SNP molecular marker related to cottonseed oil content and application thereof
By developing SNP molecular markers on chromosome D12 of the cotton genome, the problem of delayed phenotypic identification in high-oil-yield breeding was solved, enabling early and efficient screening and breeding, and significantly improving cotton breeding efficiency and economic benefits.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-05-06
- Publication Date
- 2026-06-05
AI Technical Summary
The lack of effective molecular markers in existing technologies for identifying and screening cotton germplasm resources with high oil content has led to high oil breeding relying on phenotypic identification at field maturity, resulting in long breeding cycles and low efficiency.
A SNP molecular marker located at position 49859419 on chromosome D12 of the cotton genome was developed for detecting cotton genotype. Cotton individuals with genotype GG had significantly higher oil content than those with GC and CC genotypes, providing a method for identifying and screening high oil content.
Early DNA identification significantly shortens the breeding cycle, improves selection efficiency, rapidly eliminates low-oil genotypes, promotes the breeding of new cotton varieties with high oil content, and enhances the economic benefits of cotton planting.
Smart Images

Figure CN122146929A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of cotton biotechnology, and in particular to SNP molecular markers related to cottonseed oil content and their applications. Background Technology
[0002] Cotton is the world's most important natural fiber crop and a vital economic crop in my country, significantly impacting national economic development and farmers' income. Fiber accounts for 13.3% of cotton's total biomass, cottonseed for 20%, and cotton stalks for 66.7%. Cottonseed oil is rich in unsaturated fatty acids such as linoleic acid and linolenic acid, which help lower cholesterol levels. Cottonseed meal and cotton stalks are rich in crude protein and minerals such as calcium and iron, with nutritional components superior to wheat, rice, and corn stalks, making them excellent feed sources. Therefore, fully exploring and utilizing the added value of cottonseed and cotton stalks will not only significantly increase cotton production value but also alleviate the pressure of my country's ever-increasing demand for high-quality edible oil and feed. With the adjustment of the planting structure and supply-side structural reform, the cultivation of high-oil and other specialized cotton varieties has become an important task to meet the needs of diversified industrial development.
[0003] Statistics show that my country's annual cotton planting area is approximately 45 million mu (about 3 million hectares), producing over 8 million tons of cottonseed and 2 million tons of cottonseed oil annually, providing abundant vegetable oil resources. Research has found that cotton kernels can have an oil content as high as 40%, while the oil content of mainstream cotton varieties is typically below 30%, indicating significant room for improvement. High-oil-content varieties are relatively rare. Furthermore, cottonseed oil is rich in oleic acid, linoleic acid, and palmitic acid, with oleic acid and linoleic acid content approaching 80%, and linoleic acid content reaching as high as 50%, exhibiting significant health benefits. Developing high-oil-content cotton varieties to increase cottonseed oil yield and utilization will significantly alleviate the pressure of insufficient self-sufficiency in high-quality edible oil in my country, yielding substantial social benefits.
[0004] In the study of the molecular mechanisms of cottonseed oil content, genes such as Gh13LPAAT5, GhPEPC2, GhACCase, GhWRI1a, GhGAPT, and GhCIPK are involved in cottonseed oil synthesis, while GhPRXR is involved in cottonseed oil accumulation. Regarding variety breeding, there are currently no dedicated regional experimental groups for high-oil-content varieties in China. Our team, through hybridization, created 22 progeny materials with oil content exceeding 30% and good overall traits, providing a material basis for high-oil-content cotton breeding.
[0005] The development of molecular markers is beneficial for genetic selection of traits at the chromosome level, especially single nucleotide polymorphism (SNP) markers, which are numerous and highly polymorphic. In recent years, with the continuous advancement of sequencing technology, the detection cost, reliability, and timeliness of SNPs have been developing in a way that is conducive to research, making it possible for breeding technology to break gene linkage and simultaneously improve multiple traits. Summary of the Invention
[0006] The purpose of this invention is to provide SNP molecular markers related to cottonseed oil content and their applications, in order to solve the problems existing in the prior art.
[0007] To achieve the above objectives, the present invention provides the following solution: One of the technical solutions of the present invention is an SNP molecular marker related to the oil content of cottonseed. The SNP molecular marker is located at the 49859419th base of chromosome D12 of the cotton genome, which is the 51st position of the nucleotide sequence shown in SEQ ID NO.1, and the base at this site is C or G.
[0008] The second technical solution of the present invention, wherein the SNP molecular marker is used in any of the following applications: (1) Identify or screen cotton germplasm resources with high oil content; (2) Molecular marker-assisted breeding of cotton with high oil content; (3) Prepare products for identifying or screening cotton with high oil content.
[0009] The third technical solution of the present invention is a method for identifying or screening cotton with high oil content, comprising the following steps: Detect the genotype of the SNP molecular markers in the genome of the cotton sample; The oil content of cotton individuals with genotype GG was significantly higher than that of individuals with genotypes GC and CC. The oil content of cotton individuals with the GC genotype was significantly higher than that of individuals with the CC genotype.
[0010] The fourth technical solution of the present invention is a method for breeding new cotton varieties with high oil content, which involves detecting the genotype of the SNP molecular marker in the genome of the cotton to be tested, and selecting cotton individuals with the genotype GG for breeding.
[0011] Based on the above technical solution, the present invention has the following technical effects: This invention provides an SNP molecular marker D12_49859419 related to cottonseed oil content and its application. This marker is located in the stably expressed QTL interval qOC-D12-1 on chromosome D12 and contributes up to 10.78% to the phenotypic variation in cottonseed oil content. The oil content of the GG homozygous genotype lines is significantly higher than that of the CC homozygous genotype lines, with a difference of approximately 1.2 percentage points, accurately and stably reflecting the oil content of cottonseed. Using this marker, high-throughput genotyping can be performed by extracting DNA at the cotton seedling stage, eliminating the need to wait for field maturity and harvest to determine seed oil content. This solves the technical bottleneck of delayed phenotypic identification and reliance on field performance at maturity in high-oil-content breeding, significantly shortening the breeding cycle and improving selection efficiency. The operation method is simple and suitable for early screening of large-scale breeding populations, enabling rapid elimination of low-oil-content genotype plants and accelerating the breeding process of new cotton varieties with high oil content. This invention is beneficial for fully exploring the value of cottonseed oil, improving the overall economic benefits of cotton planting, and has important social and economic significance for alleviating the pressure on the supply of high-quality vegetable oil in my country. Attached Figure Description
[0012] Figure 1 The difference in oil content among different genotypes of D12_49859419. Detailed Implementation
[0013] Unless otherwise specified, the technical solutions described in this invention are all conventional solutions in the field, and the reagents or raw materials used are all purchased from commercial channels or are publicly available unless otherwise specified.
[0014] This invention provides an SNP molecular marker related to the oil content of cottonseed. The SNP molecular marker is located at position 49859419 of chromosome D12 of the cotton genome, which is position 51 of the nucleotide sequence shown in SEQ ID NO.1. The base at this position is C or G.
[0015] In some specific implementations, the SNP molecular markers include genotypes GG, GC, and CC.
[0016] This invention also provides the application of the SNP molecular marker in any of the following: (1) Identify or screen cotton germplasm resources with high oil content; (2) Molecular marker-assisted breeding of cotton with high oil content; (3) Prepare products for identifying or screening cotton with high oil content.
[0017] In some specific implementations, the cotton is Jifeng 914, Shizao 1, or a offspring bred from either of these as parents.
[0018] This invention also provides a method for identifying or screening cotton with high oil content, comprising the following steps: Detect the genotype of the SNP molecular markers in the genome of the cotton sample; The oil content of cotton individuals with genotype GG was significantly higher than that of individuals with genotypes GC and CC. The oil content of cotton individuals with the GC genotype was significantly higher than that of individuals with the CC genotype.
[0019] In some specific implementations, the cotton is Jifeng 914, Shizao 1, or a offspring bred from either of these as parents.
[0020] This invention also provides a method for breeding new cotton varieties with high oil content, which involves detecting the genotype of the SNP molecular marker in the genome of the cotton to be tested, and selecting cotton individuals with the genotype GG for breeding.
[0021] Example 1 The discovery of SNPs 1. A cotton F2 segregating population (experimental population) was constructed using Jifeng 914 as the female parent and Shizao 1 as the male parent, with 465 individual plants. The oil content of the parents and 465 F3 seeds (seeds harvested from F2 individual plants) was investigated using nuclear magnetic resonance.
[0022] 2. Extract DNA from 200 cotton seedlings and analyze it using the CTAB method (Paterson AH, Brubaker CL, Wendel J F. A rapid method for extraction of cotton (Gossypiums pp.) genomie DNA suitable for RFLP and PCR analysis. Plant MOl Rep, 1993, 11: 122-127).
[0023] 3. Development of SNP tags using GBTS. Following the method of Xu et al. (Xu Y, Yang QN, Zheng HJ, et al. Genotyping by target sequencing (GBTS) and its applications [J]. Sci AgricSin, 2020, 53: 2983-3004.), SNP detection was performed on DNA.
[0024] 4. Construct a high-density genetic map. Select SNPs with polymorphism among parents and in the population, and construct a genetic map using MSTMap (the minimum spanning tree map, version update 2015) software, with LOD values ranging from 4.0 to 20.0.
[0025] 5. QTL Mapping. Combining genetic maps and seed oil content data, QTLs were located using the ICIM program in QTLIciMapping 4.0 software, with parameters Step=1cM, PIN=0.001, and LOD values determined by 1000 iterations. Results showed that qOC-D12-1 was stably expressed, with a contribution rate exceeding 10%.
[0026] 6. Identification of key SNPs. Based on QTL mapping results, loci with high LOD values and high contribution rates were selected. The genotypes of SNPs within these loci in the parents and population were determined, and significant differences between different genotypes were analyzed in conjunction with seed oil content data.
[0027] 7. A high-density genetic map containing 7635 SNPs was constructed. An oil content QTL qOC-D12-1 was located at position 85.5-88.5 cM on chromosome D12. This QTL contributed 10.78% to the phenotypic variation. The enhancing gene was derived from the maternal parent Jifeng 914 (Table 1).
[0028] Table 1. Information related to the located oil content QTL
[0029] 8. One SNP marker, D12_49859419, was found in the located QTL interval. It is located at position 51 (TM-1 V2.1) of the nucleotide sequence shown in SEQ ID NO.1, and the base at this position is C or G. The genotype of the parent Jifeng 914 is GG, and the genotype of the parent Shizao 1 is CC.
[0030] SEQ ID NO.1:TTTTATGAAGTACATCACAGTAATTGATAAAACGTGGTTCGCTGTCTTAA C[G] TCAAGGCTCACTGTGGTCTTAGTCTAGTCTAGTCTAGTGTAGCCACGTGC.
[0031] Table 2 Base types of SNP sites in parents
[0032] 9. The genotype of this SNP marker in Jifeng 914 was designated GG, and the genotype in Shizao 1 was designated CC. Based on the parental genotypes of these two markers, the population was divided into three groups: the homozygous GG group (genotype of SNP marker in Jifeng 914) and the CC group (genotype of SNP marker in Shizao 1), and the heterozygous GC group. A significant difference analysis of the phenotypes among the three groups was performed (Table 3). Figure 1 It can be seen that the oil content of the GG group is significantly higher than that of the CC group (by about 1.2%). This indicates that the SNP marker (D12_49859419) in the qOC-D12-1 interval is effective in identifying the oil content of cottonseed.
[0033] Table 3. Differences in oil content among different genotypes
[0034] Note: a, b, and c are significant at the 0.05 level.
[0035] Example 2 SNP verification DNA was extracted from the remaining 265 lines in the F3 population. SNP markers were developed using GBTS technology, and the SNP genotypes at the D12_49859419 locus were statistically analyzed. The plants were then grouped according to genotype, and the significant differences in oil content among different genotypes were analyzed. The results showed that among the remaining 265 individual plants, 178 lines were homozygous for the GG genotype at the D12_49859419 locus, 47 lines were homozygous for the CC genotype, and 40 lines were heterozygous for the GC genotype. Analysis of the oil content data for the three genotypes revealed that the oil content of the GG homozygous genotype population was significantly higher than that of the CC homozygous genotype population (Table 4), similar to the results in Table 3, demonstrating that D12_49859419 plays a significant role in identifying cottonseed oil content.
[0036] Table 4. Significance analysis of the validation data of SNPs
[0037] Note: a, b, and c indicate that the differences are significant at the 0.05 level.
[0038] 8. The Value of SNPs. Improving oil content is an urgent goal in cotton breeding and production, and it represents a technical bottleneck in existing breeding methods. D12_49859419 can assist in identifying the oil content of cottonseeds, possessing significant application value and playing a crucial role in accelerating the breeding of new high-oil cotton varieties and improving the economic benefits of cotton.
[0039] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively describe all embodiments here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.
Claims
1. A SNP molecular marker related to cottonseed oil content, characterized in that, The SNP molecular marker is located at position 49859419 of chromosome D12 in the cotton genome, which is position 51 of the nucleotide sequence shown in SEQ ID NO.1, and the base at this position is C or G.
2. The SNP molecular marker according to claim 1, characterized in that, The SNP molecular markers include genotypes GG, GC, and CC.
3. The application of the SNP molecular marker of claim 1 in any of the following: (1) Identify or screen cotton germplasm resources with high oil content; (2) Molecular marker-assisted breeding of cotton with high oil content; (3) Prepare products for identifying or screening cotton with high oil content.
4. The application according to claim 3, characterized in that, The cotton varieties mentioned are Jifeng 914, Shizao 1, or offspring bred from either of these two varieties.
5. A method for identifying or screening cotton with high oil content, characterized in that, Includes the following steps: Detecting the genotype of the SNP molecular marker described in claim 1 in the genome of the cotton sample; The oil content of cotton individuals with genotype GG was significantly higher than that of individuals with genotypes GC and CC. The oil content of cotton individuals with the GC genotype was significantly higher than that of individuals with the CC genotype.
6. The method according to claim 5, characterized in that, The cotton varieties mentioned are Jifeng 914, Shizao 1, or offspring bred from either of these two varieties.
7. A method for breeding new cotton varieties with high oil content, characterized in that, The genotype of the SNP molecular marker described in claim 1 in the genome of the cotton to be tested is detected, and cotton individuals with the genotype GG are selected for breeding.