Application of rose RrFLS protein and its coding gene in improving plant resistance to salt stress
By overexpressing the rose RrFLS protein and its encoding gene, and combining the interaction of RrCHS, RrF3'H, and RrDFR genes, the salt stress resistance of rose and Arabidopsis was enhanced, solving the problem of slow growth of rose under salt stress, improving seed germination rate and taproot length, and enhancing the salt tolerance of plants.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SHANDONG AGRICULTURAL UNIVERSITY
- Filing Date
- 2026-04-13
- Publication Date
- 2026-06-05
AI Technical Summary
Roses grow slowly, their leaves turn chlorotic, they age prematurely, and they may even die under salt stress. Existing research has not fully explored and applied the functional genes related to salt stress tolerance in roses, and there is a lack of systematic and in-depth research.
By overexpressing the rose RrFLS protein and its encoding gene, and using recombinant technology to fuse the expressed protein tag in plants, the plant's resistance to salt stress is improved. Combined with the interaction of the RrCHS, RrF3'H, and RrDFR genes, the plant's salt tolerance is enhanced.
It improved seed germination rate and taproot length in plants under salt stress, enhanced plant salt stress resistance, and promoted the expression of salt tolerance-related genes and improved physiological indicators.
Smart Images

Figure CN122146767A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, specifically to the application of the rose RrFLS protein and its encoding gene in improving plant resistance to salt stress. Background Technology
[0002] Soil salinization is one of the important abiotic stresses affecting agricultural production and horticultural plant cultivation. With the aggravation of problems such as improper irrigation, secondary soil salinization, and salt accumulation in coastal areas, the adverse effects of salt stress on plant growth, development, yield, and quality are becoming increasingly prominent.
[0003] Rose( Rosa rugosa Roses are important horticultural plants with ornamental, edible, medicinal, and economic processing value, and are widely used in landscaping, cut flower production, aromatic essential oil extraction, and food processing. However, in large-scale cultivation, cultivated roses are quite sensitive to salt stress, especially in coastal saline-alkali areas and some inland salinized regions. Salt stress can easily lead to inhibited seed germination, suppressed root growth, imbalanced ion homeostasis, decreased photosynthetic capacity of leaves, and increased accumulation of reactive oxygen species, resulting in slow plant growth, chlorosis of leaves, premature aging, and even death. This seriously restricts the promotion and industrialization of roses in saline-alkali areas.
[0004] Currently, research on plant salt tolerance mainly focuses on ion transport regulation, osmotic regulation, antioxidant defense, and stress response signaling pathways. Studies on rose salt tolerance also tend to emphasize changes in physiological and biochemical indicators, functional analysis of some transcription factors or stress-related genes, and exploration of exogenous regulatory substances to alleviate salt damage. Overall, existing research on the discovery and application of functional genes related to rose salt tolerance is still insufficient. Systematic and in-depth research is lacking on their mechanisms of action in salt stress response and their application value in improving rose salt tolerance. Therefore, screening and identifying functional genes closely related to rose salt tolerance and clarifying their mechanisms of action is of great significance for the breeding of salt-tolerant rose varieties. Summary of the Invention
[0005] In view of the above-mentioned prior art, the purpose of this invention is to provide the application of rose RrFLS protein and its encoding gene in improving plant resistance to salt stress.
[0006] To achieve the above objectives, the present invention adopts the following technical solution: A first aspect of the present invention provides the application of rose RrFLS protein in improving plant resistance to salt stress; said RrFLS protein is a protein as shown in (A1) or (A2) below: (A1) A protein with the amino acid sequence shown in SEQ ID NO.1; (A2) The protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of the protein defined in (A1).
[0007] In the aforementioned proteins, the protein tag refers to a polypeptide or protein fused with the target protein using in vitro DNA recombination technology for expression, to facilitate the expression, detection, tracing, and / or purification of the target protein. The protein tag may be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc.
[0008] In the above applications, improving the plant's resistance to salt stress specifically means: increasing the seed germination rate and taproot length of the plant under salt stress treatment; or, increasing the activity of SOD and POD and the content of proline in the plant.
[0009] A second aspect of the invention provides RrFLS The application of genes in the following (1) or (2): (1) Improve the plant's resistance to salt stress; (2) Cultivate plant varieties tolerant to salt stress; The RrFLS A gene is a nucleic acid molecule as shown in (i) or (ii): (i) Nucleic acid molecules with nucleotide sequences as shown in SEQ ID NO.2; (ii) Nucleic acid molecules other than (i) that encode the amino acid sequence shown in SEQ ID NO.1.
[0010] In the above applications, through overexpression RrFLS Genes can be used to enhance a plant's resistance to salt stress.
[0011] In the above applications, the following substances are used for overexpression. RrFLS Gene: C1) contains RrFLS Gene expression cassettes; C2) contains RrFLS Recombinant vectors of genes, or recombinant vectors containing the expression cassette described in C1); C3) contains RrFLS Recombinant microorganisms containing genes, or recombinant microorganisms containing the expression cassette described in C1), or recombinant microorganisms containing the recombinant vector described in C2); C4) contains RrFLS Transgenic plant lines containing the gene or transgenic plant lines containing the expression cassette described in C1).
[0012] In the above applications, the RrFLS Genes through and RrCHS, RrF3'H, RrDFR Gene interactions enhance plant resistance to salt stress.
[0013] In the above applications, the plant is either rose or Arabidopsis thaliana.
[0014] A third aspect of the present invention provides a method for improving the resistance of plants to salt stress, comprising: inducing the plant to... RrFLS The steps of gene overexpression.
[0015] In the above methods, the plant is made RrFLS Gene overexpression is achieved through the following methods: Exogenous transfer RrFLS Genes; or the introduction of genes that can activate or enhance [something]. RrFLS DNA fragments at the transcriptional or translational level or for protein activity.
[0016] The beneficial effects of this invention are: This invention marks the first discovery of a gene in roses that is associated with plant resistance to salt stress. RrFLS. right RrFLS Gene function studies and the analysis of salt tolerance mechanisms have revealed that... RrFLS Overexpression of the gene enhanced the salt tolerance of transgenic Arabidopsis thaliana. RrFLS Gene silencing increases the salt sensitivity of silent roses, and changes in related genes also indicate... RrFLS The gene plays a positive regulatory role in the response to salt stress. Yeast two-hybrid experiments further verified the interaction between RrFLS and the proteins RrCHS, RrF3'H, and RrDFR. RrCHS, RrF3'H, RrDFR The gene has a certain salt tolerance function. Attached Figure Description
[0017] Figure 1 : RrFLS Analysis of gene expression patterns under salt stress.
[0018] Figure 2 Screening of positive seedlings of T2 generation transgenic Arabidopsis thaliana.
[0019] Figure 3 PCR validation of transgenic Arabidopsis thaliana; In the figure, M: RB2000 DNA Marker; 1-5: RrFLS Five different lines of transgenic Arabidopsis thaliana; 6-7: two different lines of pBI121-GFP transgenic Arabidopsis thaliana; 8-9: wild-type Arabidopsis thaliana.
[0020] Figure 4 In transgenic Arabidopsis thaliana RrFLS Expression analysis; In the figure, WT: wild-type Arabidopsis thaliana; pBI121: pBI121-GFP transgenic Arabidopsis thaliana; L1-L5: RrFLS Five different strains of transgenic Arabidopsis thaliana.
[0021] Figure 5 Germination rate and root length of transgenic Arabidopsis thaliana under salt stress; In the figure, A and B: overexpression under salt stress. RrFLS Germination rate of Arabidopsis thaliana after 7 days; C, D: overexpression under salt stress RrFLS Root length of the main root of Arabidopsis thaliana after 20 days of culture.
[0022] Figure 6 Analysis of the expression of salt tolerance-related genes in Arabidopsis thaliana under salt stress.
[0023] Figure 7 Overexpression under salt stress RrFLS Physiological parameters of Arabidopsis thaliana were measured; in the figure, WT: wild-type Arabidopsis thaliana; pBI121: pBI121-GFP transgenic Arabidopsis thaliana; pBI21- RrFLS -GFP: RrFLS Overexpression of Arabidopsis thaliana; A: SOD activity; B: POD activity; C: proline content; D: MDA content; E: total flavonoid content.
[0024] Figure 8 :silence RrFLS PCR identification and qRT-PCR analysis of roses; In the figure, AC: PCR detection of TRV-VIGS vector-related fragments in rose leaves; D: RrFLS Gene silencing efficiency analysis; TRV::00: TRV2-GFP infecting roses; TRV2::FLS: TRV- RrFLS -GFP-infected rose; A: GFP band molecular detection; B: TRV2 band molecular detection; C: TRV1 band molecular detection; D: CK: control; TRV00: TRV-GFP; S1, S2 and S3: 3 replicates of TRV- RrFLS -GFP.
[0025] Figure 9 Salt stress RrFLS Changes in stress phenotypes and physiological parameters in gene-silenced plants; in the figure, CK: rose; TRV-GFP: TRV2-GFP infected rose; TRV2::FLS: TRV- RrFLS -GFP infection of roses; A: RrFLS Phenotype of gene-silenced plants under salt stress; B: MDA content; C: Proline content; D: SOD activity; E: POD activity; F: Soluble sugar content Figure 10 Results of yeast two-hybrid assays to analyze the interactions of RrFLS with RrCHS, RrF3'H and RrDFR proteins.
[0026] Figure 11Phenotypic analysis results of RrDFR, RrF3'H, and RrCHS overexpressing strains and empty vector negative control (PYES2-NTB) under gradient NaCl stress. Detailed Implementation
[0027] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.
[0028] To enable those skilled in the art to better understand the technical solution of this application, the technical solution of this application will be described in detail below with reference to specific embodiments.
[0029] In this embodiment of the invention, the experimental materials required for salt tolerance phenotype studies (such as conventional biochemical reagents and plant culture consumables) are all conventional materials for plant stress tolerance research and can be legally obtained through commercial channels. Specific experimental conditions and operating procedures are generally performed according to conventional conditions for plant salt tolerance research, and it is recommended that the experimental reagents and instruments used be performed according to the operating instructions provided by the manufacturer.
[0030] Example 1: Salt stress RrFLS Gene expression analysis 1. Test method: The experimental material was an annual rose ( Rosa rugosa Cuttings were uniformly planted in 230 mm diameter plastic pots in a peat moss substrate. They were planted in a Shandong Provincial High-Tech Park (36°17′ N, 117°16′ E). Salt stress treatment was applied when the plants reached a height of 20-25 cm: a control group and a treatment group were set up, with 3 biological replicates in each group, for a total of 15 pots. The treatment group received 200 mmol·L⁻¹ salt. -1 The control group was irrigated with NaCl solution, while the control group was irrigated normally. Each irrigation was 400 mL, using a slow and even irrigation method to thoroughly irrigate the soil. Leaf samples were taken from the same part of the plant at five time points: 0, 6, 12, 24, and 72 h after salt stress treatment, with three biological replicates at each time point.
[0031] RNA was extracted from rose leaves, reverse transcribed into cDNA, and then used in rose... RrGAPDH This is an internal reference gene, detected using qRT-PCR technology. RrFLS Relative expression levels of the gene (GenBank accession number: PP409574) at different salt stress time points.
[0032] The relative expression level was calculated using 2 -ΔΔCtMethods. The qRT-PCR reaction system was performed according to the Novizan Q711 kit instructions, with the specific reaction program being 95 ℃ for 30 s; 95 ℃ for 10 s, 60 ℃ for 30 s, for 40 cycles. The primer sequences for qRT-PCR detection are shown below: RrFLS -F:GTGAACCACGACATTTCTAACG; (SEQ ID NO.3) RrFLS- R:CCCACCCTTCTTCCCTTC. (SEQ ID NO.4) RrGAPDH -F:TTCTGCCTGCTCTCAATG; (SEQ ID NO.5) RrGAPDH -R: TGCCTTCTTCTCAAGTCTG. (SEQ ID NO.6) 2. Test Results: Salt stress RrFLS Gene expression status, such as Figure 1 As shown, within 72 h of salt stress treatment, RrFLS The expression level in rose leaves showed a trend of first increasing, then decreasing, and then increasing again, reaching a peak at 6 h; the results indicated that salt stress effectively induced [the expression level]. RrFLS Gene expression.
[0033] Example 2: Heterologous transformation of Arabidopsis thaliana RrFLS Functional verification of genes 1. Construction of transgenic Arabidopsis thaliana: Will RrFLS The CDS sequence (SEQ ID NO.2) of the gene was ligated into the pBI121-GFP vector to construct the overexpression vector pBI121-. RrFLS -GFP.
[0034] The overexpression vector pBI121- was respectively RrFLS The empty vectors -GFP and pBI121-GFP were transformed into Agrobacterium GV3101 competent cells. Wild-type Arabidopsis plants were cultured for 3-4 weeks using the inflorescence infection method. F0 generation seeds were harvested and sown on MS solid medium containing kanamycin (Kan, 50 μg / mL) for selection. Seedlings were preliminarily identified as transgenic positive plants when they developed their first pair of true leaves and remained green. Transgenic positive plants were planted and individually seeded. Two more rounds of selection were conducted to obtain T2 generation transgenic seeds, which were then sown. After one month of normal culture, leaf samples were collected, and DNA was extracted for PCR detection. Total RNA was also extracted from the leaves for further analysis. AtActin2 This is an internal reference gene, detected using qRT-PCR technology.RrFLS The relative expression level of the gene in the overexpressing plant.
[0035] AtActin2 -F: GTCGTACAACCGGTATTGTG; (SEQ ID NO.7) AtActin2 -R:GAGCTGGTCTTTGAGGTTTC. (SEQ ID NO.8) Screening of positive seedlings of T2 generation transgenic Arabidopsis thaliana, such as Figure 2 As shown; RCR identification results are as follows Figure 3 As shown; the results indicate that the expected band was successfully amplified in all transgenic lines, while no corresponding band was observed in wild-type and empty vector (pBI121-GFP) plants. Different lines of transgenic Arabidopsis thaliana... RrFLS The relative expression level of genes, such as Figure 4 As shown, RrFLS The expression levels in all overexpression lines were significantly higher than those in the wild type. Lines with moderate expression levels were selected. RrFLS- L2 cells were cultured further, and T3 generation seeds were harvested and preserved.
[0036] 2. Determination of seed germination rate and root length of transgenic Arabidopsis thaliana under salt stress: Transgenic Arabidopsis thaliana plants with intermediate relative expression levels (pBI121-) were selected. RrFLS Seeds of Arabidopsis thaliana (WT), empty vector control (pBI121-GFP), and wild-type WT were sterilized and then sown on MS solid medium containing 0 mM and 100 mM NaCl, respectively. Each treatment was configured with 3 biological replicates, with one culture dish per replicate. After 7 days of culture, the germination rate of each group was accurately counted by region.
[0037] The transgenic Arabidopsis plants, empty vector control plants, and wild-type Arabidopsis (WT) seeds were sown on MS solid medium without NaCl. After culturing for 5 days, seedlings with consistent growth were selected and transferred to MS plates containing 0 mM and 100 mM NaCl, respectively, and cultured vertically for another 15 days. Subsequently, the length of the main root of Arabidopsis on different culture media was accurately measured.
[0038] The results are as follows Figure 5 As shown, the results indicate that the germination rate of seeds in all groups reached 100% under NaCl-free conditions. Under 100 mM NaCl stress, overexpression... RrFLS The germination rate of Arabidopsis seeds was 77%, while the germination rates of the empty vector control and WT plants were only 58% and 60%, respectively.
[0039] The root length of the primary root of Arabidopsis thaliana plants grown for 20 days was measured in MS solid medium containing 0 mM and 100 mM NaCl. The results showed that under 100 mM NaCl stress, the overexpression lines... RrFLS The root length of Arabidopsis thaliana (5.0 cm) was greater than that of wild-type WT (4.6 cm) and empty vector control pBI121-GFP (4.4 cm).
[0040] 3. Analysis of salt tolerance-related gene expression and determination of physiological indicators in transgenic Arabidopsis thaliana under salt stress: T3 generation transgenic Arabidopsis thaliana plants (pBI121-) were selected. RrFLS -GFP), pBI121-GFP control plants and WT Arabidopsis seeds were grown under the same culture conditions for 20 days, then subjected to irrigation with 200 mmol·L⁻¹ NaCl solution, and samples were collected 6 h later. AtActin2 As internal reference genes, qRT-PCR was used to detect salt tolerance-related genes in Arabidopsis thaliana. AtNHX1 (NM_122597) , AtSOS2 ( NM_122932) , AtADH (AY088010) AtSOS1 The expression level of (ID: NM_126259).
[0041] AtNHX1 -F: ACTCACCTAAACCACGAAGC; (SEQ ID NO.9) AtNHX1 -R:CAGACCACCAAATCACAACC. (SEQ ID NO.10) AtSOS1 -F:GCTTGCTACATTTCTGCTG; (SEQ ID NO.11) AtSOS1 -R: CCTGCCAAAGGAAATCATC. (SEQ ID NO.12) AtSOS2 -F: TTAGTGGACAGGGTTACGA; (SEQ ID NO.13) AtSOS2 -R: CCATTGAGTTCGCTACAGC. (SEQ ID NO.14) AtADH -F: CTCTTGGTGCTGTTGGTTTAGG; (SEQ ID NO.15) AtADH -R: AATTGGCTTGTCATGGTCTTTC. (SEQ ID NO.16) Leaves of transgenic T3 generation Arabidopsis and wild-type Arabidopsis were collected at 0 h, 6 h, 12 h, 24 h, and 72 h after salt stress. The activities of SOD and POD enzymes, as well as the contents of MDA and total flavonoids, were determined according to the method described in "Zhao Shijie. Experimental Guide to Plant Physiology. Beijing: China Agricultural Science and Technology Press, 2002".
[0042] The expression of salt tolerance-related genes in Arabidopsis thaliana under salt stress conditions is as follows: Figure 6 As shown, the results indicate that compared with WT and empty vector controls (no significant difference between the two), RrFLS The expression of the above-mentioned salt tolerance-related genes was significantly upregulated in the overexpression lines.
[0043] The results of physiological index determination of transgenic Arabidopsis thaliana under salt stress are as follows: Figure 7 As shown, compared with the two control groups, RrFLS The MDA content in the overexpression lines was significantly reduced; the SOD and POD activities and proline content were significantly increased; and the total flavonoid content was also higher than that in the control group.
[0044] In summary, overexpression RrFLS Genes can improve seed germination rate and taproot length under salt stress, and promote the expression of salt-tolerant genes in plants, thereby enhancing the salt tolerance of plants.
[0045] Example 3: Virus-induced gene silencing RrFLS Functional verification of genes 1. RrFLS Construction of gene-silenced rose plants: Using the SGN VIGS tool in RrFLS Specific fragments were selected from the CDS sequence, primers containing the TRV2 vector restriction sites were designed and ligated into the TRV2-GFP vector to construct the TRV2-GFP vector. RrFLS Recombinant plasmids were used to transform Agrobacterium GV3101 competent cells.
[0046] T- RrFLS -F: tgcccgggcctcgag ggatcc GAGGAGAAAGAGGTTTACG; (SEQ ID NO.17) T- RrFLS -R:aaggttacc gaattctctaga CCTTCTTCAGTTCTTGTGC. (SEQ ID NO.18) The experimental group TRV2- was treated using a vacuum method. RrFLSAgrobacterium +TRV1 and control group TRV2+TRV1 bacterial suspensions were injected into rose leaves. Two weeks later, samples were taken from newly sprouted rose leaves, and PCR amplification was performed using cDNA from the sample leaves as a template. Positive results were detected using PCR and qRT-PCR techniques.
[0047] The results show that ( Figure 8 In groups A, B, and C), the TRV-VIGS treatment group amplified specific bands for TRV1, TRV2, and GFP, and the band sizes were consistent with the expected target bands; among them ( Figure 8 In section B), the extra portion of the TRV2 vector ligating the target fragment compared to the empty vector is the same length as the target fragment, proving that TRV-GFP and TRV- RrFLS -GFP was successfully infected and expressed in rose leaves. qRT-PCR results showed that, compared with the control, TRV2- RrFLS -GFP in the leaves of rose plants RrFLS The expression level was significantly reduced ( Figure 8 (D). The above results indicate that RrFLS The gene has been effectively silenced in rose leaves.
[0048] 2. Silence under salt stress RrFLS Phenotypic and physiological response analysis of the genetic rose: For successfully identified silent plants (TRV) -RrFLS -GFP) and control plants (wild-type control CK, empty vector control TRV-GFP) were treated with 200 mmol·L⁻¹ -1 The plants were irrigated with a NaCl solution, 400 mL per pot, using a slow and even watering method to ensure thorough watering. Fifteen pots were used for both silent and control treatments, with three biological replicates. After 72 hours of salt stress treatment, leaf phenotypes were observed in each treatment group, and the activities of SOD and POD enzymes, as well as the contents of MDA and soluble sugars, were measured.
[0049] The results are as follows Figure 9 As shown, after 72 hours of salt stress, RrFLS The silent lines showed a stronger salt-sensitive phenotype than the control plants (CK, TRV-GFP): the leaves wilted and lost their green color, accompanied by scorched and curled leaf margins; while the control group only showed slight curling.
[0050] Measurement RrFLS Physiological indicators of the silent strain and the control (CK and TRV-GFP) showed that after 72 h of salt stress, the activities of SOD and POD and the content of soluble sugars in the silent strain were significantly reduced, while the contents of MDA and proline were increased.
[0051] Therefore, RrFLS Gene silencing increases the salt sensitivity of roses.
[0052] Example 4: Functional verification of RrFLS interacting proteins and encoding genes 1. Yeast two-hybrid (Y2H) experiment: Proteins that may interact with RrFLS were identified using the STRING online tool: RrDFR (ID: KM203111), RrCHS (ID: XM_062145577), and RrF3'H (ID: XM_062143411). Based on the Rose Transcriptome Database, restriction enzymes targeting the pGADT7 vector cleavage sites were designed. RrDFR , RrCHS , RrF3'H Gene-specific primers are as follows: AD- RrCHS -F: gccatggaggccagt gaattc ATGGTGACCGTCGAGGAAGTCC; (SEQ ID NO.19) AD- RrCHS -R: cagctcgagctcgat ggatcc AGCAGCCACACTGTGAAGCAC. (SEQ ID NO.20) AD- RrF3'H -F: gccatggaggccagt gaattc ATGGCCCCTACTCCTACTACTC; (SEQ IDNO.21) AD- RrF3'H -R: cagctcgagctcgat ggatcc GGCAAAAATATTATCCACTGGC. (SEQ IDNO.22) AD- RrDFR -F: gccatggaggccagt gaattc ATGGGATCGGAATCCGAGTC; (SEQ ID NO.23) AD- RrDFR -R: cagctcgagctcgat ggatcc GCCTGTGACTTTGACACGGAC. (SEQ ID NO.24) Amplification was performed using the aforementioned specific primers, and the resulting structures were ligated to the pGADT7 vector to construct recombinant vectors pGADT7-RrDFR, pGADT7-RrCHS, pGADT7-RrF3'H, and pGBKT7-RrFLS. These vectors were then co-transformed into Y2H Gold yeast competent cells with pGBKT7-RrFLS and plated on SD / Trp / -Leu two-cell plates. The cells were incubated upside down at 28 ℃–30 °C for 3–5 days. Single colonies with good growth were picked from the two-cell plates, serially diluted with 0.9% NaCl solution, and spotted onto SD / -Trp / -Leu / -His / -Ade four-cell plates. The cells were incubated at 30 °C for 3–5 days to observe yeast growth and detect protein interactions.
[0053] The results of the yeast two-hybrid assay showed that the positive control group (pGBKT7-53+pGADT7-T) exhibited typical blue colonies on SD / -Ade / -His / -Leu / -Trp / X-α-gal medium, while the negative control group (pGBKT7-Lam+pGADT7-T) showed no growth. In the experimental groups, co-transformation combinations of RrFLS with RrCHS, RrF3'H, and RrDFR all showed the same growth phenotype and X-α-gal staining positivity as the positive control. Figure 10 This indicates that there is a specific interaction between the above proteins.
[0054] 2. Validation of yeast overexpression: For further analysis RrCHS, RrDFR, RrF3'H To determine the gene's function, specific primers carrying the pYES2-NTB vector restriction site were designed. NTB- RrCHS -F:cgataaggtacctaa ggatcc ATGGTGACCGTCGAGGAAGTCC; (SEQ IDNO.25) NTB- RrCHS -R:tgctggatatctgca gaattc AGCAGCCACACTGTGAAGCAC. (SEQ ID NO.26) NTB- RrF3H -F:cgataaggtacctaa ggatcc ATGGCCCCTACTCCTACTACTC; (SEQ IDNO.27) NTB- RrF3H -R:tgctggatatctgca gaattc GGCAAAAATATTATCCACTGGC. (SEQ IDNO.28) NTB- RrDFR-F:cgataaggtacctaa ggatcc ATGGGATCGGAATCCGAGTC; (SEQ ID NO.29) NTB- RrDFR -R:tgctggatatctgca gaattc GCCTGTGACTTTGACACGGAC. (SEQ ID NO.30) Recombinant vectors pYES2-NTB-RrDFR, pYES2-NTB-RrCHS, and pYES2-NTB-RrF3'H were constructed. The experimental group and the negative control pYES2-NTB were transformed into yeast strain INVSC1 using the lithium acetate conversion method, plated on SD-Ura plates, and incubated at 30°C for 4 days.
[0055] Select the correct positive clones from the experimental and control groups, resuspend them in 2 ml of sterile water, and dilute (10⁻⁶). 0 10 -1 10 -2 Spot the yeast onto SG-Ura+0 M NaCl, SG-Ura+0.5 M NaCl, SG-Ura+1.0 M NaCl, SG-Ura+1.3 M NaCl, SG-Ura+1.5 M NaCl, and SG-Ura+2.0 M NaCl plates, and incubate them in a 30℃ incubator. After 7 days, observe the growth status of the yeast on the plates and evaluate the salt tolerance phenotype of the gene.
[0056] The results are as follows Figure 11 As shown, all strains lost their growth ability in NaCl concentrations of SG-U + 1.3 M and above, but under SG-U + 0.5 M / 1.0 M NaCl conditions, the colony density of the overexpression lines was significantly higher than that of the control. This result indicates that... RrDFR , RrF3'H , RrCH Overexpression of S enhances the adaptability of yeast to sublethal salt concentrations (≤1.0 M NaCl).
[0057] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.
Claims
1. Application of rose RrFLS protein in improving plant resistance to salt stress; characterized in that, The RrFLS protein is the protein shown in either (A1) or (A2) below: (A1) A protein with the amino acid sequence shown in SEQ ID NO.1; (A2) The protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of the protein defined in (A1).
2. The application according to claim 1, characterized in that, Specifically, improving plant resistance to salt stress involves: increasing seed germination rate and taproot length under salt stress treatment; or increasing SOD and POD activity and proline content in plants.
3. RrFLS The application of genes in the following (1) or (2): (1) Improve the plant's resistance to salt stress; (2) Cultivate plant varieties tolerant to salt stress; The RrFLS A gene is a nucleic acid molecule as shown in (i) or (ii): (i) Nucleic acid molecules with nucleotide sequences as shown in SEQ ID NO.2; (ii) Nucleic acid molecules other than (i) that encode the amino acid sequence shown in SEQ ID NO.
1.
4. The application according to claim 3, characterized in that, Through overexpression RrFLS Genes can be used to enhance a plant's resistance to salt stress.
5. The application according to claim 4, characterized in that, Overexpression using the following substances RrFLS Gene: C1) contains RrFLS Gene expression cassettes; C2) contains RrFLS Recombinant vectors of genes, or recombinant vectors containing the expression cassette described in C1); C3) contains RrFLS Recombinant microorganisms containing genes, or recombinant microorganisms containing the expression cassette described in C1), or recombinant microorganisms containing the recombinant vector described in C2); C4) contains RrFLS Transgenic plant lines containing the gene or transgenic plant lines containing the expression cassette described in C1).
6. The application according to claim 3, characterized in that, The RrFLS Genes through and RrCHS, RrF3'H, RrDFR Gene interactions enhance plant resistance to salt stress.
7. The application according to claim 3, characterized in that, The plant in question is either rose or Arabidopsis thaliana.
8. A method for improving plant resistance to salt stress, characterized in that, include: In plants RrFLS The steps of gene overexpression.
9. The method according to claim 8, characterized in that, In plants RrFLS Gene overexpression is achieved through the following methods: Exogenous transfer RrFLS Genes; or the introduction of genes that can activate or enhance [something]. RrFLS DNA fragments at the transcriptional or translational level or for protein activity.