Take an appropriate amount of rice leaves into a 2mL centrifuge tube containing RNase Free (AXYGEN, MCT-200-C) with 5 mm steel balls added in advance, and quickly put it into a foam box containing liquid nitrogen to freeze (at the same time, cool the 25-well vibrating plate with liquid nitrogen). Then place it in a vibrator and shake it at 30~35 Hz for 90 s. If the sample volume is large, a second vibration can be performed to ensure that the sample is completely broken up.

[0038] (2) Add 1 mL of Trizol to the sample tube, shake vigorously to mix thoroughly, and let stand on ice for 5 min. Add 200 μL of chloroform, shake thoroughly to mix thoroughly, and let stand on ice for 2-3 min. Then centrifuge at 13000 rpm for 15 min at 4°C.

[0039] (3) After centrifugation, the sample is divided into three layers. Take the top colorless aqueous phase and put it into a new RNase Free 2 mL centrifuge tube. Add an equal volume of isopropanol and gently invert the tube 5-6 times until the solution is clear. Let it precipitate at room temperature for 10 min, and then centrifuge at 4℃ and 13000rpm for 20 min.

[0040] (4) Discard the supernatant. A white flaky precipitate will be visible at the bottom of the tube. Add 800 μL of 75% ethanol prepared with RNase-free water. Gently blow and wash the precipitate with a pipette tip. Then centrifuge at 13,000 rpm for 2 min at 4°C and discard the supernatant. Repeat the washing once. Centrifuge at 13,000 rpm for 2 min at 4°C. Aspirate the remaining liquid with a pipette tip and air dry in an air dryer for 30-60 s.

[0041] (5) Add an appropriate amount of RNase-free water to the centrifuge tube and dissolve on ice. Use a NanoDrop micro-biodetector to determine the RNA concentration and purity for subsequent reverse transcription. The A260 / A280 ratio is an important indicator of RNA purity, and the A260 / A280 ratio of pure RNA is approximately 2.0.

[0042] 2. cDNA first-strand synthesis Reverse transcription was performed according to the instructions of the TransScript® All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (One-Step gDNA Removal) kit. The reaction system is shown in Table 2.

[0043] Table 2 cDNA First-Strand Synthesis Reaction System The above reaction mixture was mixed by pipetting in a 200 μL RNase-Free centrifuge tube, briefly centrifuged, and then incubated in a PCR instrument at 42°C for 5 min, followed by heating at 85°C for 5 s to complete the synthesis of first-strand cDNA and the removal of gDNA. The reverse transcription product was used for subsequent gene cloning or stored at -20°C for long-term use.

[0044] 3. OsLHCA3 Full-length gene amplification According to SEQ ID NO.1 OsLHCA3 Gene sequence, specific primers designed as follows: OsLHCA3 -ORF-F: 5'-CGACGACAAGACCGTCACCATGGCGGCTCAGGCTCTTCTCTCTGGGA-(SEQ ID NO.2) OsLHCA3 -ORF-R: 5'-GAGGAGAAGAGCCGTCGATGGAACTTGAGGCTGGTGAGGATGTTGT -3' (SEQ ID NO.3) Using the Nipponbare rice cDNA obtained through reverse transcription as a template, KOD FX Neo PCR enzyme was used for... OsLHCA3 The full-length fragment amplification and PCR system are shown in Table 3.

[0045] Table 3 OsLHCA3 Gene PCR amplification reaction system Perform the PCR reaction according to the procedure shown in Table 4.

[0046] Table 4 OsLHCA3 Gene PCR amplification program Example 3: Construction of plant expression vectors This invention uses the pCV-cMyc binary expression vector (e.g.) Figure 20(As shown) for plant genetic transformation. This vector contains typical T-DNA components: LB, 35S PolyA, HPTII (hygromycin resistance gene), 35S promoter, Nos terminator, multiple cloning site, and RB, etc., and is suitable for Agrobacterium-mediated stable transformation of rice.

[0047] In order to target gene OsLHCA3 For efficient vector insertion, this study employs a ligation-independent cloning (LIC) strategy. This method utilizes the 3'→5' exonuclease activity of T4 DNA polymerase to generate complementary sticky ends in the presence of specific nucleotides, achieving directional ligation of the target fragment to the vector. It eliminates the need for ligases, is simple to perform, and has low background.

[0048] 1. Treatment with the target fragment dATP The purified target fragment was treated with dATP according to the reaction system shown in Table 5.

[0049] Table 5 dATP treatment system After mixing, centrifuge briefly and react on a PCR instrument: 37 ℃ for 20 min, 75 ℃ for 20 min, then cool to 4 ℃ for later use.

[0050] 2. Carrier linearization The structure of the carrier pCV-cMyc used in this study is as follows: Figure 21 As shown, its multiple cloning sites include Pst I, Apa I, and other restriction enzyme sites. LIC vector digestion was performed according to the reaction system shown in Table 6.

[0051] Table 6 LIC vector enzymatic digestion reaction system Mix the above liquid thoroughly with a pipette, centrifuge briefly, and then incubate in a metal bath at 37°C for 30 minutes.

[0052] 3. Carrier dTTP treatment The carrier dTTP processing system is shown in Table 7.

[0053] Table 7. Carrier dATP treatment system After mixing the above liquids, centrifuge briefly and then perform the reaction on a PCR instrument: 37 ℃ for 20 min, 75 ℃ for 20 min, then cool to 4 ℃ for later use, and store at -40 ℃ for long-term storage.

[0054] 4. Ligation of the target fragment to the vector Add 5 μL each of the dATP-treated fragment and the dTTP-treated vector to a 200 μL sterile centrifuge tube, mix by pipetting, centrifuge briefly, incubate at 70℃ for 5 min on a PCR instrument, cool to 22℃ at a rate of 0.2℃ / s, and incubate for 30 min. Storage at 4℃ or overnight ligation can improve ligation efficiency.

[0055] Example 4: Agrobacterium transformation and positive clone identification 1. Electrocution The positive plasmid was transformed into Agrobacterium using an electroporation method. The specific steps are as follows: (1) Remove Agrobacterium EHA105 competent cells from -80℃ and place them on ice until they thaw; (2) Add 2 μL of recombinant plasmid to competent cells and gently pipette to mix; (3) Quickly transfer the mixture to the ethanol-treated and dried electric shock cup, set the voltage of the electric shock device to 2.2kV, place the electric shock cup into the correct electric shock tank, and start the electric shock; (4) After the electric shock is completed, quickly insert it into ice, add 1 mL of antibiotic-free LB liquid culture medium, transfer it to competent empty tubes, and incubate at 28 ℃ and 200 rpm for 3 h. (5) Centrifuge at 5000 rpm for 1 min, collect the bacterial cells, discard the supernatant, retain 100 μL to resuspend the bacterial cells, spread them on solid LB plates containing 50 μg / mL kanamycin (Kan) + rifampin (Rif), and incubate at 28 ℃ for 48 h.

[0056] 2. Identification of positive clones Transformed Agrobacterium colonies were picked and inoculated into LB liquid medium containing 50 μg / mL Kan and 50 μg / mL Rif, and incubated overnight at 28 ℃ and 200 rpm. 1 μL of the bacterial culture was then used for PCR detection. The detection primers were OJG141 and BNY-1, and the primer sequences are as follows: OJG141: 5'-GAAACTGATGCATTGAACTTGACG-3' (SEQ ID NO. 4); BNY-1: 5'-ATTTGGAGAGAACACGGGG-3' (SEQ ID NO. 5).

[0057] The PCR detection system is shown in Table 8.

[0058] Table 8 PCR Detection System After mixing, perform PCR cycling according to the conditions shown in Table 9.

[0059] Table 9 PCR Cycling Conditions Take the bacterial solution that tested positive, mix it with 30% glycerol, and store it at -80℃.

[0060] Example 5: Genetic Transformation of Rice 1. Preparation of bacterial culture Take the positively transformed strain stored at -80℃ and streak it onto LB agar plates containing 50 μg / mL Kan and 50 μg / mL Rif. Incubate at 28℃ until single colonies form. Pick a single colony and place it in LB liquid medium containing 50 μg / mL Kan and 50 μg / mL Rif. Incubate overnight at 28℃ with shaking at 220 rpm. Dilute the bacterial culture 1:100 with fresh LB medium and continue incubation with shaking until OD (outlet capacity) is reached. 600 It is around 1.0.

[0061] 2. Cultivation of transgenic plants (1) Disinfection ① Take young spikelets of Japanese hyacinth flowers that are about two weeks old (during the grain-filling stage), manually thresh and remove the husks, select plump, clean seeds without sterile spots, rinse the seeds with sterile water, and remove any floating shriveled seeds; ② Place the seeds in a sterile glass tube and rinse them 2-3 times with sterile water; ③ Add 70% alcohol for 1 minute to disinfect, then pour off the alcohol and rinse 2-3 times with sterile water; ④ Add 30% sodium hypochlorite (NaClO, available chlorine 5.2%, containing a few drops of Tween-20) solution and let it stand for 30 min; pour off the sodium hypochlorite solution, rinse 2-3 times with sterile water, and finally soak the seeds in sterile water and let them stand for 30-45 min.

[0062] (2) Induction culture Spread the seeds evenly on sterile filter paper, absorb excess moisture, and place 5-10 seeds per dish in mature embryo induction medium; seal the culture dish with sealing film and incubate in a 28℃ light incubator for about 20 days.

[0063] (3) Subgeneration Once the seeds have grown pale yellow, dense, spherical embryogenic callus, open the culture dish in a clean bench, use tweezers to pick out the naturally divided, intact embryogenic callus tissue, place it in a subculture medium, and subculture it for 1 week in a 28°C light incubator.

[0064] (4) Co-cultivation ① Pick a single Agrobacterium clone and shake it until the bacterial culture reaches OD500. 600 The concentration was approximately 1.0; bacterial cells were collected and resuspended in AAM inoculum (containing 200 μM acetylsuccinone (As)), and the OD concentration of the inoculum was adjusted. 600 Approximately 0.1; ② Select callus tissue of appropriate size and place it in the prepared Agrobacterium suspension above and soak it for 5 minutes; take out the callus tissue and dry it on sterile filter paper for 0.5-1 h; spread the callus tissue evenly on the co-culture medium and incubate in the dark at 25 ℃ for 2-2.5 days.

[0065] (5) Screening and cultivation ① Remove the callus tissue and wash it with sterile water, shaking it continuously during the process; wash and soak it in sterile water containing 500 mg / L cephalexin for 30 minutes, repeat the washing 3 times, and then spread the callus tissue flat on sterile filter paper to air dry for 2 hours. ② The dried callus tissue was transferred to selective medium (containing 500 mg / L cefadroxil and 50 mg / L hygromycin) for the first round of screening and cultured in a 28 ℃ light incubator for 14 days; ③ Select the initial callus tissue that has grown into resistant callus and place it in a new selective medium (containing 500 mg / L cefadroxil and 50 mg / L hygromycin) for a second round of selection. Culture in a 28 ℃ light incubator for about 10 days until granular resistant callus tissue grows.

[0066] (6) Differentiation culture Select bright yellow resistant callus tissues and transfer them to wide-mouthed plastic bottles containing differentiation culture medium (4-5 callus tissues per bottle). Place the bottles in a constant temperature incubator to differentiate into 15-30 days.

[0067] (7) Rooting and transplanting Once the callus-differentiated seedlings have grown to about 2-3 cm, remove the seedlings, remove the root callus, and transfer them to a rooting medium for 1-2 weeks. Add an appropriate amount of sterile water to the healthy seedlings and harden them off for 3-7 days. Wash off the root medium and transplant the seedlings into the soil, ensuring the water level does not submerge them. Cultivate them in a normal greenhouse environment.

[0068] 3. Molecular biological detection of transgenic plants After positive identification of the obtained T0 generation transgenic plants, T1 generation seeds were harvested and propagated. Several independent transformant lines were preliminarily screened from the T1 generation plants using hygromycin resistance screening combined with PCR detection. Further analysis was performed using Western blot to detect total protein in the leaves of each positive T2 generation line. OsLHCA3 Protein expression levels.

[0069] like Figure 22 As shown in A, among the multiple independent T2 generation lines tested, OsLHCA3 There were some differences in protein expression levels between strains 12# and 16#. OsLHCA3The highest protein accumulation indicates that the expression of the exogenous gene was most stable and efficient in these two lines. Therefore, these two lines were selected for subsequent resistance identification experiments.

[0070] Subsequently, the growth and development phenotypes of T2 generation lines 12# and 16# were observed. Figure 22 As shown in B and C, the seed germination and seedling growth of these two transgenic lines showed no significant difference compared to wild-type Nipponbare rice, indicating that... OsLHCA3 The upregulation of expression did not have a significant impact on the growth and development of rice plants.

[0071] Example 6: Identification of RSV resistance in transgenic rice 1. Purification and identification of high-virus-carrying planthoppers The planthopper colony was reared with RSV-infected rice plants for 5-7 days to ensure sufficient viral acquisition. Fifth-instar females were individually captured and reared in test tubes (each tube containing 2-3 rice seedlings for feeding). After 2-3 weeks of individual rearing (until the second-generation larvae reached the 2nd-3rd instar), females were captured for virus carriage testing. Positive strains were transferred to large beakers for further propagation. The offspring were sampled and tested; once the virus carriage rate stabilized, the infected planthoppers were grouped and reared.

[0072] 2. Transfer OsLHCA3 Genetically modified rice inoculated with RSV Select to transfer OsLHCA3 Genetically modified rice T2 generation lines 12# and 16# were used as test materials, with wild-type rice (Nipponbare) as a control, and were sown simultaneously. Seeds were soaked and germinated in sterile water at 37℃, with 20-40 healthy seeds selected from each line. After approximately 2 days, when the seeds showed signs of sprouting, they were sown, with each line planted in a separate nutrient pot (10 cm × 10 cm) and cultured in a greenhouse environment.

[0073] Once the rice plants reach the 3-leaf stage, they are transferred to inoculation cages. Using an effective inoculation rate of 2-3 larvae per plant, the purified, high-virus-carrying 2nd-3rd instar larvae of the planthopper are transferred into the cages. Wild-type and transgenic plants are simultaneously fed the virus for 3 days. During inoculation, ensure that the inoculated rice seedlings are evenly infected, and drive them away every 24 hours. After the inoculation is complete, remove all planthoppers. After the rice seedlings have recovered in a greenhouse environment for 2-3 days, they are transplanted to the field for disease investigation and analysis.

[0074] 3. Turn OsLHCA3 RSV inoculation identification of genetically modified rice like Figure 23 As shown in Figure A, 15 days after inoculation, symptom observation revealed that the overexpressing strain exhibited significantly milder viral symptoms than the wild-type Nipponbare. Figure 23As shown in Figure C, the incidence rate statistics show that the incidence rates of the two independent strains tested, 12# and 16#, were significantly lower than those of the control plants. Figure 23 As shown in Figure B, 45 days after inoculation, the transgenic rice plants showed significantly better growth than the control plants. Western blot analysis confirmed this. OsLHCA3 The accumulation levels of RSV coat protein (CP protein) in genetically modified rice and wild-type susceptible plants were as follows: Figure 23 As shown in D, the RSV CP accumulation in the leaves of the two transgenic independent lines, 12# and 16#, was lower than that in the control plants; further analysis by qRT-PCR showed that... Figure 23 As shown in E, the accumulation of RSV RNAs in the leaves of the two transgenic independent lines 12# and 16# infected plants was lower than that in the control plants.

[0075] The above results indicate that OsLHCA3 Overexpression effectively inhibits RSV accumulation, and the conversion... OsLHCA3 Genetically modified rice plants exhibited RSV resistance.

[0076] Example 7 OsLHCA3 Disease resistance mechanisms of genes 1. OsLHCA3 Interfering with the interaction between NSvc4 and OsREM1.4 Analysis using luciferase complementation assay OsLHCA3 The effect of NSvc4-Remorin interaction. Remorins are a class of plant proteins located at cell membrane lipid valves and plasmodesmata. NSvc4 can interfere with the host's disease resistance mechanisms by interacting with rice Remorin proteins (such as OsREM1.4), thereby promoting viral movement between cells. OsREM1.4 is a member of the rice Remorin family. Figure 24 As shown, when OsLHCA3 During expression, the fluorescence intensity of the interaction between NSvc4 and OsREM1.4 was significantly reduced, indicating that... OsLHCA3 It interfered with the interaction between NSvc4 and OsREM1.4 in plants.

[0077] 2. OsLHCA3 Restore palmitoylation modification of Remorin The palmitoylation level of Remorin was assessed using a biotinylation assay. Palmitoylation is a post-translational modification that mediates protein localization to specific regions of the cell membrane (such as lipid valves and plasmodesmata), and is crucial for the disease-fighting function of Remorin. Figure 25 As shown, expression of NSvc4 significantly reduced palmitoylation levels of OsREM1.4, indicating that viral motility proteins interfered with the proper localization of Remorin. However, when OsLHCA3When co-expressed with NSvc4, the palmitoylation level of OsREM1.4 was partially restored, indicating that... OsLHCA3 It can counteract this destructive effect of NSvc4 and help maintain the functional state of Remorin.

[0078] 3. OsLHCA3 Restore callosity deposition Aniline blue staining was used to quantitatively analyze callosity deposition. For example... Figure 26 The results showed that NSvc4 expression significantly reduced callosity deposition at plasmodesmata, while co-expression significantly reduced callosity deposition compared to the control group. OsLHCA3 NSvc4 significantly restored callosity accumulation.

[0079] 4. OsLHCA3 Affects NSvc4 positioning and virus movement function like Figure 27 As shown in Figure A, laser confocal microscopy results indicate that NSvc4 can be located in plasmodesmata and chloroplasts. When combined with... OsLHCA3 When co-expressed, NSvc4 showed a significant increase in localization in chloroplasts.

[0080] Complementation assays were performed using the PVX-Δp25-GFP mutant. Figure 27 As shown in B and C, when PVX-Δp25-GFP is combined with GUS or OsLHCA3 When co-expressed, the GFP fluorescence signal is confined to a single cell; when NSvc4 and PVX-Δp25-GFP are co-expressed, the GFP fluorescence signal diffuses to ≥2 adjacent cells; OsLHCA3 Co-expression with NSvc4 and PVX-Δp25-GFP significantly reduced the diffusion of GFP fluorescence.

[0081] Further analysis was performed using Drop-And-See technology combined with CFDA reagents, such as... Figure 27 As shown in D and E, OsLHCA3 Co-expression with NSvc4 significantly inhibited the intercellular diffusion of CFDA.

[0082] The above results indicate that OsLHCA3 NSvc4 is recruited to chloroplasts, preventing it from interacting with Remorin in plasmodesmata, thereby impairing its viral motility.

[0083] While the present invention has been disclosed above, it is not limited thereto. Any person skilled in the art can make various modifications and alterations without departing from the spirit and scope of the invention; therefore, the scope of protection of the present invention should be determined by the scope defined in the claims.

[0084] sequence list SEQ ID NO.1 OsLHCA3 gene sequence ATGGCGGCTCAGGCTCTTCTCTCTGGGAGGCAGCTGCTGGGGAGGCCATTGCAATCTTCAGTCTCCAGGTCTTCTTCCTCCAGGAAGGCACCCTTCATGGTCAGGGCAGAGGCCACTCCCCCTGCCAAGCAAGGTGCTGACAGGCAGCTGTGGTTCGCATCCAAGCAGTCCCTGAGCTACCTGGATGGCACGCTTCCGGGAGACTTCGGGTTCGACCCGCTGGGGCTATCGGACCCGGAGGGGACCGGTGGGTTCATCGAGCCACGGTGGCTGGCCTACGGCGAGGTGTTCAACGGCCGGACGGCGATGATGGGCGTCGTCGGCATGGTCGCCCCGGAGCTCCTCGGCAAGCTGGGCCTCGTCCCCGCCGAGACGGCGATCCCGTGGTTCCAGACCGGCGTGATCCCCCCCGCGGGCACCTACACCTACTGGGCCGACCCTTACACTCTCTTCGTCTTCGAGCTCGCCCTCGTCGGCTTCGCCGAGCACCGCCGCTTCCAGGACTGGTACACGCCGGGCTCCATGGGGAAGCAGTACTTCCTCGGCCTCGAGAAGTACCTCGCCGGCTCCGGCGAGCCGGCCTACCCCGGCGGCCCGCTCTTCAACCCGCTCGGCTTCGGGACCAAGAGCGAGGCGGAGATGAAGGAGCTCAAGCTCAAGGAGATCAAGAATGGCAGGCTCGCCATGCTCGCCTTCCTCGGCTTCTCCGTCCAGGCGCTCTTCACCGGGGTTGGCCCCGTGCAGAACCTGCTTGATCACCTCGCTGATCCCGTCCACAACAACATCCTCACCAGCCTCAAGTTCCATTAG SEQ ID NO.2 OsLHCA3-ORF-F sequence 5’-CGACGACAAGACCGTCACCATGGCGGCTCAGGCTCTTCTCTCTGGGA-3’ SEQ ID NO.3 OsLHCA3-ORF-R sequence 5’-GAGGAGAAGAGCCGTCGATGGAACTTGAGGCTGGTGAGGATGTTGT-3’ SEQ ID NO.4 OJG141 sequence 5’-GAAACTGATGCATTGAACTTGACG-3’ SEQ ID NO.5 BNY-1 5’-ATTTGGAGAGAACACGGGG-3’ 。

Claims

1. The use of a gene in breeding rice resistant to rice stripe virus, characterized in that, The genes include OsLHCA3 Genes, the ones mentioned OsLHCA3 The gene sequence is shown in SEQ ID NO.

1.

2. A recombinant expression vector, characterized in that, The recombinant expression vector comprises the nucleotide sequence shown in SEQ ID NO.1, and the nucleotide sequence is operatively linked to the 35S promoter.

3. An engineered bacterium containing the recombinant expression vector as described in claim 2, characterized in that, The engineered bacteria is Agrobacterium tumefaciens EHA105.

4. A transgenic rice cell, characterized in that, The genome of the transgenic rice cells contains the nucleotide sequence shown in SEQ ID NO. 1, and the nucleotide sequence is overexpressed.

5. A transgenic rice plant, characterized in that, Obtained from the transgenic rice cell regeneration described in claim 4, and in the plant OsLHCA3 Gene overexpression.

6. A method for cultivating rice resistant to rice stripe virus, characterized in that, Includes the following steps: (1) Cloning rice as shown in SEQ ID NO.1 OsLHCA3 Gene; (2) Construct a recombinant expression vector containing the gene; (3) Transform the recombinant expression vector into Agrobacterium; (4) Transform rice callus tissue with the aforementioned Agrobacterium; (5) Screening and obtaining transgenic rice plants.

7. A method for improving the resistance of rice to rice stripe virus, characterized in that, By enhancing the rice OsLHCA3 The gene expression level recruits the rice stripe virus motility protein NSvc4 to chloroplasts, interferes with the interaction between NSvc4 and OsREM1.4, restores the palmitoylation level of OsREM1.4, and restores callosin deposition at plasmodesmata, thereby inhibiting the intercellular motility function of NSvc4.

8. The use of the protein encoded by the gene of claim 1 in inhibiting the function of rice stripe virus motility protein NSvc4.

9. The use of the protein encoded by the gene of claim 1 in the preparation of transgenic plants resistant to rice stripe virus.

10. The use of the protein encoded by the gene of claim 1 as an antagonist of the rice stripe virus motility protein NSvc4, characterized in that, The protein inhibits the intercellular movement of NSvc4 by recruiting NSvc4 to chloroplasts.