InDel molecular marker related to post-harvest plant height regeneration ability of alfalfa on chromosome 5 and application thereof
By developing the InDel molecular marker Ms_Chr5_76562683 on chromosome 5 of alfalfa, and using PCR amplification and electrophoresis detection, the problem of the difficulty in efficiently improving the plant height regeneration ability of alfalfa after cutting was solved, and rapid and accurate identification of plant height regeneration ability and improvement of breeding efficiency were achieved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- LANZHOU UNIV
- Filing Date
- 2026-04-29
- Publication Date
- 2026-06-05
AI Technical Summary
Traditional breeding methods for improving alfalfa plant height regeneration after cutting are characterized by long cycles, low efficiency, susceptibility to environmental factors, low accuracy of phenotypic selection, and difficulty in achieving efficient improvement through molecular marker-assisted breeding.
An InDel molecular marker, Ms_Chr5_76562683, located on chromosome 5 of alfalfa was developed. The plant height regeneration ability was detected by PCR amplification and agarose gel electrophoresis. Primer pairs Ms_Chr5_76562683-F and Ms_Chr5_76562683-R were designed to identify the plant height trait of alfalfa after mowing.
It enables rapid and accurate identification of the high regeneration capacity of alfalfa plants, simplifies the breeding process, improves breeding efficiency and accuracy, and reduces costs.
Smart Images

Figure CN122146927A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to an InDel molecular marker located on chromosome 5 that is related to the plant height regeneration ability of alfalfa after cutting and its application. Background Technology
[0002] Alfalfa (Medicago sativa L.) is a perennial herbaceous plant belonging to the genus *Medicago* in the legume family. It is a widely cultivated legume forage with high feed value, often referred to as the "King of Forages." Alfalfa's regeneration ability is a crucial yield-related trait; the rate of plant height regeneration after mowing directly determines the forage's regeneration speed and annual yield. Studies have shown that alfalfa varieties with strong post-mowing height regeneration ability can recover growth quickly, significantly increasing the number of annual mowing cycles and total yield. Currently, improving alfalfa's post-mowing height regeneration ability mainly relies on conventional hybridization breeding and phenotypic selection. However, alfalfa is a tetraploid species that is cross-pollinated, self-incompatible, and has a complex genetic background. Traditional breeding methods are time-consuming and inefficient, and quantitative traits such as post-mowing height regeneration ability are easily affected by environmental factors, resulting in low accuracy in phenotypic selection. Therefore, by analyzing the genetic basis of alfalfa's ability to regenerate plant height after cutting, we can discover molecular markers closely linked to this trait and carry out molecular marker-assisted breeding for high-yielding and high-quality alfalfa varieties.
[0003] Genome-wide association studies (GWAS) are a highly efficient method for elucidating the genetic basis of complex quantitative traits. By associating genotype data from large-scale populations with the phenotype of a target trait, they can rapidly locate genetic variation loci significantly associated with the trait. Molecular marker-assisted breeding (MDMA) allows for direct selection of target traits at the DNA level, offering advantages such as high efficiency, accuracy, and independence from growth period and environmental influences, significantly shortening the breeding process. InDel markers, based on primers designed from conserved sequences flanking inserted or deleted segments in the genome, allow for genotyping based on differences in fragment size of PCR amplification products. They offer advantages such as ease of operation, good stability, low cost, and co-dominant inheritance. This invention utilizes 230 alfalfa accessions to construct a population and resequencing them. Combined with the regeneration plant height trait, an InDel locus associated with plant height regeneration ability was developed. This has significant implications for constructing MDMA breeding systems, improving germplasm resources, and breeding new varieties. Summary of the Invention
[0004] One of the objectives of this invention is to provide an InDel molecular marker related to the regeneration capacity of alfalfa plant height after cutting.
[0005] A second objective of this invention is to provide the application of the InDel molecular markers mentioned above that are related to the plant height regeneration ability of alfalfa after cutting.
[0006] To achieve the above objectives, the present invention adopts the following technical solution: The InDel molecular marker related to plant height regeneration ability after mowing disclosed in this invention is located on chromosome 5 of alfalfa and is named Ms_Chr5_76562683.
[0007] Primer pairs were used to amplify the InDel molecular marker associated with high regeneration capacity of alfalfa plants. The primer pair sequence corresponding to the molecular marker Ms_Chr5_76562683 is as follows: Ms_Chr5_76562683-F: TATAATCCGTCTCATTCTATAAAATAAATCT (shown in SEQ ID NO.1); Ms_Chr5_76562683-R: AATTTTATGGACGCACACTTTTGAT (shown as SEQ ID NO.2).
[0008] This invention also discloses the application of the above-mentioned molecular marker primer pairs in marker-assisted breeding of alfalfa regenerated plant height after mowing. In other words, the molecular markers of this invention can be used in future marker-assisted breeding. By extracting DNA from leaves during the seedling stage and detecting the presence of the molecular markers of this invention, the regenerated plant height-related traits of alfalfa materials can be identified, thereby determining the strength of alfalfa plant height regeneration ability. The detection can be performed using PCR, specifically using the above-mentioned molecular marker primer pairs, or it can be performed using sequencing methods.
[0009] This invention also discloses the application of the aforementioned molecular markers in identifying the regenerated plant height trait of alfalfa after mowing, particularly in screening and identifying the regeneration ability of alfalfa after mowing. Specifically, the specific steps for identifying the regenerated plant height trait of alfalfa after mowing are as follows: (1) Using the DNA of the tested germplasm as a template for PCR amplification, PCR amplification was performed using the primer pair corresponding to the molecular marker Ms_Chr5_76562683. The PCR amplification reaction system is shown in Table 1: Table 1. Reaction system for PCR amplification
[0010] Pre-denaturation at 98℃ for 30 seconds; denaturation at 98℃ for 10 seconds, annealing at 58℃ for 5 seconds, extension at 72℃ for 10 seconds, 40 cycles; extension at 72℃ for 1 minute; store at 4℃.
[0011] (2) Detection of PCR products by agarose gel electrophoresis: Take 3 μL and judge the results of alfalfa plant height based on the band results.
[0012] PCR amplification was performed using primers Ms_Chr5_76562683-F and Ms_Chr5_76562683-R. If the PCR amplification product contained only one characteristic band of 285 bp as shown in SEQ ID NO.4, then the alfalfa was a tall type (with strong plant height regeneration ability). If there was both a characteristic band of 285 bp as shown in SEQ ID NO.4 and a characteristic band of 260 bp as shown in SEQ ID NO.5, then the alfalfa was a short type (with weak plant height regeneration ability).
[0013] In addition, this invention also protects a kit for identifying the high regeneration capacity trait of alfalfa plants, the kit containing primer pairs Ms_Chr5_76562683-F and Ms_Chr5_76562683-R. Other components of the kit are all conventional reagents. Specifically, it also includes 10×PCR Buffer, dNTPs, and Taq DNA polymerase. This invention does not impose any special restrictions on the concentration of the primer pairs; primer concentrations well-known in the art can be used. This invention also does not impose any special restrictions on the source of the 10×PCR Buffer, dNTPs, and Taq DNA polymerase; common PCR amplification reagents well-known in the art can be used.
[0014] The kit of this invention can rapidly identify the regeneration ability of alfalfa plant height after mowing, and can also rapidly identify the genotype of alfalfa plant height after mowing. The specific method follows the steps for identifying the regenerated plant height trait of alfalfa after mowing. By performing electrophoresis and / or sequencing on the PCR amplification products, if the PCR amplification product has only one characteristic band of 285 bp as shown in SEQ ID NO.4, then the alfalfa is homozygous tall (strong plant height regeneration ability) genotype; if the PCR amplification product has both one characteristic band of 285 bp as shown in SEQ ID NO.4 and one characteristic band of 260 bp as shown in SEQ ID NO.5, then the alfalfa is heterozygous short (weak plant height regeneration ability) genotype.
[0015] The present invention has the following advantages: (1) The inventors of this invention screened out a molecular marker Ms_Chr5_76562683 that is related to the plant height regeneration ability of alfalfa after cutting. This molecular marker is located on chromosome 5. Using the molecular marker Ms_Chr5_76562683 of this invention, the plant height regeneration ability of alfalfa after cutting can be quickly and accurately identified.
[0016] (2) Using markers linked to the plant height regeneration ability after cutting for screening is beneficial for molecular marker-assisted selection breeding. The method is simple and feasible, which can improve efficiency and save costs.
[0017] (3) The molecular markers of the present invention have the characteristics of convenient detection, stable amplification products and high specificity. They can be applied in a simple, rapid and high-throughput manner to the breeding practice and material identification of alfalfa plant height regeneration ability after cutting. Attached Figure Description
[0018] Figure 1 The genome-wide association analysis results for the height of alfalfa regenerated plants after mowing are obtained from a Manhattan plot based on EMMAX software. The black dots indicate the InDel positions associated in this invention.
[0019] Figure 2 This is a box plot showing the plant height distribution corresponding to the genotype at the Ms_Chr5_76562683 locus in the alfalfa population of Example 1 of this invention. 0 / 0 indicates a homozygous tall genotype (strong plant height regeneration ability) at the Ms_Chr5_76562683 locus, while 0 / 1 indicates a heterozygous short genotype (weak plant height regeneration ability). Dots represent extreme values, and **** represents... P <0.0001.
[0020] Figure 3 This is a partial sequence alignment result of short-stemmed (weak plant height regeneration ability) and tall-stemmed (strong plant height regeneration ability) materials in the plant height regeneration ability related region.
[0021] Figure 4 Electrophoresis images of amplified molecular markers at the Chr5_76562683 locus in 14 alfalfa germplasm resources. The concentration of agarose gel was 2%.
[0022] In the diagram, M represents a DNA marker. Detailed Implementation
[0023] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer with the description. However, unless otherwise specified, the specific experimental methods involved in the following embodiments are conventional methods or implemented according to the conditions recommended in the manufacturer's instructions.
[0024] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, the experimental methods in the following embodiments are all conventional methods. Unless otherwise specified, the reagents and materials used can be purchased commercially.
[0025] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.
[0026] Example 1: Development of molecular markers related to alfalfa plant height regeneration ability after cutting This invention uses the height of regenerated plants after mowing at the initial flowering stage (four weeks after mowing) to measure the regeneration capacity of alfalfa. A higher value indicates tall alfalfa (strong regeneration capacity), while a lower value indicates short alfalfa (weak regeneration capacity). The regenerated plant height of the alfalfa population was measured four weeks after mowing, and GWAS analysis located an InDel locus in the alfalfa. Figure 1 The black locus, named Ms_Chr5_76562683, is located at locus 76562683 on chromosome 5 of the alfalfa reference genome (downloadable from https: / / figshare.com / articles / dataset / Medicago_sativa_genome_and_annotation_files / 12623960; the downloaded file "ZhongmuNo.1_genome.fasta.gz" is the alfalfa genome sequence). The first allele is 0 / 0, and the second allele is 0 / 1. A box plot showing the plant height distribution corresponding to the genotypes at the Ms_Chr5_76562683 locus in the population is shown. Figure 2 This indicates that the height of alfalfa lines with genotype 0 / 1 regenerated four weeks after mowing was significantly different from that of alfalfa lines with genotype 0 / 0. An insertion / deletion fragment TATTACCCTGTTGAAGAACTCAGAT (shown in SEQ ID NO. 3) is present at locus 76562683 on alfalfa chromosome 5. Figure 3 The insertion of the fragment shown in SEQ ID NO.3 affects the plant height regeneration ability of alfalfa four weeks after cutting. Alfalfa with the fragment shown in SEQ ID NO.3 inserted is a type of alfalfa with strong plant height regeneration ability four weeks after cutting; alfalfa without the fragment shown in SEQ ID NO.3 is a type of alfalfa with weak plant height regeneration ability four weeks after cutting.
[0027] Based on the InDel variant and its upstream and downstream sequences, the following primers were designed using NCBI (https: / / www.ncbi.nlm.nih.gov / ): Ms_Chr5_76562683-F: TATAATCCGTCTCATTCTATAAAATAAATCT (shown in SEQ ID NO.1); Ms_Chr5_76562683-R: AATTTTATGGACGCACACTTTTGAT (shown as SEQ ID NO.2).
[0028] Then, PCR amplification was performed on the test samples using the above primers. The results showed that the PCR product of homozygous alfalfa samples with strong plant height regeneration ability after four weeks of mowing only had a characteristic band of 285bp, while the PCR product of heterozygous alfalfa samples with weak plant height regeneration ability after four weeks of mowing had both a characteristic band of 285bp and a characteristic band of 260bp.
[0029] Example 2: Accuracy verification of the molecular markers described in this invention 230 germplasm accessions were identified, and the specific germplasm materials used are shown in Table 2: Table 2. Plant height of 230 germplasm materials four weeks after mowing and genotypes corresponding to the Chr5_76562683 locus.
[0030]
[0031]
[0032] 1) Using the genomic DNA of alfalfa to be identified as a template, PCR amplification was performed using the primer pair to obtain the PCR product; The PCR amplification reaction system is as follows: template DNA 10–100 ng, 1 μL of 10 μM forward primer, 1 μL of 10 μM reverse primer, 10 μL of 2 × Taq PCR Master Mix, and deionized water to a final volume of 20 μL. The preferred PCR amplification reaction program is: 98℃ pre-denaturation for 30 s; 98℃ denaturation for 10 s, 58℃ annealing for 5 s, 72℃ extension for 10 s, 40 cycles; 72℃ extension for 1 min; storage at 4℃. Separation is performed by electrophoresis on a 2% agarose gel. After loading, the samples are electrophoresed at 120V DC for 40 min, and the PCR banding patterns of each sample are then read.
[0033] 2) Determine the plant height of alfalfa after cutting based on the size of the PCR product: When the PCR product of the alfalfa to be identified is missing the fragment shown in SEQ ID NO.3, the alfalfa to be identified is a dwarf (weak plant height regeneration ability) type alfalfa. When the fragment shown in SEQ ID NO.3 is inserted into the PCR product of the alfalfa to be identified, the alfalfa to be identified is a tall (strong plant height regeneration ability) type alfalfa. Specifically, when the fragment shown in SEQ ID NO.3 is inserted into the PCR product of the alfalfa to be identified, the band length of the PCR product is 285bp (SEQ ID NO.4), then the alfalfa to be identified is a tall-stemmed (strong plant height regeneration ability) type alfalfa.
[0034] SEQ ID The sequence of NO.4 is as follows: TATAATCCGTCTCATTCTATAAAATAAAATCTCAAGTTTATTAATAATACAATTAAGTAAATCCTAATTATTTATTTATTATTAAATTTCGATATCCAATTTAAGGATCGAATAATATGTGGTACCAATCCAACTGAC AACTAGCAGAGTCTTCGCAGACCCAAGAGTATTACCCTGTTGAAGAACTCAGATTATCCAATTTCGTTCAGGGGTGTTCATTGACATATAGGATTTTATGATCTAGAGATCTTGTTGGAAGTATCAAAAGTGTGCGTCCATAAATT.
[0035] When the PCR product of the alfalfa to be identified is missing the fragment shown in SEQ ID NO.3, and the band length of the PCR product is 260bp (SEQ ID NO.5), then the alfalfa to be identified is a dwarf (weak plant height regeneration ability) type alfalfa.
[0036] SEQ ID The sequence of NO.5 is as follows: TATAATCCGTCTCATTCTATAAAATAAAATCTCAAGTTTATTAATAATACAATTAAGTAAATCCTAATTATTTATTTATTATTAAATTTCGATATCCAATTTAAGGATCGAATAATATGTGGTAC CAATCCAACTGACAACTAGCAGAGTCTTCGCAGACCCAAGAGTATCCAATTTCGTTCAGGGGTTGTTCCATTGACATATAGGATTTTATGATCTAGAGATCTTGTTGGAAGTATCAAAAGTGTGCGTCCATAAATT.
[0037] If the PCR product of the alfalfa to be identified consists of two bands, namely a band with the inserted fragment shown in SEQ ID NO.3 and a band with the deleted fragment shown in SEQ ID NO.3, and one band is 285 bp in length and the other is 260 bp, then the alfalfa to be identified is a heterozygous dwarf (weak plant height regeneration ability) type alfalfa.
[0038] Furthermore, Table 2 shows that in this study, 195 alfalfa accessions were identified as having the genotype 0 / 0 at the Chr5_76562683 locus, with an average plant height of 54.58 cm, classifying them as tall alfalfa (with strong plant height regeneration ability). The remaining 35 accessions had the genotype 0 / 1 at the Chr5_76562683 locus, with an average plant height of 49.98 cm, classifying them as short alfalfa (with weak plant height regeneration ability). Analysis of variance showed a highly significant difference in plant height between short (weak plant height regeneration ability) and tall (strong plant height regeneration ability) alfalfa. P <0.001).
[0039] Twenty-three germplasm accessions were selected ('IFMP799', 'CF048291', 'Muge', 'Juneng 2', 'Zhongcao 3', 'CF003268', 'CF031933', 'Dongmu 3', 'Huaiyang 4', 'CF005594', 'W639949', 'Liangmu', 'Zhongmu 3', 'Bara420YQ', 'Adina', 'WL363HQ', 'CF040401', 'Zhungeer', 'Dafuhao', 'WL525', 'Abi700', 'CF040681', 'Qishi 2'). PCR testing was performed on these accessions, and the results corresponded consistently with the genotypes at the Chr5_76562683 locus and the actual plant height measurements. Figure 4 Therefore, the InDel molecular marker of the present invention can effectively identify the plant height of alfalfa after mowing, and can be used for the prediction and screening of alfalfa materials with strong plant height regeneration ability after mowing.
[0040] The embodiments described above are merely preferred embodiments of the present invention and are only used to explain the present invention. They are not intended to limit the scope of the present invention. For those skilled in the art, other implementation methods can be easily made by substitution or modification based on the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.
Claims
1. An InDel molecular marker located on chromosome 5 associated with the regeneration capacity of alfalfa plant height after cutting, characterized by: The nucleotide sequence of the InDel molecular marker is shown in SEQ ID NO.4 and SEQ ID NO.
5. This molecular marker is an insertion / deletion fragment TATTACCCTGTTGAAGAACTCAGAT on chromosome 5 of alfalfa. The primer pair sequence for amplifying the InDel molecular marker is as follows: Ms_Chr5_76562683-F: TATAATCCGTCTCATTCTATAAAATAAATCT; Ms_Chr5_76562683-R: AATTTATGGACGCACACTTTTGAT.
2. To test the application of the primer pair of the InDel molecular marker described in claim 1 in molecular marker-assisted breeding of alfalfa.
3. The application according to claim 2, characterized in that, The InDel molecular marker is used to identify or assist in identifying the regenerative capacity of alfalfa plants after mowing.
4. A method for identifying the regeneration ability of alfalfa plants after cutting, characterized in that, The method includes the following steps: (1) Extract genomic DNA from alfalfa to be tested; (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the primer pair of the InDel molecular marker described in claim 1, and perform electrophoresis detection and / or sequencing on the PCR amplification products; (3) The determination is based on the electrophoresis bands and / or sequencing results of step (2), and the specific criteria are as follows: PCR amplification was performed using primers Ms_Chr5_76562683-F and Ms_Chr5_76562683-R. If the PCR amplification product contained only one characteristic band of 285 bp as shown in SEQ ID NO.4, then the alfalfa was of a type with strong plant height regeneration ability. If there was both one characteristic band of 285 bp as shown in SEQ ID NO.4 and one characteristic band of 260 bp as shown in SEQ ID NO.5, then the alfalfa was of a type with weak plant height regeneration ability.
5. A kit for identifying the regeneration capacity of alfalfa plant height after cutting, characterized in that, The kit contains primer pairs with the InDel molecular marker as described in claim 1.
6. The application of the kit according to claim 5 in identifying the genotype of plant height regeneration ability after alfalfa cutting.
7. The application according to claim 6, characterized in that, The method for identifying the genotype of plant height regeneration ability after alfalfa cutting using the aforementioned kit is as follows: (1) Extract genomic DNA from alfalfa to be tested; (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the primer pair of the InDel molecular marker described in claim 1; (3) Perform electrophoresis and / or sequencing on the PCR amplification products. If the PCR amplification product has only one characteristic band of 285 bp as shown in SEQ ID NO.4, then alfalfa is a homozygous plant with a high regeneration capacity genotype; if the PCR amplification product has both one characteristic band of 285 bp as shown in SEQ ID NO.4 and one characteristic band of 260 bp as shown in SEQ ID NO.5, then alfalfa is a heterozygous plant with a high regeneration capacity but a low regeneration capacity genotype.