Methods for cell reprogramming

Abstract

The present invention relates to methods of cell reprogramming. The present invention provides a computer-implemented method for determining transcription factors required for reprogramming a source cell into a cell exhibiting at least one characteristic of a target cell type, comprising: determining gene differential expression in the source cell and the target cell type; determining a network score for each transcription factor (TF) in each of the source cell type and the target cell type based on the gene differential expression on at least one network; and ranking the TFs based on a combination of a ranking list of the TFs ordered according to the network score and a ranking list of the TFs ordered according to the gene differential expression information; wherein the lowest ranked TFs are predicted to be capable of facilitating reprogramming of the source cell into a cell exhibiting at least one characteristic of the target cell type; thereby identifying a set of transcription factors for reprogramming the source cell into a cell exhibiting at least one characteristic of the target cell type.

Description

[0001] This application is a divisional application of Chinese patent application No. 201680081279.8, filed on December 23, 2016, entitled "Cell Reprogramming".

[0002] This application claims priority to Australian provisional application AU 2015905349, the full disclosure of which is incorporated herein by reference. Technical Field

[0003] This invention relates to methods and compositions for converting one cell type into another. More specifically, this invention relates to the transdifferentiation of cells into different cell types. Background Technology

[0004] Cell-based regenerative therapies require the generation of specific cell types to replace tissues damaged by injury, disease, or age. Embryonic stem cells (ESCs) have the potential to differentiate between each cell type in the human body and have therefore been extensively studied as a source for replacement therapy. However, ESCs cannot be derived in a patient-specific manner because they are established from cultured blastocysts. Therefore, immune rejection and ethical issues are major obstacles preventing the clinical application of ESC technology, particularly human ESC technology.

[0005] Cell replacement therapy has the potential to rapidly generate a variety of therapeutically important cell types directly from readily accessible tissues in a person, such as skin or blood. These immune-matched cells also reduce the risk of rejection after transplantation. Furthermore, these cells exhibit lower tumorigenicity because they are terminally differentiated.

[0006] Transdifferentiation, the process of converting from one cell type to another without passing through a pluripotent state, holds great promise for regenerative medicine but has not yet been reliably applied. While it is possible to convert the phenotype of one somatic cell type to another, the necessary elements for this conversion are difficult to identify and, in most cases, unknown. Among other things, the identification of factors that directly reprogram cell type identity is currently limited by the cost of exhaustive experimental testing of seemingly credible sets of factors, making it an inefficient and non-scalable approach.

[0007] A new and / or improved method is needed to identify the factors required to convert one cell type to another. Cells and cell populations for therapeutic applications are also needed.

[0008] Any reference to prior art in this specification is not an admission or implication that such prior art forms part of the general knowledge of any jurisdiction, or that such prior art can reasonably be expected to be understood as being related to and / or combined with other prior art known to those skilled in the art. Summary of the Invention

[0009] This invention relates to a predictive framework that combines gene expression data with regulatory network information to predict the reprogramming factors necessary to induce cell conversion (i.e., to convert source cells into cells exhibiting characteristics of a target cell type). This framework correctly predicts transcription factors used in known transdifferentiation as well as those experimentally validated for previously unknown transdifferentiation. The invention also relates to methods and compositions for directly reprogramming source cells (i.e., transdifferentiation or cell reprogramming) into cells exhibiting characteristics of a target cell type.

[0010] This invention provides a method for determining transcription factors required to convert source cells into cells exhibiting at least one characteristic of a target cell type, the method comprising the following steps: - Identify differential gene expression in the source cells and these target cell types; - Based on differential gene expression on at least one network, determine the network score for each transcription factor (TF) in each of the source cells and these target cell types, wherein the network contains information on interactions that affect gene expression; - These TFs are sorted based on a combination of network scores and differential gene expression information to identify a set of transcription factors that can transform source cells into cells exhibiting at least one characteristic of the target cell type.

[0011] Preferably, the gene score of each differentially expressed gene in the source cell and these target cell types is determined.

[0012] Preferably, the gene score is a combination of the logarithmic fold change in differential expression and an adjusted P-value.

[0013] Preferably, the gene score is calculated using a tree-based method, preferably against the background.

[0014] Preferably, the network contains information on protein-DNA interactions, protein-DNA interactions, and / or protein-RNA interactions.

[0015] Preferably, the network contains information about the interactions between transcription factors and gene regulatory regions.

[0016] Preferably, the regulatory region is the promoter region of a gene.

[0017] Preferably, the method further includes a step of collecting expression data for each gene before determining gene scores.

[0018] Preferably, the method further includes the step of removing transcriptional redundant TFs from the sorted list for each cell type.

[0019] This invention provides a method for determining transcription factors required to convert source cells into cells exhibiting at least one characteristic of a target cell type, the method comprising the following steps: - Determine the gene score for each differentially expressed gene in the source cell and these target cell types; - The network score of each transcription factor (TF) in each of the source and target cell types is determined by performing a weighted summation of the scores of each gene on at least one network, where the network contains information about interactions that affect gene expression; - These TFs are ranked based on a combination of gene and network scores; and - Based on a comparison of sorted lists for each cell type, identify a set of transcription factors used to transform source cells into cells exhibiting at least one characteristic of the target cell type.

[0020] Preferably, the gene score is a combination of the logarithmic fold change in differential expression and an adjusted p-value. The gene score can be calculated using tree-based methods or Bayesian clustering.

[0021] Preferably, the network contains information on protein-DNA interactions, protein-DNA interactions, and protein-RNA interactions. Typically, the network contains information on interactions between transcription factors and gene regulatory regions. Typically, the regulatory region is the promoter region of a gene.

[0022] Preferably, the method further includes a step of collecting expression data for each gene before determining gene scores.

[0023] Preferably, the method further includes the step of removing transcriptional redundant TFs from the sorted list for each cell type.

[0024] This invention provides a method for determining transcription factors required to convert source cells into cells exhibiting at least one characteristic of a target cell type, the method comprising the following steps: - Collect expression data for each gene in the source cell type and the target cell type; - Calculate the differential expression of each gene in each sample against a tree-based background, and then combine the logarithmic fold change and the adjusted p-value to obtain the gene score; - The network score for each TF is calculated by performing a weighted summation of gene scores on at least one subnet centered on each TF; - These TFs are ranked based on a combination of gene and network scores; - Based on comparisons from sorted lists for each cell type, calculate the set of transcription factors used for conversion between any two cell types; and optionally... - Remove redundant transcriptional TFs from these lists.

[0025] This allows us to identify the transcription factors required to convert the source cell type into the target cell type.

[0026] This invention provides a method for determining transcription factors required to convert source cells into cells exhibiting at least one characteristic of a target cell type, the method comprising the following steps: - Collect expression data for each gene (x) in each sample (s); - Calculate the differential expression of each gene in each sample against a tree-based background, then perform a logarithmic fold change ( ) and adjusted P-value ( The combination of these elements yields the gene score. ).

[0027] - Each TF is calculated by performing a weighted summation of gene scores on two distinct subnets centered on each TF. x Network score () ); - based on and The combinations of scores are sorted into TFs; - Based on comparisons from sorted lists for each cell type, calculate the set of transcription factors used for conversion between any two cell types.

[0028] - Remove redundant transcriptional TFs from these lists.

[0029] This allows us to identify the transcription factors required to convert the source cell type into the target cell type.

[0030] Preferably, the identified set of transcription factors are those that affect the expression of at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the genes expressed in the target cell type.

[0031] The source cell type and target cell type can be any cell type described in the FANTOM5 dataset, or any cell type described herein (including Tables 4a and 4b).

[0032] Typically, this subnet is a gene expression database that has already been used with MARA or the STRING database (referred to in this paper as ( and (Although any subnet mentioned herein containing information relating to the interactions of transcription factors that affect gene expression may be used.)

[0033] Preferably, the method further includes the step of creating a cell transformation landscape by arranging the cell types on a 2D plane based on the required TFs for the cell types and adding height based on the average coverage of the required genes (directly regulated by the selected TFs).

[0034] Preferably, any method described herein further includes the step of creating a cell-transformation landscape by arranging the cell types on a 2D plane based on the required TFs for the cell types and adding height based on the average coverage of the required genes (directly regulated by the selected TFs).

[0035] In any of the methods of the present invention described above, the method further includes the step of increasing the amount of transcription factors in the source cell type, which are identified as necessary to convert the source cell type into the target cell type.

[0036] This invention provides a method for identifying reagents that can be used to promote the conversion of a source cell type to a target cell type, the method comprising the following steps: - Identify one or more transcription factors required to convert a source cell type to a target cell type using any of the methods described herein; - Screen one or more candidate reagents for their ability to increase the amount of one or more transcription factors required to convert a source cell type to a target cell type; The reagent that increases the amount of one or more transcription factors is one that can be used to promote the conversion of the source cell type to the target cell type.

[0037] Preferably, the candidate reagent can be any compound that is desired to be tested, including but not limited to proteins (such as antibodies or fragments thereof or antibody mimics), peptides, nucleic acids (including RNA, DNA, antisense oligonucleotides, and peptide nucleic acids), carbohydrates, organic compounds, small molecules, natural products, library extracts, and body fluids. The candidate compound can be part of a library, such as a collection of compounds containing variations or modifications.

[0038] The present invention also provides a method for reprogramming a source cell, the method comprising increasing the expression of one or more transcription factors or variants thereof in the source cell, wherein the source cell is reprogrammed to exhibit at least one characteristic of a target cell, wherein: - The source cells are selected from the following group, which consists of the following: dermal fibroblasts, epidermal keratinocytes, embryonic stem cells, monocytes, or cardiac fibroblasts; - The target cells are selected from the following group, which consists of: chondrocytes, hair follicles, CD4+ T cells, CD8+ T cells, NK cells, hematopoietic stem cells (HSCs), adipose mesenchymal stem cells (MSCs), bone marrow mesenchymal stem cells (MSCs), oligodendrocytes, oligodendrocyte precursors, skeletal muscle cells, smooth muscle cells, and fetal cardiomyocytes; and These transcription factors are one or more of those listed in Tables 4a and 4b.

[0039] This invention provides a method for reprogramming source cells, the method comprising increasing the protein expression of one or more transcription factors or variants thereof in the source cells, wherein the source cells are reprogrammed to exhibit at least one characteristic of target cells, wherein: - The source cells are selected from the following group, which consists of the following: dermal fibroblasts, epidermal keratinocytes, embryonic stem cells, pluripotent stem cells, mesenchymal stem cells, monocytes, or cardiac fibroblasts; - The target cells are selected from the following group, which consists of: chondrocytes, hair follicles, CD4+ T cells, CD8+ T cells, NK cells, hematopoietic stem cells (HSCs), mesenchymal stem cells (MSCs), adipose-derived MSCs, bone marrow MSCs, oligodendrocytes, oligodendrocyte precursors, skeletal muscle cells, smooth muscle cells, fetal cardiomyocytes, epithelial cells, endothelial cells, keratinocytes, and astrocytes; and These transcription factors are one or more of those listed in Tables 4a and 4b.

[0040] This invention provides a method for generating cells from source cells that exhibit at least one characteristic of target cells, the method comprising: - Increase the amount of one or more transcription factors or their variants in the source cells; and - The source cells are cultured for a sufficient time under conditions that allow them to differentiate into target cells; thereby generating cells from the source cells that exhibit at least one characteristic of the target cells, wherein: - The source cells are selected from the following group, which consists of the following: dermal fibroblasts, epidermal keratinocytes, embryonic stem cells, pluripotent stem cells, mesenchymal stem cells, monocytes, or cardiac fibroblasts; - The target cells are selected from the following group, which consists of: chondrocytes, hair follicles, CD4+ T cells, CD8+ T cells, NK (natural killer) cells, hematopoietic stem cells (HSCs), mesenchymal stem cells (MSCs), adipose-derived MSCs, bone marrow MSCs, oligodendrocytes, oligodendrocyte precursors, skeletal muscle cells, smooth muscle cells, fetal cardiomyocytes, epithelial cells, endothelial cells, keratinocytes, and astrocytes; and These transcription factors are one or more of those listed in Tables 4a and 4b.

[0041] Preferably, the method increases the amount of one or more transcription factors or their variants in the source cells by contacting the source cells with a reagent that increases the expression of transcription factors.

[0042] Preferably, the reagent is selected from the group consisting of: nucleotide sequences, proteins, aptamers and small molecules, ribosomes, RNAi reagents and peptide-nucleic acid (PNA) and their analogues or variants.

[0043] Preferably, the amount of one or more transcription factors is increased by introducing at least one nucleic acid sequence encoding a transcription factor protein listed in Tables 4a and 4b.

[0044] Preferably, the source cells are dermal fibroblasts, and wherein... (a) The target cells are chondrocytes, and the transcription factors are any one or more of BARX1, PITX1, SMAD6, FOXC1, SIX2, and AHR; (b) The target cell is a hair follicle, and the transcription factors are any one or more of ZIC1, PRRX2, RARB, VDR, FOXD1, and CREB3; (c) The target cell is a CD4+ T cell, and the transcription factors are any one or more of RORA, LEF1, JUN, FOS, and BACH2; (d) The target cell is a CD8+ T cell, and the transcription factors are any one or more of RORA, FOS, SMAD7, JUN, and RUNX3; (e) The target cell is an NK cell, and the transcription factors are any one or more of RORA, SMAD7, FOS, JUN, and NFATC2; (f) The target cell is an HSC, and the transcription factors are any one or more of MYB, GATA1, GFI1, and GFI1B; (g) The target cells are adipose MSCs, and the transcription factors are any one or more of NOTCH3, HIC1, ID1, ESRRA, IR1, SIX5, SREBF1, and SNAI2; (h) The target cells are MSCs of the bone marrow, and the transcription factors are any one or more of SIX1, ID1, HOXA7, FOXC2, HOXA9, MAFB, and IRX5; (i) The target cell is an oligodendrocyte precursor, and the transcription factors are any one or more of NKX2-1, ANKRD1, FOXA2, CDH1, ZFP42, IGF1, ICAM1, and FOS; (j) The target cell is a skeletal muscle cell, and the transcription factors are any one or more of MYOG, HIC1, MYOD1, FOXD1, PITX3, SIX2, HOXA7, and JUNB; (k) The target cell is a smooth muscle cell, and the transcription factors are any one or more of GATA6, LIF, JUNB, CREB3, MEIS1, and PBX1; (l) The target cells are fetal cardiomyocytes, and the transcription factors are any one or more of BMP10, GATA6, TBX5, FHL2, NKX2-5, HAND2, GATA4, and PPARGC1A. (m) The target cell is an astrocyte, and these transcription factors are any one or more of SOX2, SOX9, ARNT2, E2F5, PBX1, SMAD1, and RUNX2; (n) The target cell is an epithelial cell, and the transcription factors are any one or more of FOS, DBP, HES1, FOXA2, ESRRA, CDH1, FOXQ1, and PAX6; (o) The target cells are endothelial cells, and these transcription factors are any one or more of SOX17, SMAD1, TAL1, IRF1, TCF7L1, MXD4, and JUNB; or (p) The target cell is a keratinocyte, and the transcription factors are any one or more of FOXQ1, SOX9, MAFB, CDH1, FOS, and REL.

[0045] Preferably, the source cell is an epidermal keratinocyte, and wherein... (a) The target cells are chondrocytes, and the transcription factors are any one or more of BARX1, PITX1, SMAD6, TGFB3, FOXC1, and SIX2; (b) The target cell is a hair follicle, and the transcription factors are any one or more of RUNX1T1, ZIC1, PRRX1, MSX1, EBF1, FOXD1, and RUNX2; (c) The target cell is a CD4+ T cell, and the transcription factors are any one or more of RORA, LEF1, JUN, FOS, and NR3C1; (d) The target cell is a CD8+ T cell, and the transcription factors are any one or more of RORA, FOS, SMAD7, JUN, and RUNX3; (e) The target cell is an NK cell, and the transcription factors are any one or more of RORA, SMAD7, FOS, JUN, NFATC2, and RUNX3; (f) The target cell is an HSC, and the transcription factors are any one or more of MYB, GATA1, GFI1, and GFI1B; (g) The target cells are adipose MSCs, and the transcription factors are any one or more of TWIST1, HIC1, ID1, MSX1, IRF1, HOXB7, SNAI2, and E2F1; (h) The target cells are MSCs of the bone marrow, and the transcription factors are any one or more of SIX1, TWSIT1, ID1, HMOX1, FOXC2, and HOXA7; (i) The target cell is an oligodendrocyte precursor cell, and the transcription factors are any one or more of NKX2-1, ANKRD1, ZFP42, FOS, IGF1, ICAM1, FOXA2, and CDH1; (j) The target cell is a skeletal muscle cell, and the transcription factors are any one or more of MYOG, MYOD1, RF1, PITX3, HOXA7, FOXD1, and SOX8; (k) The target cell is a smooth muscle cell, and these transcription factors are any one or more of IRF1, GATA6, LIF, and MEIS1; (l) The target cell is an endothelial cell, and these transcription factors are any one or more of SOX17, TAL1, SMAD1, IRF1, TCF7L1, and HOXB7; or (m) The target cell is an epithelial cell, and the transcription factors are any one or more of NOTCH1, HR, DBP, OTX1, ESRRA, FOXQ1, PAX6, and IRX5.

[0046] Preferably, the source cell is an embryonic stem cell, and wherein... (a) The target cells are chondrocytes, and the transcription factors are any one or more of BARX1, PITX1, SMAD6, and NFKB1; (b) The target cell is a hair follicle, and the transcription factors are any one or more of TWIST1, ZIC1, NR2F2, PRRX1, NFKB1, and AHR; (c) The target cell is a CD4+ T cell, and the transcription factors are any one or more of RORA, LEF1, JUN, FOS, and BACH2; (d) The target cell is a CD8+ T cell, and the transcription factors are any one or more of RORA, FOS, SMAD7, and JUN; (e) The target cell is an NK cell, and the transcription factors are any one or more of RORA, SMAD7, FOS, JUN, and NFATC2; (f) The target cell is an HSC, and the transcription factors are any one or more of MYB, IL1B, KLF1, GATA1, GFI1, GFI1B, and NFE2; (g) The target cells are adipose MSCs, and the transcription factors are any one or more of TWIST1, SNAI2, IRF1, MXD4, NFKB1, MSX1, HOXB7, and ESRRA; (h) The target cells are MSCs of the bone marrow, and the transcription factors are any one or more of IRF1, RUNX1, CEBPB, AHR, FOXC2, and HOXA9; (i) The target cell is an oligodendrocyte precursor cell, and the transcription factors are any one or more of NKX2-1, ANKRD1, FOXA2, LMO3, FOS, IGF1, ICAM1, and CDH1; (j) The target cell is a skeletal muscle cell, and the transcription factors are any one or more of MYOG, IRF1, MYOD1, FOXD1, NFKB1, JUNB, and HOXA7; (k) The target cell is a smooth muscle cell, and these transcription factors are any one or more of IRF1, NFKB1, JUNB, FOSL2, GATA6, and MEIS1; (l) The target cell is an astrocyte, and the transcription factors are any one or more of IRF1, SOX9, ARNT2, PAX6, SNAI2, RUNX2, and SOX5; (m) The target cell is an endothelial cell, and these transcription factors are any one or more of SOX17, SMAD1, TAL1, HOXB7, JUNB, NFKB1, and IRF1; (n) The target cell is an epithelial cell, and these transcription factors are any one or more of MYC, IL1B, FOS, NFKB1, ESRRA, FOXQ1, IRF1, and PAX6; or (o) The target cells are keratinocytes, and the transcription factors are SOX9, NFKB1, MYC, NR2F2, FOSL2, FOSL1 and AHR.

[0047] Preferably, the source cell is a monocyte, and wherein... (a) The target cell is an HSC, and the transcription factors are any one or more of MYB, IL1B, GATA1, GFI1, and GFI1B.

[0048] Preferably, the source cell is a cardiac fibroblast, and the target cell is a fetal cardiomyocyte, and the transcription factors are any one or more of BMP10, GATA6, TBX5, ANKRD1, HAND1, PPARGC1A, NKX2-5, and GATA4.

[0049] Preferably, the source cell is a mesenchymal stem cell, and the target cell is an astrocyte, and the transcription factors are any one or more of SOX2, SOX9, ARNT2, MYBL2, POU3F2, E2F1, and HMGB2.

[0050] Preferably, the source cell is a pluripotent stem cell, and wherein... (a) The target cell is an astrocyte, and the transcription factors are any one or more of PAX6, POU3F2, SNAI2, RUNX2, SOX5, E2F5, and HMGB2; (b) The target cell is a keratinocyte, and these transcription factors are any one or more of TP63, TFAP2A, MYC, NFKBIA, SOX9, and NFKB1; or (c) The target cell is an endothelial cell, and the transcription factors are any one or more of SOX17, TAL1, HOXB7, NFKB1, IRF1, SMAD1, and JUNB.

[0051] Preferably, the at least one characteristic of the target cell is the upregulation of any one or more target cell markers and / or changes in cell morphology.

[0052] Preferably, the following markers for target cells include: - Chondrocytes: Production of CD49, CD10, CD9, CD95, integrin α10β1,105 and sulfated glycosaminoglycans (GAG); - Hair follicles: CD200, PHLDA1, and folliculoritol; - CD4+ T cells: CD3, CD4; - CD8+ T cells: CD3, CD8; - NK cells: CD56, CD2; - HSC: CD45, CD19 / 20, CD14 / 15, CD34, CD90; - Adipose MSCs: CD13, CD29, CD90, CD105, CD10, CD45 and their in vitro differentiation into osteoblasts, adipocytes and chondrocytes; - MSCs from bone marrow: CD13, CD29, CD90, CD105, CD10, and in vitro differentiation into osteoblasts, adipocytes, and chondrocytes; - Oligodendrocytes and oligodendrocyte precursors; NG2 and PDGFRα QPCR of Olig2 and Nkx2.2; - Skeletal muscle cells: MyoD, myoblasts, and intermyogenic proteins; - Smooth muscle cells: cardiomyin, smooth muscle α-actin, and smooth muscle myosin heavy chain; - Fetal cardiomyocytes: MEF2C, MYH6, ACTN1, CDH2, and GJA1; - Endothelial cells: PeCAM (CD31), VE-cadherin, and VEGFR2; - Keratinocytes: keratin 1, keratin 14, ubiquitin, and epidermal proteins; - Astrocytes: GFAP, S100B, and ALDH1L1; and - Epithelial cells: cytokeratin 15 (CK15), cytokeratin 3 (CK3), epidermal proteins and connexin 4.

[0053] Preferably, culturing the source cells for a sufficient time under conditions that allow them to differentiate into target cells includes culturing these cells in the relevant culture media shown in Table 9 for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 days.

[0054] Preferably, the method further includes the step of giving the individual a cell exhibiting at least one characteristic of the target cell type.

[0055] The present invention also relates to cells generated according to any of the methods described above that exhibit at least one characteristic of the target cells.

[0056] The present invention also provides a method for reprogramming source cells listed in Tables 4a and 4b, the method comprising increasing the protein expression of transcription factors or variants thereof in the source cells in Tables 4a and 4b, wherein the source cells are reprogrammed to exhibit at least one characteristic of target cells.

[0057] This invention provides a method for reprogramming source cells into cells exhibiting at least one characteristic of target cells, the method comprising: i) providing source cells or a cell population containing source cells; ii) transfecting the source cells with one or more nucleic acids, the nucleic acids comprising a nucleotide sequence encoding one or more transcription factors; iii) culturing the cells or cell population, and optionally monitoring the cells or cell population for at least one characteristic of the target cells, wherein: - The source cells are selected from the following group, which consists of the following: dermal fibroblasts, epidermal keratinocytes, embryonic stem cells, pluripotent stem cells, mesenchymal stem cells, monocytes, or cardiac fibroblasts; - The target cells are selected from the following group, which consists of: chondrocytes, hair follicles, CD4+ T cells, CD8+ T cells, NK cells, hematopoietic stem cells (HSCs), mesenchymal stem cells (MSCs), adipose-derived MSCs, bone marrow MSCs, oligodendrocytes, oligodendrocyte precursors, skeletal muscle cells, smooth muscle cells, fetal cardiomyocytes, epithelial cells, endothelial cells, keratinocytes, and astrocytes; and These transcription factors are one or more of those listed in Tables 4a and 4b.

[0058] In any of the methods of the invention described herein, the source cell is a fibroblast, and (a) The target cells are chondrocytes, and the transcription factors are any one or more of BARX1, PITX1, SMAD6, FOXC1, SIX2, and AHR; (b) The target cell is a hair follicle, and the transcription factors are any one or more of ZIC1, PRRX2, RARB, VDR, FOXD1, and CREB3; (c) The target cell is a CD4+ T cell, and the transcription factors are any one or more of RORA, LEF1, JUN, FOS, and BACH2; (d) The target cell is a CD8+ T cell, and the transcription factors are any one or more of RORA, FOS, SMAD7, JUN, and RUNX3; (e) The target cell is an NK cell, and the transcription factors are any one or more of RORA, SMAD7, FOS, JUN, and NFATC2; (f) The target cell is an HSC, and the transcription factors are any one or more of MYB, GATA1, GFI1, and GFI1B; (g) The target cells are adipose MSCs, and the transcription factors are any one or more of NOTCH3, HIC1, ID1, ESRRA, IR1, SIX5, SREBF1, and SNAI2; (h) The target cells are MSCs of the bone marrow, and the transcription factors are any one or more of SIX1, ID1, HOXA7, FOXC2, HOXA9, MAFB, and IRX5; (i) The target cell is an oligodendrocyte precursor, and the transcription factors are any one or more of NKX2-1, ANKRD1, FOXA2, CDH1, ZFP42, IGF1, ICAM1, and FOS; (j) The target cells are skeletal muscle cells, and the transcription factors are MYOG, HIC1, MYOD1, FOXD1, PITX3, SIX2, HOXA7, and JUNB. (k) The target cell is a smooth muscle cell, and the transcription factors are any one or more of GATA6, LIF, JUNB, CREB3, MEIS1, and PBX1; (l) The target cells are fetal cardiomyocytes, and the transcription factors are any one or more of BMP10, GATA6, TBX5, FHL2, NKX2-5, HAND2, GATA4, and PPARGC1A; (m) The target cell is an astrocyte, and the transcription factors are any one or more of SOX2, SOX9, ARNT2, E2F5, PBX1, SMAD1, and RUNX2.

[0059] (n) The target cell is an epithelial cell, and the transcription factors are any one or more of FOS, DBP, HES1, FOXA2, ESRRA, CDH1, FOXQ1, and PAX6; (o) The target cells are endothelial cells, and these transcription factors are any one or more of SOX17, SMAD1, TAL1, IRF1, TCF7L1, MXD4, and JUNB; or (p) The target cell is a keratinocyte, and the transcription factors are any one or more of FOXQ1, SOX9, MAFB, CDH1, FOS, and REL.

[0060] All of the listed transcription factors can be used in (a) through (p) above. Preferably, the fibroblast is a dermal fibroblast.

[0061] In any of the methods of the invention described herein, the source cell is a keratinocyte, and (a) The target cells are chondrocytes, and the transcription factors are any one or more of BARX1, PITX1, SMAD6, TGFB3, FOXC1, and SIX2; (b) The target cell is a hair follicle, and the transcription factors are any one or more of RUNX1T1, ZIC1, PRRX1, MSX1, EBF1, FOXD1, and RUNX2; (c) The target cell is a CD4+ T cell, and the transcription factors are any one or more of RORA, LEF1, JUN, FOS, and NR3C1; (d) The target cell is a CD8+ T cell, and the transcription factors are any one or more of RORA, FOS, SMAD7, JUN, and RUNX3; (e) The target cell is an NK cell, and the transcription factors are any one or more of RORA, SMAD7, FOS, JUN, NFATC2, and RUNX3; (f) The target cell is an HSC, and the transcription factors are any one or more of MYB, GATA1, GFI1, and GFI1B; (g) The target cells are adipose MSCs, and the transcription factors are any one or more of TWIST1, HIC1, ID1, MSX1, IRF1, HOXB7, SNAI2, and E2F1; (h) The target cells are MSCs of the bone marrow, and the transcription factors are any one or more of SIX1, TWSIT1, ID1, HMOX1, FOXC2, and HOXA7; (i) The target cell is an oligodendrocyte precursor cell, and the transcription factors are any one or more of NKX2-1, ANKRD1, ZFP42, FOS, IGF1, ICAM1, FOXA2, and CDH1; (j) The target cell is a skeletal muscle cell, and the transcription factors are any one or more of MYOG, MYOD1, RF1, PITX3, HOXA7, FOXD1, and SOX8; (k) The target cell is a smooth muscle cell, and these transcription factors are any one or more of IRF1, GATA6, LIF, and MEIS1; (l) The target cells are endothelial cells, and the transcription factors are any one or more of SOX17, TAL1, SMAD1, IRF1, and TCF7L1. Or (m) The target cell is an epithelial cell, and the transcription factors are any one or more of NOTCH1, HR, DBP, OTX1, ESRRA, FOXQ1, PAX6, and IRX5.

[0062] All the transcription factors listed in (a) to (m) above can be used. Preferably, the keratinocyte is an epidermal keratinocyte. More preferably, the keratinocyte is an oral mucosal keratinocyte. More preferably, in the case that the source cell is an oral mucosal keratinocyte, the target cell is a corneal epithelial cell.

[0063] In any of the methods of the invention described herein, the source cell is an embryonic stem cell, and (a) The target cells are chondrocytes, and the transcription factors are any one or more of BARX1, PITX1, SMAD6, and NFKB1; (b) The target cell is a hair follicle, and the transcription factors are any one or more of TWIST1, ZIC1, NR2F2, PRRX1, NFKB1, and AHR; (c) The target cell is a CD4+ T cell, and the transcription factors are any one or more of RORA, LEF1, JUN, FOS, and BACH2; (d) The target cell is a CD8+ T cell, and the transcription factors are any one or more of RORA, FOS, SMAD7, and JUN; (e) The target cell is an NK cell, and the transcription factors are any one or more of RORA, SMAD7, FOS, JUN, and NFATC2; (f) The target cell is an HSC, and the transcription factors are any one or more of MYB, IL1B, KLF1, GATA1, GFI1, GFI1B, and NFE2; (g) The target cells are adipose MSCs, and the transcription factors are any one or more of TWIST1, SNAI2, IRF1, MXD4, NFKB1, MSX1, HOXB7, and ESRRA; (h) The target cells are MSCs of the bone marrow, and the transcription factors are any one or more of IRF1, RUNX1, CEBPB, AHR, FOXC2, and HOXA9; (i) The target cell is an oligodendrocyte precursor cell, and the transcription factors are any one or more of NKX2-1, ANKRD1, FOXA2, LMO3, FOS, IGF1, ICAM1, and CDH1; (j) The target cell is a skeletal muscle cell, and the transcription factors are any one or more of MYOG, IRF1, MYOD1, FOXD1, NFKB1, JUNB, and HOXA7; (k) The target cell is a smooth muscle cell, and these transcription factors are any one or more of IRF1, NFKB1, JUNB, FOSL2, GATA6, and MEIS1; (l) The target cell is an endothelial cell, and the transcription factors are any one or more of SOX17, TAL1, SMAD1, HOXB7, JUNB, IRF1, and NFKB1; (m) The target cell is an astrocyte, and these transcription factors are any one or more of IRF1, SOX9, ARNT2, PAX6, SNAI2, SOX5, and RUNX2; (n) The target cell is a keratinocyte, and these transcription factors are any one or more of SOX9, NFKB1, MYC, NR2F2, AHR, FOSL1, and FOSL2, or (o) The target cell is an epithelial cell, and the transcription factors are any one or more of MYC, IL1B, FOS, NFKB1, ESRRA, FOXQ1, IRF1, and PAX6.

[0064] All of the listed transcription factors can be used in (a) through (o) above. Preferably, the embryonic stem cell is a human embryonic stem cell.

[0065] In any of the methods of the invention described herein, the source cell is a monocyte, and the target cell is an HSC, and the transcription factors are any one or more of MYB, IL1B, GATA1, GFI1, and GFI1B. Preferably, all of the listed transcription factors are used.

[0066] In any of the methods of the invention described herein, the source cell is a cardiac fibroblast, and the target cell is a fetal cardiomyocyte, and the transcription factors are any one or more of BMP10, GATA6, TBX5, ANKRD1, HAND1, PPARGC1A, NKX2-5, and GATA4. Preferably, all of the listed transcription factors are used.

[0067] In any method of the invention described herein, the source cell is a pluripotent cell, and the target cell is an endothelial cell, and the transcription factors are any one or more of SOX17, TAL1, HOXB7, NFKB1, IRF1, JUNB, and SMAD1. Preferably, all of the listed transcription factors are used. Preferably, the pluripotent cell is an induced pluripotent stem cell (iPSC).

[0068] In any of the methods of the invention described herein, the source cell is a pluripotent cell, and the target cell is an astrocyte, and the transcription factors are any one or more of PAX6, POU3F2, SNAI2, RUNX2, SOX5, E2F5, and HMGB2. Preferably, all of the listed transcription factors are used. Preferably, the pluripotent cell is an induced pluripotent stem cell (iPSC).

[0069] In any method of the invention described herein, the source cell is a pluripotent cell, and the target cell is a keratinocyte, and the transcription factors are any one or more of TP63, TFAP2A, MYC, NFKBIA, SOX9, and NFKB1. Preferably, all of the listed transcription factors are used. Preferably, the pluripotent cell is an induced pluripotent stem cell (iPSC).

[0070] In any of the methods of the invention described herein, the source cell is a bone marrow stem cell, and the target cell is an astrocyte, and the transcription factors are any one or more of SOX2, SOX9, ARNT2, MYBL2, POU3F2, E2F1, and HMGB2. Preferably, all of the listed transcription factors are used.

[0071] Preferably, the at least one characteristic of the target cell is the upregulation of any one or more target cell markers and / or changes in cell morphology. Relevant markers are described herein and are known to those skilled in the art. Exemplary markers for the following target cells include: - Chondrocytes: Production of CD49, CD10, CD9, CD95, integrin α10β1,105 and sulfated glycosaminoglycans (GAG); - Hair follicles: CD200, PHLDA1, and folliculoritol; - CD4+ T cells: CD3, CD4; - CD8+ T cells: CD3, CD8; - NK cells: CD56, CD2; - HSC: CD45, CD19 / 20, CD14 / 15, CD34, CD90; - Adipose MSCs: CD13, CD29, CD90, CD105, CD10, CD45 and their in vitro differentiation into osteoblasts, adipocytes and chondrocytes; - MSCs from bone marrow: CD13, CD29, CD90, CD105, CD10, and in vitro differentiation into osteoblasts, adipocytes, and chondrocytes; - Oligodendrocytes and oligodendrocyte precursors; NG2 and PDGFRα QPCR of Olig2 and Nkx2.2; - Skeletal muscle cells: MyoD, myoblasts, and intermyogenic proteins; - Smooth muscle cells: cardiomyin, smooth muscle α-actin, and smooth muscle myosin heavy chain; - Fetal cardiomyocytes: MEF2C, MYH6, ACTN1, CDH2, and GJA1; - Endothelial cells: PeCAM (CD31), VE-cadherin, and VEGFR2; - Keratinocytes: keratin 1, keratin 14, ubiquitin, and epidermal proteins; - Astrocytes: GFAP, S100B, and ALDH1L1; and - Epithelial cells: cytokeratin 15 (CK15), cytokeratin 3 (CK3), epidermal proteins and connexin 4.

[0072] Typically, suitable conditions for target cell differentiation include culturing cells in a suitable culture medium for a sufficient time. Sufficient culture time can be at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 days. Suitable culture media can be those shown in Table 9.

[0073] The present invention also provides cells exhibiting at least one characteristic of target cells generated by the methods described herein.

[0074] In any of the methods described herein, the method may further include the step of amplifying cells exhibiting at least one characteristic of the target cell type to increase the proportion of cells exhibiting at least one characteristic of the target cell type in the population. The cell amplification step may involve culturing the cells for a sufficient time under the conditions for generating the cell population as described below.

[0075] In any of the methods described herein, the method may further include giving an individual cells exhibiting at least one characteristic of the target cell type, or a cell population comprising cells exhibiting at least one characteristic of the target cell type.

[0076] The present invention also provides a cell population in which at least 5% of the cells exhibit at least one characteristic of the target cells, and these cells are generated by the method described herein. Preferably, at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the cells in the population exhibit at least one characteristic of the target cells.

[0077] The present invention provides a kit for use in the method described in any one of the preceding statements, for generating cells exhibiting at least one characteristic of target cells, the kit comprising one or more nucleic acids having one or more nucleic acid sequences, transcription factors described herein or variants thereof, and optionally further comprising instructions for reprogramming source cells to exhibit at least one characteristic of target cells.

[0078] The present invention also relates to a kit for generating cells exhibiting at least one characteristic of target cells as disclosed herein. In some embodiments, the kit comprises one or more nucleic acids having one or more nucleic acid sequences encoding transcription factors or variants thereof described herein. Preferably, the kit can be used to generate cells exhibiting at least one characteristic of target cells mentioned in Tables 4a and 4b. Preferably, the kit can be applied to source cells mentioned in Tables 4a and 4b. In some embodiments, the kit further comprises instructions for reprogramming source cells according to the methods disclosed herein to generate cells exhibiting at least one characteristic of target cells. Preferably, the present invention provides a kit for use in the methods of the present invention described herein.

[0079] This invention relates to a composition comprising at least one target cell and at least one agent for increasing the protein expression of one or more transcription factors in the target cell. Preferably, the target cell is as described herein. Furthermore, the transcription factor can be any of those described herein. Preferably, the target cell and transcription factor are as described in Tables 4a and 4b.

[0080] The present invention provides a method for reprogramming fibroblasts, the method comprising increasing the expression of any one or more proteins of FOXQ1, SOX9, MAFB, CDH1, FOS and REL or variants thereof in fibroblasts, wherein the fibroblasts are reprogrammed to exhibit at least one characteristic of keratinocytes.

[0081] This invention provides a method for generating cells exhibiting at least one characteristic of keratinocytes from fibroblasts, the method comprising: - Increases the levels of any one or more of FOXQ1, SOX9, MAFB, CDH1, FOS, and REL or their variants in fibroblasts; and - Fibroids are cultured for a sufficient time under conditions suitable for keratinocyte differentiation; thereby generating cells from fibroblasts that exhibit at least one characteristic of keratinocytes.

[0082] The present invention provides a method for reprogramming fibroblasts into cells exhibiting at least one characteristic of keratinocytes, the method comprising: i) providing fibroblasts or a cell population containing fibroblasts; ii) transfecting the fibroblasts with one or more nucleic acids comprising nucleotide sequences encoding polypeptides FOXQ1, SOX9, MAFB, CDH1, FOS, and REL; iii) culturing the cells or cell population, and optionally monitoring the cells or cell population for at least one characteristic of keratinocytes.

[0083] Preferably, at least one characteristic of the keratinocyte is the upregulation of any one or more keratinocyte markers and / or changes in cell morphology. Keratinocyte markers include keratin 1, keratin 14, and epidermal proteins, and the cell morphology is cobblestone-like.

[0084] Typically, suitable conditions for keratinocyte differentiation include culturing cells in a suitable culture medium for a sufficient period of time. Sufficient culture time can be at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 days. Suitable culture media can be those shown in Table 9.

[0085] The present invention also provides cells exhibiting at least one characteristic of keratinocytes produced by methods as described herein.

[0086] In any of the methods described herein, the method may further include the step of amplifying cells exhibiting at least one characteristic of the target cell type to increase the proportion of cells exhibiting at least one characteristic of the target cell type in the population. The cell amplification step may involve culturing the cells for a sufficient time under the conditions for generating the cell population as described below.

[0087] In any of the methods described herein, the method may further include giving an individual cells exhibiting at least one characteristic of keratinocytes, or a cell population comprising cells exhibiting at least one characteristic of keratinocytes.

[0088] The present invention also provides a cell population in which at least 5% of the cells exhibit at least one characteristic of keratinocytes, and these cells are generated by the method described herein. Preferably, at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the cells in the population exhibit at least one characteristic of keratinocytes.

[0089] The present invention also relates to a kit for generating cells exhibiting at least one characteristic of keratinocytes as disclosed herein. In some embodiments, the kit comprises any one or more of the following: (i) a nucleic acid sequence encoding a FOXQ1 polypeptide or a variant thereof; and (ii) a nucleic acid sequence encoding a SOX9 polypeptide or a variant thereof; and (iii) a nucleic acid sequence encoding a MAFB polypeptide or a variant thereof; and (iv) a nucleic acid sequence encoding a CDH1 polypeptide or a variant thereof; and (v) a nucleic acid sequence encoding a FOS polypeptide or a variant thereof; and (vi) a nucleic acid sequence encoding a REL polypeptide or a variant thereof. In some embodiments, the kit further comprises instructions for reprogramming fibroblasts into cells exhibiting at least one characteristic of keratinocytes according to the methods disclosed herein. Preferably, the present invention provides a kit for use in the cases described herein in the methods of the present invention.

[0090] This invention relates to a composition comprising at least one fibroblast and at least one agent that increases the expression of any one or more proteins of FOXQ1, SOX9, MAFB, CDH1, FOS and REL in the fibroblast.

[0091] The present invention provides a method for reprogramming fibroblasts, the method comprising increasing the expression of any one or more proteins of SOX17, SMAD1, TAL1, IRF1, TCF7L1, MXD4 and JUNB or variants thereof in fibroblasts, wherein the fibroblasts are reprogrammed to exhibit at least one characteristic of endothelial cells.

[0092] This invention provides a method for generating cells exhibiting at least one characteristic of endothelial cells from fibroblasts, the method comprising: - Increases the levels of any one or more of SOX17, SMAD1, TAL1, IRF1, TCF7L1, MXD4, and JUNB or their variants in fibroblasts; and - Fibroids are cultured for a sufficient time under conditions suitable for endothelial differentiation; thereby generating cells from fibroblasts that exhibit at least one characteristic of endothelial cells.

[0093] The present invention provides a method for reprogramming fibroblasts into cells exhibiting at least one characteristic of endothelial cells, the method comprising: i) providing fibroblasts or a cell population containing fibroblasts; ii) transfecting the fibroblasts with one or more nucleic acids comprising nucleotide sequences encoding polypeptides SOX17, SMAD1, TAL1, IRF1, TCF7L1, MXD4, and JUNB; iii) culturing the cells or cell population, and optionally monitoring the cells or cell population for at least one characteristic of endothelial cells.

[0094] Preferably, at least one characteristic of the endothelial cell is the upregulation of any one or more endothelial cell markers and / or changes in cell morphology. Endothelial markers include CD31 (Pe-CAM), VE-cadherin, and VEGFR2, and the cell morphology may be a capillary-like structure.

[0095] Typically, suitable conditions for endothelial cell differentiation include culturing cells in a suitable culture medium for a sufficient time. Sufficient culture time can be at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 days. Suitable culture media can be those shown in Table 9.

[0096] The present invention also provides cells exhibiting at least one characteristic of endothelial cells, produced by methods as described herein.

[0097] In any of the methods described herein, the method may further include giving an individual cells exhibiting at least one characteristic of endothelial cells, or a cell population comprising cells exhibiting at least one characteristic of endothelial cells.

[0098] The present invention also provides a cell population in which at least 5% of the cells exhibit at least one characteristic of endothelial cells, and these cells are generated by the method described herein. Preferably, at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the cells in the population exhibit at least one characteristic of endothelial cells.

[0099] The present invention also relates to a kit for generating cells exhibiting at least one characteristic of endothelial cells as disclosed herein. In some embodiments, the kit comprises any one or more of the following: (i) a nucleic acid sequence encoding a SOX17 polypeptide or a variant thereof; and (ii) a nucleic acid sequence encoding a SMAD1 polypeptide or a variant thereof; and (iii) a nucleic acid sequence encoding an IRF1 polypeptide or a variant thereof; (iv) a nucleic acid sequence encoding a TCF7L1 polypeptide or a variant thereof; (v) a nucleic acid sequence encoding an MXD4 polypeptide or a variant thereof; (vi) a nucleic acid sequence encoding a TAL1 polypeptide or a variant thereof; and (vii) a nucleic acid sequence encoding a JUNB polypeptide or a variant thereof. In some embodiments, the kit further comprises instructions for reprogramming fibroblasts into cells exhibiting at least one characteristic of endothelial cells according to the methods disclosed herein. Preferably, the present invention provides a kit for use in the cases described herein in the methods of the present invention.

[0100] The present invention relates to a composition comprising at least one fibroblast and at least one agent that increases the expression of any one or more of the proteins SOX17, SMAD1, TAL1, IRF1, TCF7L1, MXD4 and JUNB in ​​the fibroblast.

[0101] The present invention provides a method for reprogramming fibroblasts, the method comprising increasing the expression of any one or more proteins of SOX2, SOX9, ARNT2, E2F5, PXB1, SMAD1 and RUNX2 or variants thereof in fibroblasts, wherein the fibroblasts are reprogrammed to exhibit at least one characteristic of astrocytes.

[0102] This invention provides a method for generating cells exhibiting at least one characteristic of astrocytes from fibroblasts, the method comprising: - Increases the levels of any one or more of SOX2, SOX9, ARNT2, E2F5, PXB1, SMAD1, and RUNX2 or their variants in fibroblasts; and - Fibroblasts are cultured for a sufficient time under conditions suitable for astrocyte differentiation; thereby generating cells from fibroblasts that exhibit at least one characteristic of astrocytes.

[0103] The present invention provides a method for reprogramming fibroblasts into cells exhibiting at least one characteristic of astrocytes, the method comprising: i) providing fibroblasts or a cell population containing fibroblasts; ii) transfecting the fibroblasts with one or more nucleic acids comprising nucleotide sequences encoding polypeptides SOX2, SOX9, ARNT2, E2F5, PXB1, SMAD1, and RUNX2; iii) culturing the cells or cell population, and optionally monitoring the cells or cell population for at least one characteristic of astrocytes.

[0104] Preferably, at least one characteristic of the astrocyte is the upregulation of any one or more astrocyte markers and / or changes in cell morphology. Astrocyte markers include GFAP, S100B, and ALDH1L1. Preferably, the marker used is GFAP. Preferably, the observed morphology is the presence of star-like projections. Typically, conditions suitable for astrocyte differentiation include culturing the cells in a suitable culture medium for a sufficient time. Sufficient culture time can be at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 days. Suitable culture media can be those shown in Table 9.

[0105] The present invention also provides cells exhibiting at least one characteristic of astrocytes produced by the methods described herein.

[0106] In any of the methods described herein, the method may further include giving an individual cells exhibiting at least one characteristic of astrocytes, or a cell population comprising cells exhibiting at least one characteristic of astrocytes.

[0107] The present invention also provides a cell population in which at least 5% of the cells exhibit at least one characteristic of astrocytes, and these cells are generated by the method described herein. Preferably, at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the cells in the population exhibit at least one characteristic of astrocytes.

[0108] The present invention also relates to a kit for generating cells exhibiting at least one characteristic of astrocytes as disclosed herein. In some embodiments, the kit comprises any one or more of the following: (i) a nucleic acid sequence encoding a SOX2 polypeptide or a variant thereof; and (ii) a nucleic acid sequence encoding a SOX9 polypeptide or a variant thereof; (iii) a nucleic acid sequence encoding an ARNT2 polypeptide or a variant thereof; (iv) a nucleic acid sequence encoding an E2F5 polypeptide or a variant thereof; (v) a nucleic acid sequence encoding a PXB1 polypeptide or a variant thereof; (vi) a nucleic acid sequence encoding a SMAD1 polypeptide or a variant thereof; and (vii) a nucleic acid sequence encoding a RUNX2 polypeptide or a variant thereof. In some embodiments, the kit further comprises instructions for reprogramming fibroblasts into cells exhibiting at least one characteristic of astrocytes according to the methods disclosed herein. Preferably, the present invention provides a kit for use in the methods of the present invention described herein.

[0109] The present invention relates to a composition comprising at least one fibroblast and at least one agent for increasing the expression of any one or more proteins of SOX2, SOX9, ARNT2, E2F5, PXB1, SMAD1 and RUNX2 in the fibroblast.

[0110] The present invention provides a method for reprogramming fibroblasts, the method comprising increasing the expression of any one or more proteins of FOS, DBP, HES1, FOXA2, ESRRA, CDH1, FOXQ1 and PAX6 or variants thereof in fibroblasts, wherein the fibroblasts are reprogrammed to exhibit at least one characteristic of epithelial cells.

[0111] This invention provides a method for generating cells exhibiting at least one characteristic of epithelial cells from fibroblasts, the method comprising: - Increases the levels of any one or more of FOS, DBP, HES1, FOXA2, ESRRA, CDH1, FOXQ1, and PAX6 or their variants in fibroblasts; and - Fibroids are cultured for a sufficient time under conditions suitable for epithelial cell differentiation; thereby generating cells from fibroblasts that exhibit at least one characteristic of epithelial cells.

[0112] The present invention provides a method for reprogramming fibroblasts into cells exhibiting at least one characteristic of epithelial cells, the method comprising: i) providing fibroblasts or a cell population containing fibroblasts; ii) transfecting the fibroblasts with one or more nucleic acids comprising nucleotide sequences encoding polypeptides FOS, DBP, HES1, FOXA2, ESRRA, CDH1, FOXQ1, and PAX6; iii) culturing the cells or cell population, and optionally monitoring the cells or cell population for at least one characteristic of epithelial cells.

[0113] Preferably, at least one characteristic of the epithelial cell is the upregulation of any one or more epithelial markers and / or changes in cell morphology. Epithelial markers include cytokeratin 15 (CK15), cytokeratin 3 (CK3), epithelial proteins, and connexin 4. Preferably, the observed morphology is a cobblestone appearance.

[0114] Typically, suitable conditions for epithelial differentiation include culturing cells in a suitable culture medium for a sufficient period of time. Sufficient culture time can be at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 days. Suitable culture media can be those shown in Table 9.

[0115] The present invention also provides cells exhibiting at least one characteristic of epithelial cells, produced by methods as described herein.

[0116] In any of the methods described herein, the method may further include giving an individual cells exhibiting at least one characteristic of epithelial cells, or a cell population comprising cells exhibiting at least one characteristic of epithelial cells.

[0117] The present invention also provides a cell population in which at least 5% of the cells exhibit at least one characteristic of epithelial cells, and these cells are generated by the method described herein. Preferably, at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the cells in the population exhibit at least one characteristic of epithelial cells.

[0118] The present invention also relates to a kit for generating cells exhibiting at least one characteristic of epithelial cells as disclosed herein. In some embodiments, the kit comprises any one or more of the following: (i) a nucleic acid sequence encoding a FOS polypeptide or a variant thereof; and (ii) a nucleic acid sequence encoding a DBP polypeptide or a variant thereof; (iii) a nucleic acid sequence encoding a FOXA2 polypeptide or a variant thereof; (iv) a nucleic acid sequence encoding an ESRRA polypeptide or a variant thereof; (v) a nucleic acid sequence encoding a CDH1 polypeptide or a variant thereof; (vi) a nucleic acid sequence encoding a FOXQ1 polypeptide or a variant thereof; and (vii) a nucleic acid sequence encoding a PAX6 polypeptide or a variant thereof. In some embodiments, the kit further comprises instructions for reprogramming fibroblasts into cells exhibiting at least one characteristic of epithelial cells according to the methods disclosed herein. Preferably, the present invention provides a kit for use in the cases described herein in the methods of the present invention.

[0119] The present invention relates to a composition comprising at least one fibroblast and at least one agent for increasing the expression of any one or more proteins of FOS, DBP, HES1, FOXA2, ESRRA, CDH1, FOXQ1 and PAX6 in the fibroblast.

[0120] The present invention provides a method for reprogramming keratinocytes, the method comprising increasing the expression of any one or more of the proteins SOX17, TAL1, SMAD1, IRF1, HOXB7 and TCF7L1 in keratinocytes, wherein the keratinocytes are reprogrammed to exhibit at least one characteristic of endothelial cells.

[0121] This invention provides a method for generating cells exhibiting at least one characteristic of endothelial cells from keratinocytes, the method comprising: Increase the levels of any one or more of SOX17, TAL1, SMAD1, IRF1, HOXB7, and TCF7L1 or their variants in keratinocytes; and Keratinocytes are cultured for a sufficient time under conditions suitable for endothelial differentiation; thereby generating cells from keratinocytes that exhibit at least one characteristic of endothelial cells.

[0122] The present invention provides a method for reprogramming keratinocytes into cells exhibiting at least one characteristic of endothelial cells, the method comprising: i) providing keratinocytes or a cell population containing keratinocytes; ii) transfecting the keratinocytes with one or more nucleic acids comprising nucleotide sequences encoding polypeptides SOX17, TAL1, SMAD1, IRF1, HOXB7, and TCF7L1; iii) culturing the cells or cell population, and optionally monitoring the cells or cell population for at least one characteristic of endothelial cells.

[0123] Preferably, in any aspect of the invention, the endothelial cell is a microvascular endothelial cell.

[0124] Preferably, at least one characteristic of the endothelial cell is the upregulation of any one or more endothelial cell markers and / or changes in cell morphology. Endothelial markers include CD31, VE-cadherin, and VEGFR2.

[0125] Typically, suitable conditions for endothelial cell differentiation include culturing cells in a suitable culture medium for a sufficient time. Sufficient culture time can be at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 days. Suitable culture media can be those shown in Table 9.

[0126] The present invention also provides cells exhibiting at least one characteristic of microvascular endothelial cells, produced by the methods described herein.

[0127] The present invention also provides a cell population in which at least 5% of the cells exhibit at least one characteristic of endothelial cells (preferably microvascular endothelial cells), and these cells are generated by the method described herein. Preferably, at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the cells in the population exhibit at least one characteristic of endothelial cells (preferably microvascular endothelial cells).

[0128] The present invention also relates to a kit for generating cells exhibiting at least one characteristic of endothelial cells as disclosed herein. In some embodiments, the kit comprises any one or more of the following: (i) a nucleic acid sequence encoding a SOX17 polypeptide or a variant thereof; and (ii) a nucleic acid sequence encoding a TAL1 polypeptide or a variant thereof; and (iii) a nucleic acid sequence encoding a SMAD1 polypeptide or a variant thereof; and (iv) a nucleic acid sequence encoding an IRF1 polypeptide or a variant thereof; (v) a nucleic acid sequence encoding a TCF7L1 polypeptide or a variant thereof; and (vi) a nucleic acid sequence encoding a HOXB7 polypeptide or a variant thereof. In some embodiments, the kit further comprises instructions for reprogramming keratinocytes into cells exhibiting at least one characteristic of endothelial cells according to the methods disclosed herein. Preferably, the present invention provides a kit for use in the cases described herein in the methods of the present invention.

[0129] This invention relates to a composition comprising at least one keratinocyte and at least one agent that increases the expression of any one or more proteins of SOX17, TAL1, SMAD1, IRF1, HOXB7, and TCF7L1 in the keratinocyte.

[0130] The present invention provides a method for reprogramming keratinocytes, the method comprising increasing the expression of any one or more of the proteins NOTCH1, HR, DBP, OTX1, ESRRA, FOXQ1, PAX6 and IRX5 in keratinocytes, wherein the keratinocytes are reprogrammed to exhibit at least one characteristic of epithelial cells.

[0131] This invention provides a method for generating cells exhibiting at least one characteristic of epithelial cells from keratinocytes, the method comprising: Increase the levels of any one or more of NOTCH1, HR, DBP, OTX1, ESRRA, FOXQ1, PAX6, and IRX5 or their variants in keratinocytes; and Keratinocytes are cultured for a sufficient time under conditions suitable for epithelial differentiation; thereby generating cells from keratinocytes that exhibit at least one characteristic of epithelial cells.

[0132] The present invention provides a method for reprogramming keratinocytes into cells exhibiting at least one characteristic of epithelial cells, the method comprising: i) providing keratinocytes or a cell population containing keratinocytes; ii) transfecting the keratinocytes with one or more nucleic acids, the nucleic acids comprising nucleotide sequences encoding polypeptides NOTCH1, HR, DBP, OTX1, ESRRA, FOXQ1, PAX6, and IRX5; iii) culturing the cells or cell population, and optionally monitoring the cells or cell population for at least one characteristic of epithelial cells.

[0133] Preferably, in any aspect of the invention, the epithelial cell is a corneal epithelial cell.

[0134] Preferably, at least one characteristic of the epithelial cell is the upregulation of any one or more epithelial markers and / or changes in cell morphology. Epithelial markers include cytokeratin 15 (CK15), cytokeratin 3 (CK3), epithelial proteins, and connexin 4.

[0135] Typically, suitable conditions for endothelial cell differentiation include culturing cells in a suitable culture medium for a sufficient time. Sufficient culture time can be at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 days. Suitable culture media can be those shown in Table 9.

[0136] The present invention also provides cells exhibiting at least one characteristic of epithelial cells (preferably corneal epithelial cells) produced by the methods described herein.

[0137] The present invention also provides a cell population in which at least 5% of the cells exhibit at least one characteristic of epithelial cells (preferably corneal epithelial cells), and these cells are generated by the method described herein. Preferably, at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the cells in the population exhibit at least one characteristic of epithelial cells (preferably corneal epithelial cells).

[0138] The present invention also relates to a kit for generating cells exhibiting at least one characteristic of epithelial cells as disclosed herein. In some embodiments, the kit comprises any one or more of the following: (i) a nucleic acid sequence encoding a NOTCH1 polypeptide or a variant thereof; and (ii) a nucleic acid sequence encoding an HR polypeptide or a variant thereof; and (iii) a nucleic acid sequence encoding a DBP polypeptide or a variant thereof; and (iv) a nucleic acid sequence encoding an OTX1 polypeptide or a variant thereof; (v) a nucleic acid sequence encoding an ESRRA polypeptide or a variant thereof; (vi) a nucleic acid sequence encoding a FOXQ1 polypeptide or a variant thereof; (vii) a nucleic acid sequence encoding a PAX6 polypeptide or a variant thereof; and (viii) a nucleic acid sequence encoding an IRX5 polypeptide or a variant thereof. In some embodiments, the kit further comprises instructions for reprogramming keratinocytes into cells exhibiting at least one characteristic of epithelial cells according to the methods disclosed herein. Preferably, the present invention provides a kit for use in the methods of the present invention described herein.

[0139] The present invention relates to a composition comprising at least one keratinocyte and at least one agent for increasing the expression of any one or more proteins among NOTCH1, HR, DBP, OTX1, ESRRA, FOXQ1, PAX6, and IRX5 in the keratinocyte.

[0140] The present invention provides a method for differentiating embryonic stem cells, the method comprising increasing the expression of any one or more of the proteins SOX17, TAL1, SMAD1, HOXB7, JUNB, IRF1 and NFKB1 in embryonic stem cells, wherein the embryonic stem cells are differentiated to exhibit at least one characteristic of endothelial cells.

[0141] This invention provides a method for generating cells exhibiting at least one characteristic of endothelial cells from embryonic stem cells, the method comprising: Increase the levels of any one or more of SOX17, TAL1, SMAD1, HOXB7, JUNB, IRF1, and NFKB1 or their variants in embryonic stem cells; and Embryonic stem cells are cultured for a sufficient time under conditions suitable for endothelial differentiation; thereby generating cells from embryonic stem cells that exhibit at least one characteristic of endothelial cells.

[0142] The present invention provides a method for differentiating embryonic stem cells into cells exhibiting at least one characteristic of endothelial cells, the method comprising: i) providing embryonic stem cells or a cell population containing embryonic stem cells; ii) transfecting the embryonic stem cells with one or more nucleic acids, the nucleic acids comprising nucleotide sequences encoding any one or more of the polypeptides SOX17, TAL1, SMAD1, HOXB7, JUNB, IRF1, and NFKB1; iii) culturing the cells or cell population, and optionally monitoring the cells or cell population for at least one characteristic of endothelial cells.

[0143] Preferably, in any aspect of the invention, the endothelial cell is a microvascular endothelial cell.

[0144] Preferably, at least one characteristic of the endothelial cell is the upregulation of any one or more endothelial cell markers and / or changes in cell morphology. Endothelial markers include CD31, VE-cadherin, and VEGFR2.

[0145] Typically, suitable conditions for endothelial cell differentiation include culturing cells in a suitable culture medium for a sufficient time. Sufficient culture time can be at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 days. Suitable culture media can be those shown in Table 9.

[0146] The present invention also provides cells exhibiting at least one characteristic of microvascular endothelial cells, produced by the methods described herein.

[0147] The present invention also provides a cell population in which at least 5% of the cells exhibit at least one characteristic of endothelial cells (preferably microvascular endothelial cells), and these cells are generated by the method described herein. Preferably, at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the cells in the population exhibit at least one characteristic of endothelial cells (preferably microvascular endothelial cells).

[0148] The present invention also relates to a kit for generating cells exhibiting at least one characteristic of endothelial cells as disclosed herein. In some embodiments, the kit comprises any one or more of the following: (i) a nucleic acid sequence encoding a SOX17 polypeptide or a variant thereof; (ii) a nucleic acid sequence encoding a TAL1 polypeptide or a variant thereof; (iii) a nucleic acid sequence encoding a SMAD1 polypeptide or a variant thereof; (iv) a nucleic acid sequence encoding an IRF1 polypeptide or a variant thereof; (v) a nucleic acid sequence encoding an NFKB1 polypeptide or a variant thereof; (vi) a nucleic acid sequence encoding a HOXB7 polypeptide or a variant thereof; and (vii) a nucleic acid sequence encoding a JUNB polypeptide or a variant thereof. In some embodiments, the kit further comprises instructions for differentiating embryonic stem cells into cells exhibiting at least one characteristic of endothelial cells according to the methods disclosed herein. Preferably, the present invention provides a kit for use in the methods of the present invention described herein.

[0149] The present invention relates to a composition comprising at least one embryonic stem cell and at least one agent for increasing the expression of any one or more proteins of SOX17, TAL1, SMAD1, HOXB7, JUNB, IRF1 and NFKB1 in the embryonic stem cell.

[0150] The present invention provides a method for differentiating embryonic stem cells, the method comprising increasing the protein expression of IRF1, SOX9, ARNT2, PAX6, SNAI2, SOX5 and RUNX2 in embryonic stem cells, wherein the embryonic stem cells are differentiated to exhibit at least one characteristic of astrocytes.

[0151] This invention provides a method for generating or producing cells exhibiting at least one characteristic of astrocytes from embryonic stem cells, the method comprising: Increase the amount of any one or more of IRF1, SOX9, ARNT2, PAX6, SNAI2, SOX5, and RUNX2 or their variants in embryonic stem cells; and Embryonic stem cells are cultured for a sufficient time under conditions suitable for astrocyte differentiation; thereby generating cells from embryonic stem cells that exhibit at least one characteristic of astrocytes.

[0152] The present invention provides a method for differentiating embryonic stem cells into cells exhibiting at least one characteristic of astrocytes, the method comprising: i) providing embryonic stem cells or a cell population containing embryonic stem cells; ii) transfecting the embryonic stem cells with one or more nucleic acids, the nucleic acids comprising a nucleotide sequence encoding any one or more polypeptides selected from IRF1, SOX9, ARNT2, PAX6, SNAI2, SOX5, and RUNX2; iii) culturing the cells or cell population, and optionally monitoring the cells or cell population for at least one characteristic of astrocytes.

[0153] Preferably, at least one characteristic of the astrocyte is the upregulation of any one or more astrocyte markers and / or changes in cell morphology. Astrocyte markers include GFAP, S100B, and ALDH1L1. Preferably, the marker used is GFAP. Preferably, the observed morphology is the presence of star-shaped projections.

[0154] Typically, suitable conditions for astrocyte differentiation include culturing cells in a suitable culture medium for a sufficient time. Sufficient culture time can be at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 days. Suitable culture media can be those shown in Table 9.

[0155] The present invention also provides cells exhibiting at least one characteristic of astrocytes produced by the methods described herein.

[0156] The present invention also provides a cell population in which at least 5% of the cells exhibit at least one characteristic of astrocytes, and these cells are generated by the method described herein. Preferably, at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the cells in the population exhibit at least one characteristic of astrocytes.

[0157] The present invention also relates to a kit for generating cells exhibiting at least one characteristic of astrocytes as disclosed herein. In some embodiments, the kit comprises any one or more of the following: (i) a nucleic acid sequence encoding an IRF1 polypeptide or a variant thereof; (ii) a nucleic acid sequence encoding a SOX9 polypeptide or a variant thereof; (iii) a nucleic acid sequence encoding an ARNT2 polypeptide or a variant thereof; (iv) a nucleic acid sequence encoding a PAX6 polypeptide or a variant thereof; (v) a nucleic acid sequence encoding a SNAI2 polypeptide or a variant thereof; (vi) a nucleic acid sequence encoding a RUNX2 polypeptide or a variant thereof; and (vii) a nucleic acid sequence encoding a SOX5 polypeptide or a variant thereof. In some embodiments, the kit further comprises instructions for differentiating embryonic stem cells into cells exhibiting at least one characteristic of astrocytes according to the methods disclosed herein. Preferably, the present invention provides a kit for use in the methods of the present invention described herein.

[0158] The present invention relates to a composition comprising at least one embryonic stem cell and at least one agent for increasing the protein expression of IRF1, SOX9, ARNT2, PAX6, SNAI2, SOX5 and RUNX2 in the embryonic stem cell.

[0159] The present invention provides a method for differentiating embryonic stem cells, the method comprising increasing the expression of any one or more of the following proteins in embryonic stem cells: SOX9, NFK1, MYC, NR2F2, FOSL1, AHR, and FOSL2, wherein the embryonic stem cells are differentiated to exhibit at least one characteristic of keratinocytes.

[0160] This invention provides a method for generating cells exhibiting at least one characteristic of keratinocytes from embryonic stem cells, the method comprising: Increase the levels of any one or more of SOX9, NFKB1, MYC, NR2F2, FOSL1, AHR, and FOSL2 or their variants in embryonic stem cells; and Embryonic stem cells are cultured for a sufficient time under conditions suitable for keratinocyte differentiation; thereby generating cells from embryonic stem cells that exhibit at least one characteristic of keratinocytes.

[0161] The present invention provides a method for differentiating embryonic stem cells into cells exhibiting at least one characteristic of keratinocytes, the method comprising: i) providing embryonic stem cells or a cell population containing embryonic stem cells; ii) transfecting the embryonic stem cells with one or more nucleic acids, the nucleic acids comprising a nucleotide sequence encoding any one or more polypeptides selected from SOX9, NFKB1, MYC, NR2F2, FOSL1, AHR, and FOSL2; iii) culturing the cells or cell population, and optionally monitoring the cells or cell population for at least one characteristic of keratinocytes.

[0162] Preferably, at least one characteristic of the keratinocyte is the upregulation of any one or more keratinocyte markers and / or changes in cell morphology. Keratinocyte markers include pankeratin, keratin 1, keratin 14, and epidermal protein, and the cell morphology is cobblestone-like.

[0163] Typically, suitable conditions for keratinocyte differentiation include culturing cells in a suitable culture medium for a sufficient period of time. Sufficient culture time can be at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 days. Suitable culture media can be those shown in Table 9.

[0164] The present invention also provides cells exhibiting at least one characteristic of keratinocytes produced by methods as described herein.

[0165] The present invention also provides a cell population in which at least 5% of the cells exhibit at least one characteristic of keratinocytes, and these cells are generated by the method described herein. Preferably, at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the cells in the population exhibit at least one characteristic of keratinocytes.

[0166] The present invention also relates to a kit for generating cells exhibiting at least one characteristic of keratinocytes as disclosed herein. In some embodiments, the kit comprises any one or more of the following: (i) a nucleic acid sequence encoding a SOX9 polypeptide or a variant thereof; (ii) a nucleic acid sequence encoding an NFKB1 polypeptide or a variant thereof; (iii) a nucleic acid sequence encoding a MYC polypeptide or a variant thereof; (iv) a nucleic acid sequence encoding a FOSL2 polypeptide or a variant thereof; (v) a nucleic acid sequence encoding an NR2F2 polypeptide or a variant thereof; (vi) a nucleic acid sequence encoding a FOSL1 polypeptide or a variant thereof; and (vii) a nucleic acid sequence encoding an AHR polypeptide or a variant thereof. In some embodiments, the kit further comprises instructions for differentiating embryonic stem cells into cells exhibiting at least one characteristic of keratinocytes according to the methods disclosed herein. Preferably, the present invention provides a kit for use in the methods of the present invention described herein.

[0167] The present invention relates to a composition comprising at least one embryonic stem cell and at least one agent for increasing the protein expression of SOX9, NFKB1, MYC, NR2F2, FOSL1, AHR and FOSL2 in the embryonic stem cell.

[0168] The present invention provides a method for differentiating embryonic stem cells, the method comprising increasing the expression of any one or more of the following proteins in the embryonic stem cells: MYC, IL1B, FOS, NFKB1, ESRRA, FOXQ1, IRF1 and PAX6, wherein the embryonic stem cells are differentiated to exhibit at least one characteristic of epithelial cells (preferably corneal epithelial cells).

[0169] This invention provides a method for generating cells exhibiting at least one characteristic of epithelial cells from embryonic stem cells, the method comprising: Increase the levels of any one or more of MYC, IL1B, FOS, NFKB1, ESRRA, FOXQ1, IRF1, and PAX6 or their variants in embryonic stem cells; and Embryonic stem cells are cultured for a sufficient time under conditions suitable for epithelial differentiation; thereby generating cells from embryonic stem cells that exhibit at least one characteristic of epithelial cells.

[0170] The present invention provides a method for differentiating embryonic stem cells into cells exhibiting at least one characteristic of epithelial cells, the method comprising: i) providing embryonic stem cells or a cell population containing embryonic stem cells; ii) transfecting the embryonic stem cells with one or more nucleic acids, the nucleic acids comprising a nucleotide sequence encoding any one or more polypeptides selected from MYC, IL1B, FOS, NFKB1, ESRRA, FOXQ1, IRF1, and PAX6; iii) culturing the cells or cell population, and optionally monitoring the cells or cell population for at least one characteristic of epithelial cells.

[0171] Preferably, at least one characteristic of the epithelial cell is the upregulation of any one or more epithelial markers and / or changes in cell morphology. Epithelial markers include cytokeratin 15 (CK15), cytokeratin 3 (CK3), epithelial proteins, and connexin 4, and the cell morphology can be cobblestone-like.

[0172] Typically, suitable conditions for epithelial differentiation include culturing cells in a suitable culture medium for a sufficient period of time. Sufficient culture time can be at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 days. Suitable culture media can be those shown in Table 9.

[0173] The present invention also provides cells exhibiting at least one characteristic of epithelial cells, produced by methods as described herein.

[0174] The present invention also provides a cell population in which at least 5% of the cells exhibit at least one characteristic of epithelial cells, and these cells are generated by the method described herein. Preferably, at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the cells in the population exhibit at least one characteristic of epithelial cells.

[0175] The present invention also relates to a kit for generating cells exhibiting at least one characteristic of epithelial cells as disclosed herein. In some embodiments, the kit comprises any one or more of the following: (i) a nucleic acid sequence encoding a MYC polypeptide or a variant thereof; (ii) a nucleic acid sequence encoding an IL1B polypeptide or a variant thereof; (iii) a nucleic acid sequence encoding a FOS polypeptide or a variant thereof; (iv) a nucleic acid sequence encoding an NFKB1 polypeptide or a variant thereof; (v) a nucleic acid sequence encoding an ESRRA polypeptide or a variant thereof; (vi) a nucleic acid sequence encoding a FOXQ1 polypeptide or a variant thereof; (vii) a nucleic acid sequence encoding an IRF1 polypeptide or a variant thereof; and (viii) a nucleic acid sequence encoding a PAX6 polypeptide or a variant thereof. In some embodiments, the kit further comprises instructions for differentiating embryonic stem cells into cells exhibiting at least one characteristic of epithelial cells according to the methods disclosed herein. Preferably, the present invention provides a kit for use in the methods of the present invention described herein.

[0176] The present invention relates to a composition comprising at least one embryonic stem cell and at least one agent for increasing the expression of any one or more proteins of MYC, IL1B, FOS, NFKB1, ESRRA, FOXQ1, IRF1 and PAX6 in the embryonic stem cell.

[0177] The present invention provides a method for generating endothelial cells from pluripotent stem cells (including differentiating pluripotent stem cells), the method comprising increasing the expression of any one or more of the proteins SOX17, TAL1, NFKB1, IRF1, HOXB7, JUNB and SMAD1 in the pluripotent stem cells, wherein the pluripotent stem cells are differentiated to exhibit at least one characteristic of endothelial cells.

[0178] In any aspect of the present invention, including any method or composition, the pluripotent stem cell may be an induced pluripotent stem cell (iPSC).

[0179] This invention provides a method for generating cells exhibiting at least one characteristic of endothelial cells from pluripotent stem cells, the method comprising: Increase the levels of any one or more of SOX17, TAL1, NFKB1, HOXB7, JUNB, IRF1, and SMAD1 or their variants in pluripotent stem cells; and Pluripotent stem cells are cultured for a sufficient time under conditions suitable for endothelial cell differentiation; thereby generating cells from pluripotent stem cells that exhibit at least one characteristic of endothelial cells.

[0180] The present invention provides a method for differentiating pluripotent stem cells into cells exhibiting at least one characteristic of endothelial cells, the method comprising: i) providing pluripotent stem cells or a cell population containing pluripotent stem cells; ii) transfecting the pluripotent stem cells with one or more nucleic acids comprising nucleotide sequences encoding any one or more of the polypeptides SOX17, TAL1, NFKB1, HOXB7, JUNB, IRF1, and SMAD1; and iii) culturing the cells or cell population, and optionally monitoring the cells or cell population for at least one characteristic of endothelial cells.

[0181] Preferably, at least one characteristic of the endothelial cell is the upregulation of any one or more endothelial cell markers and / or changes in cell morphology. Endothelial cell markers include panCD31, VE-cadherin, and VEGFR2.

[0182] Typically, suitable conditions for endothelial cell differentiation include culturing cells in a suitable culture medium for a sufficient time. Sufficient culture time can be at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 days. Suitable culture media can be those shown in Table 9.

[0183] The present invention also provides cells exhibiting at least one characteristic of endothelial cells, produced by methods as described herein.

[0184] The present invention also provides a cell population in which at least 5% of the cells exhibit at least one characteristic of endothelial cells, and these cells are generated by the method described herein. Preferably, at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the cells in the population exhibit at least one characteristic of endothelial cells.

[0185] The present invention also relates to a kit for generating cells exhibiting at least one characteristic of endothelial cells as disclosed herein. In some embodiments, the kit comprises any one or more of the following: (i) a nucleic acid sequence encoding a SOX17 polypeptide or a variant thereof; (ii) a nucleic acid sequence encoding a TAL1 polypeptide or a variant thereof; (iii) a nucleic acid sequence encoding an NFKB1 polypeptide or a variant thereof; (iv) a nucleic acid sequence encoding an IRF1 polypeptide or a variant thereof; (v) a nucleic acid sequence encoding a SMAD1 polypeptide or a variant thereof; (vi) a nucleic acid sequence encoding a HOXB7 polypeptide or a variant thereof; and (vii) a nucleic acid sequence encoding a JUNB polypeptide or a variant thereof. In some embodiments, the kit further comprises instructions for differentiating pluripotent stem cells into cells exhibiting at least one characteristic of endothelial cells according to the methods disclosed herein. Preferably, the present invention provides a kit for use in the methods of the present invention described herein.

[0186] The present invention relates to a composition comprising at least one pluripotent stem cell and at least one agent for increasing the expression of any one or more proteins of SOX17, TAL1, NFK1, IRF1, HOXB7, JUNB and SMAD1 in the pluripotent stem cell.

[0187] The present invention provides a method for generating astrocytes from pluripotent stem cells (including differentiating pluripotent stem cells), the method comprising increasing the expression of any one or more of the proteins PAX6, SNAI2, POU3F2, SOX5, E2F5, RUNX2 and HMGB2 in pluripotent stem cells, wherein the pluripotent stem cells are differentiated to exhibit at least one characteristic of astrocytes.

[0188] This invention provides a method for generating cells exhibiting at least one characteristic of astrocytes from pluripotent stem cells, the method comprising: Increase the amount of any one or more of PAX6, SNAI2, POU3F2, SOX5, E2F5, RUNX2, and HMGB2 or their variants in pluripotent stem cells; and Pluripotent stem cells are cultured for a sufficient time under conditions suitable for astrocyte differentiation; thereby generating cells from pluripotent stem cells that exhibit at least one characteristic of astrocytes.

[0189] The present invention provides a method for differentiating pluripotent stem cells into cells exhibiting at least one characteristic of astrocytes, the method comprising: i) providing pluripotent stem cells or a cell population containing pluripotent stem cells; ii) transfecting the pluripotent stem cells with one or more nucleic acids comprising a nucleotide sequence encoding any one or more of the polypeptides PAX6, SNAI2, POU3F2, SOX5, E2F5, RUNX2, and HMGB2; and iii) culturing the cells or cell population, and optionally monitoring the cells or cell population for at least one characteristic of astrocytes.

[0190] Preferably, at least one characteristic of the astrocyte is the upregulation of any one or more astrocyte markers and / or changes in cell morphology. Astrocyte markers include GFAP, S100B, and ALDH1L1. Preferably, the marker used is GFAP. Preferably, the observed morphology is the presence of star-shaped projections.

[0191] Typically, suitable conditions for astrocyte differentiation include culturing cells in a suitable culture medium for a sufficient time. Sufficient culture time can be at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 days. Suitable culture media can be those shown in Table 9.

[0192] The present invention also provides cells exhibiting at least one characteristic of astrocytes produced by the methods described herein.

[0193] The present invention also provides a cell population in which at least 5% of the cells exhibit at least one characteristic of astrocytes, and these cells are generated by the method described herein. Preferably, at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the cells in the population exhibit at least one characteristic of astrocytes.

[0194] The present invention also relates to a kit for generating cells exhibiting at least one characteristic of astrocytes as disclosed herein. In some embodiments, the kit comprises any one or more of the following: (i) a nucleic acid sequence encoding a PAX6 polypeptide or a variant thereof; (ii) a nucleic acid sequence encoding a SNAI2 polypeptide or a variant thereof; (iii) a nucleic acid sequence encoding a RUNX2 polypeptide or a variant thereof; (iv) a nucleic acid sequence encoding an HMGB2 polypeptide or a variant thereof; (v) a nucleic acid sequence encoding a POU3F2 polypeptide or a variant thereof; (vi) a nucleic acid sequence encoding a SOX5 polypeptide or a variant thereof; and (vii) a nucleic acid sequence encoding an E2F5 polypeptide or a variant thereof. In some embodiments, the kit further comprises instructions for differentiating pluripotent stem cells into cells exhibiting at least one characteristic of astrocytes according to the methods disclosed herein. Preferably, the present invention provides a kit for use in the methods of the present invention described herein.

[0195] The present invention relates to a composition comprising at least one pluripotent stem cell and at least one agent for increasing the expression of any one or more proteins of PAX6, SNAI2, POU3F2, SOX5, E2F5, RUNX2 and HMGB2 in the pluripotent stem cell.

[0196] The present invention provides a method for generating keratinocytes from pluripotent stem cells (including differentiating pluripotent stem cells), the method comprising increasing the expression of any one or more of the proteins TFAP2A, MYC, SOX9, TP63, NFKBIA, and NFKB1 in pluripotent stem cells, wherein the pluripotent stem cells are differentiated to exhibit at least one characteristic of keratinocytes.

[0197] This invention provides a method for generating cells exhibiting at least one characteristic of keratinocytes from pluripotent stem cells, the method comprising: Increase the amount of any one or more TFAP2A, MYC, SOX9, TP63, NFKBIA, and NFKB1 or their variants in pluripotent stem cells; and Pluripotent stem cells are cultured for a sufficient time under conditions suitable for keratinocyte differentiation; thereby generating cells from pluripotent stem cells that exhibit at least one characteristic of keratinocytes.

[0198] The present invention provides a method for differentiating pluripotent stem cells into cells exhibiting at least one characteristic of keratinocytes, the method comprising: i) providing pluripotent stem cells or a cell population containing pluripotent stem cells; ii) transfecting the pluripotent stem cells with one or more nucleic acids comprising a nucleotide sequence encoding any one or more of the polypeptides TFAP2A, MYC, SOX9, TP63, NFKBIA, and NFKB1; and iii) culturing the cells or cell population, and optionally monitoring the cells or cell population for at least one characteristic of keratinocytes.

[0199] Preferably, at least one characteristic of the keratinocyte is the upregulation of any one or more keratinocyte markers and / or changes in cell morphology. Keratinocyte markers include keratin 1, keratin 14, and epidermal proteins, and the cell morphology is cobblestone-like.

[0200] Typically, suitable conditions for keratinocyte differentiation include culturing cells in a suitable culture medium for a sufficient period of time. Sufficient culture time can be at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 days. Suitable culture media can be those shown in Table 9.

[0201] The present invention also provides cells exhibiting at least one characteristic of keratinocytes produced by methods as described herein.

[0202] The present invention also provides a cell population in which at least 5% of the cells exhibit at least one characteristic of keratinocytes, and these cells are generated by the method described herein. Preferably, at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the cells in the population exhibit at least one characteristic of keratinocytes.

[0203] The present invention also relates to a kit for generating cells exhibiting at least one characteristic of keratinocytes as disclosed herein. In some embodiments, the kit comprises any one or more of the following: (i) a nucleic acid sequence encoding a TFAP2A polypeptide or a variant thereof; (ii) a nucleic acid sequence encoding a MYC polypeptide or a variant thereof; (iii) a nucleic acid sequence encoding a SOX9 polypeptide or a variant thereof; (iv) a nucleic acid sequence encoding an NFKB1 polypeptide or a variant thereof; (v) a nucleic acid sequence encoding a TP63 polypeptide or a variant thereof; and (vi) a nucleic acid sequence encoding an NFKBIA polypeptide or a variant thereof. In some embodiments, the kit further comprises instructions for differentiating pluripotent stem cells into cells exhibiting at least one characteristic of keratinocytes according to the methods disclosed herein. Preferably, the present invention provides a kit for use in the methods of the present invention described herein.

[0204] This invention relates to a composition comprising at least one pluripotent stem cell and at least one agent that increases the expression of any one or more proteins of TFAP2A, MYC, SOX9, TP63, NFKBIA, and NFKB1 in the pluripotent stem cell.

[0205] The present invention provides a method for generating astrocytes from bone marrow stem cells (including differentiating bone marrow stem cells), the method comprising increasing the expression of any one or more of the proteins SOX2, SOX9, ARNT2, MYBL2, POU3F2, E2F1 and HMGB2 in bone marrow stem cells, wherein the bone marrow stem cells are differentiated to exhibit at least one characteristic of astrocytes.

[0206] This invention provides a method for generating cells exhibiting at least one characteristic of astrocytes from bone marrow stem cells, the method comprising: Increase the amount of any one or more SOX2, SOX9, ARNT2, MYBL2, POU3F2, E2F1, and HMGB2 or their variants in bone marrow stem cells; and Bone marrow stem cells are cultured for a sufficient time under conditions suitable for astrocyte differentiation; thereby generating cells from bone marrow stem cells that exhibit at least one characteristic of astrocytes.

[0207] The present invention provides a method for differentiating bone marrow stem cells into cells exhibiting at least one characteristic of astrocytes, the method comprising: i) providing bone marrow stem cells or a cell population containing bone marrow stem cells; ii) transfecting the bone marrow stem cells with one or more nucleic acids comprising a nucleotide sequence encoding any one or more of the polypeptides SOX2, SOX9, ARNT2, MYBL2, POU3F2, E2F1, and HMGB2; and iii) culturing the cells or cell population, and optionally monitoring the cells or cell population for at least one characteristic of astrocytes.

[0208] Preferably, at least one characteristic of the astrocyte is the upregulation of any one or more astrocyte markers and / or changes in cell morphology. Astrocyte markers include GFAP, S100B, and ALDH1L1. Preferably, the marker used is GFAP. Preferably, the observed morphology is the presence of star-shaped projections.

[0209] Typically, suitable conditions for astrocyte differentiation include culturing cells in a suitable culture medium for a sufficient time. Sufficient culture time can be at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 days. Suitable culture media can be those shown in Table 9.

[0210] The present invention also provides cells exhibiting at least one characteristic of astrocytes produced by the methods described herein.

[0211] The present invention also provides a cell population in which at least 5% of the cells exhibit at least one characteristic of astrocytes, and these cells are generated by the method described herein. Preferably, at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the cells in the population exhibit at least one characteristic of astrocytes.

[0212] The present invention also relates to a kit for generating cells exhibiting at least one characteristic of astrocytes as disclosed herein. In some embodiments, the kit comprises any one or more of the following: (i) a nucleic acid sequence encoding a SOX2 polypeptide or a variant thereof; (ii) a nucleic acid sequence encoding a SOX9 polypeptide or a variant thereof; (iii) a nucleic acid sequence encoding an ARNT2 polypeptide or a variant thereof; (iv) a nucleic acid sequence encoding an E2F1 polypeptide or a variant thereof; (v) a nucleic acid sequence encoding an HMGB2 polypeptide or a variant thereof; and (vi) a nucleic acid sequence encoding a POU3F2 polypeptide or a variant thereof. In some embodiments, the kit further comprises instructions for differentiating bone marrow stem cells into cells exhibiting at least one characteristic of astrocytes according to the methods disclosed herein. Preferably, the present invention provides a kit for use in the methods of the present invention described herein.

[0213] The present invention relates to a composition comprising at least one bone marrow stem cell and at least one agent for increasing the expression of any one or more proteins of SOX2, SOX9, ARNT2, MYBL2, E2F1, POU3F2 and HMGB2 in the bone marrow stem cell.

[0214] Typically, the protein expression or amount of transcription factors as described herein is increased by contacting the cell with an agent that increases transcription factor expression. Preferably, the agent is selected from the group consisting of nucleotide sequences, proteins, aptamers and small molecules, ribosomes, RNAi reagents, and peptide-nucleic acid (PNA) and their analogues or variants. Preferably, the agent is exogenous.

[0215] Typically, the protein expression or amount of transcription factors as described herein is increased by introducing into the cell at least one nucleic acid containing a nucleotide sequence encoding a transcription factor or a functional fragment thereof. Preferably, the nucleotide sequence encoding the transcription factor is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the sequences having accession numbers listed in Table 3.

[0216] Preferably, the nucleic acid further includes a heterologous promoter. Preferably, the nucleic acid is in a vector, such as a viral vector or a non-viral vector. Preferably, the vector is a viral vector containing a genome that does not integrate into the host cell genome. The viral vector may be a retroviral vector or a lentiviral vector.

[0217] Any method described herein may have one or more steps performed in vitro, ex vivo, or in vivo.

[0218] As used herein, unless the context requires otherwise, the term “comprise” and its variations such as “comprising,” “comprises,” and “comprised” are not intended to exclude other additives, components, wholes, or steps.

[0219] Other aspects of the invention described in the foregoing paragraphs and other embodiments thereof will become clear from the following description, which is given by way of example, and with reference to the accompanying drawings. Attached Figure Description

[0220] Figure 1A-1D The Mogrify algorithm predicts the TF used for cell conversion. This is performed as follows: ( Figure 1A Mogrify aims to identify not only differentially expressed genes but also gene transferases (TFs) responsible for regulating many differentially expressed genes in a given cell type. Figure 1B We used a cell type ontology tree created as part of the FANTOM5 consortium (Forrest, ARR et al., Nature [Nature] 507, 462–470 (2014)) to select a suitable background for DESeq (Anders, S. & Huber, W. (2010)). We also used a cell type ontology tree (Forrest, ARR et al., Nature [Nature] 507, 462–470 (2014)) to calculate the adjusted gene count in the sample (Genome Biol. [Genomics Biology] 2010;11(10):R106) to calculate the adjusted gene count in the sample. p Changes in value and logarithmic multiples. Figure 1C For each TF, we construct the local network neighborhood of the influence, weighting the downstream influence of the gene by gene connection distance and its parent's out-degree. Figure 1D We maximize regulation coverage by removing redundant TFs that affect other factors.

[0221] Figure 2 Mogrify predictions for some known transdifferentiations published in the literature. TFs correctly identified by Mogrify from the published lists are highlighted. Samples were grouped using the FANTOM cellular ontology (Forrest, ARR et al., as described above). For each publication, transcription factors in the initial maximum coverage set are shown in green, and the overall predicted Mogrify set is shown in orange. For example, transdifferentiation between fibroblasts and myoblasts (Lattanzi, L. et al. J. Clin. Invest. [Clinical Research] 101, 2119–28 (1998)) requires only MYOD, and this is identified by Mogrify.

[0222] Figure 3Empirical validation of novel transdifferentiation predicted by Mogrify: induction of keratinocytes from dermal fibroblasts. (A) Transcription factor network involved in transdifferentiation of dermal fibroblasts into keratinocytes as predicted by Mogrify. (B) Overview of the method used for transdifferentiation assay. (C) qPCR analysis of markers shown in cells harvested on days 12–16 during transdifferentiation. All values ​​are experimental replicates and correlated with gene expression in dermal fibroblasts (n = 3, error bars depict sem). (D) Bright-field and GFP images at day 24 showing the cobblestone morphology of transdifferentiated cells (top panel) and GFP+ control cells (bottom panel).

[0223] Figure 4 Empirical validation of a novel transdifferentiation predicted by Mogrify: induction of microvascular endothelial cells from keratinocytes. (A) Schematic diagram of the transcription factor network involved in the transdifferentiation of keratinocytes into microvascular endothelial cells predicted by Mogrify. (B) Overview of the methods used for transdifferentiation assays. (C) Flow cytometry analysis of CD31 expression at days 0, 14, and 18 of transdifferentiation. (D) qPCR analysis of expression markers indicated in CD31+ cells harvested at day 18 of transdifferentiation. All values ​​are experimental replicates and correlated with gene expression in keratinocytes (n = 3, error bars depict sem). (E) Immunofluorescence analysis of endothelial markers CD31 and VE-cadherin at day 18 for vector-free control cells (a) and transdifferentiated cells (bf). Scale bar = 50 μm.

[0224] Figure 5 Compare with published transformations. Add additional coverage values ​​for each transformation as extra transcription factors to the list, showing coverage consistently close to 100% across eight transcription factors.

[0225] Figure 6Benchmark tests against existing cell conversion TF techniques. To show how Mogrify performs compared to other published methods for retrieving TF sets used for cell conversion, two statistics are reported. First (top), the recovery rate for each technique; a 100% recovery rate means that the technique also found all TF sets used in published conversions. The result is that if this technique has been used to design experiments, the known conversion set will be found in the first iteration. For Mogrify, this is 6 / 10 of the published conversions, while for CellNet and D'Allessio et al., this is only 1 / 10 of the published conversions. Second (bottom), the average ranking of recovered TFs is plotted. Ignoring those TFs missed by each technique, this test shows how well each managed technique handles the required TFs in a prioritized manner. Mogrify performed best in every case except for the conversion between fibroblasts and heart (cardiomyocytes). No average ranking is shown for cases where the correct TFs were not predicted. This is the case for four conversions in CellNet and one conversion in D'Alessio et al.

[0226] Figure 7 Reprogrammed landscape of human cell types. Samples were grouped using cell ontology terms provided by Forrest et al., as described above. Expression profiles containing repetitive ontology terms were arranged in the XY plane using multidimensional scaling, resulting in cell types with similar expression profiles being grouped together. The height on the landscape was then calculated according to the normalized cumulative coverage of the top 8 TFs based on Mogrify, such that the highest-ranked TF, which regulates the transitions of all desired genes, would have a height of 1, and vice versa would result in a height of 0.

[0227] Figure 8 Empirical validation of novel transitions predicted by Mogrify: induction of endothelial cells from dermal fibroblasts. A: Immunofluorescence analysis of endothelial markers PeCAM and VE-cadherin at 18 days of transdifferentiation. Scale bar, 25 μm. B: qPCR analysis showing the expression levels of endothelial-related genes VEGFR2 and VE-cadherin at 18 days of transdifferentiation.

[0228] Figure 9 Empirical validation of novel transitions predicted by Mogrify: induction of endothelial cells from hESCs. A: Immunofluorescence analysis of endothelial markers PeCAM and VE-cadherin at 18 days of transdifferentiation. Scale bar, 25 μm. B: qPCR analysis showing the expression levels of endothelial-related genes VEGFR2 and VE-cadherin at 18 days of transdifferentiation.

[0229] Figure 10Endothelial cells induced by hESC. A: Flow cytometry analysis of PeCAM expression on days 12 and 18 of transdifferentiation. FSC, forward scattering. B: Quantification of PeCAM-positive cells on day 18 of transdifferentiation. N=3.

[0230] Figure 11 Empirical validation of novel transitions predicted by Mogrify: Induction of endothelial cells from hiPSCs. A: Immunofluorescence analysis of endothelial markers PeCAM and VE-cadherin at 18 days of transdifferentiation. Scale bar, 25 μm. B: qPCR analysis showing the expression levels of endothelial-related genes VEGFR2 and VE-cadherin at 18 days of transdifferentiation.

[0231] Figure 12 A: Flow cytometry analysis of PeCAM expression in hiPSC-induced endothelial cells at days 12 and 18 of transdifferentiation. FSC, forward scattering. B: Quantification of PeCAM-positive cells at day 18 of transdifferentiation. N=3.

[0232] Figure 13 Empirical validation of novel conversion predicted by Mogrify: induction of astrocytes from fibroblasts. Immunofluorescence analysis of the astrocyte marker GFAP on day 21 of transdifferentiation. Scale bar, 25 μm.

[0233] Figure 14 Empirical validation of novel transitions predicted by Mogrify: astrocyte induction from hESCs. Immunofluorescence analysis of the astrocyte marker GFAP on day 21 of transdifferentiation. Scale bar, 25 μm.

[0234] Figure 15 Empirical validation of novel transitions predicted by Mogrify: astrocyte induction from hiPSCs. Immunofluorescence analysis of the astrocyte marker GFAP on day 21 of transdifferentiation. Scale bar, 25 μm.

[0235] Figure 16 Empirical validation of novel conversion predicted by Mogrify: astrocyte induction from BM-MSCs. Immunofluorescence analysis of the astrocyte marker GFAP on day 21 of transdifferentiation. Scale bar, 25 μm.

[0236] Figure 17 Empirical validation of novel transitions predicted by Mogrify: induction of keratinocytes from hESCs. Immunofluorescence analysis of the keratinocyte marker pankeratin on day 21 of transdifferentiation. Scale bar, 25 μm.

[0237] Figure 18Empirical validation of novel conversion predicted by Mogrify: induction of keratinocytes from hiPSCs. A: Immunofluorescence analysis of the keratinocyte marker keratin 14 (KRT14) on day 21 of transdifferentiation. Scale bar, 25 μm. B and C: Showing the keratinocyte-associated gene keratin 14 (KRT14) on day 21 of transdifferentiation. Figure 18 B) and keratin 1 ( Figure 18 qPCR analysis of the expression level of C in the sample. Detailed Implementation

[0238] It will be understood that the invention disclosed and defined in this specification extends to all alternative combinations of two or more individual features mentioned or apparent from the text or drawings. All of these different combinations constitute multiple alternative aspects of the invention.

[0239] Referring now to certain embodiments of the invention. While the invention will be described in conjunction with embodiments, it should be understood that it is not intended to limit the invention to those embodiments. Rather, the invention is intended to cover all alternatives, modifications, and equivalents that may be included within the scope of the invention as defined in the claims.

[0240] Those skilled in the art will recognize that many methods and materials similar to or equivalent to those described herein can be used in the practice of this invention. The invention is by no means limited to the methods and materials described herein. It should be understood that the invention disclosed and defined herein is extendable to all alternative combinations of two or more of the individual features mentioned or apparent from the textual or accompanying drawings. All these different combinations constitute multiple alternative aspects of the invention.

[0241] For the purposes of interpreting this specification, terms used in the singular also include the plural and vice versa.

[0242] This invention provides a practical and effective mechanism for systematically implementing cell conversion, promoting the generalization of human cell reprogramming. The invention combines gene expression data with regulatory network information to achieve what neither of these alone could accomplish—reliably and accurately identifying the transcription factors required to convert a source cell type into a cell exhibiting at least one characteristic of a target cell type. Furthermore, in some embodiments, the invention provides a set of transcription factors rather than a sorted list of all transcription factors.

[0243] Expression data for each gene in the sample can be determined using any known method, including those described herein. Data can be generated from scratch or derived from existing databases.

[0244] Differential expression can be calculated using the DESeq, edgeR, baySeq23, BBSeq24, NOISeq25, or QuasiSeq schemes, or any other method known to those skilled in the art for determining differential expression against background or pairwise comparisons in one or more samples.

[0245] The tree-based background method mentioned in the various methods of this invention is based on the principle of excluding cell types whose ontology is very close while including other cell types that are close to the background in the tree. This can be achieved by selecting a point near the top of the tree that will act as a breakpoint. Samples in the same clade as the cell type being analyzed can be removed, and those not in the same clade but still below that point can be included. The result is a sample set that is broad enough to provide reliable results, yet narrow enough to keep the statistical power at a manageable level.

[0246] An alternative to tree-based methods is Bayesian clustering, specifically the DGEclust method described by Vavoulis et al. in Genome Biology, 2015, 16:39.

[0247] To calculate the scope of influence based on transcription factor networks, any network or subnetwork containing network information sources related to the interactions of transcription factors affecting gene expression can be used. Typically, this is information related to the interactions of transcription factors with other biomolecules, such as DNA, RNA, or proteins. For example, any network information about protein-DNA interactions between transcription factors that have known binding sites in the promoter or regulatory region of a gene. An example of such a network information source is Motif Activity Response Analysis (MARA) (FANTOM Consortium, Suzuki et al. 2009. Nat Genet [Nature Genetics] 41: 553–5620). Another example of a network information source is a database of protein-protein, protein-DNA, protein-RNA, and / or biological pathway interactions. An example of such a network information source is the STRING database (a search tool for retrieving interacting genes / proteins). Examples of databases and methods used to calculate the scope of influence based on transcription factor networks are described in the examples section. Preferably, when using a MARA-derived network to generate network scores, any technique for identifying transcription start sites (such as cap analysis of gene expression (CAGE)) is used to generate gene scores.

[0248] A weighted sum of gene effects can be computed on one or more networks to generate one or more lists of effects. Preferably, at least two lists of effects are generated, such as those described herein. Weighting that can be applied includes weighting such that genes that are increasingly distant from direct regulation have a smaller effect on network scores (referred to herein as distance weighting), and weighting to compensate for highly prevalent transcription factors and to prevent them from receiving artificially high scores by regulating a large number of genes that are expressed almost indifferently (referred to herein as edge weighting).

[0249] As used herein, “Mogrify” refers to the method described herein, used to determine the transcription factors required to convert source cells into cells exhibiting at least one characteristic of target cells. In any embodiment of the invention, the Mogrify method can be implemented in a variety of computer processing systems, such as laptop computers, netbook computers, tablet computers, smartphones, desktop computers, and server computers. In one embodiment, the computer system includes a processor and a data storage device, wherein a series of computer-readable media are stored on the data storage device. In one aspect, the computer system may further include an algorithm for comparing expression profiles between source and / or target cells. In one embodiment, expression profiles or a series of expression profiles from different cell types are stored on the computer-readable media. In another embodiment, details of transcription factors involved in regulating gene networks are stored on the computer-readable media. It should be understood that the specific type of computer processing system will determine the appropriate hardware and architecture to be used.

[0250] Gene and network scores can be determined using any of the methods described in this article (including examples).

[0251] Transcription factors can be ranked using any of the methods described herein, which consider scores, such as gene and network scores as described herein, or influence lists as described herein. Preferably, transcription factors are ranked using scores or influence lists based on differential expression analysis and / or scores or influence lists based on interactions of transcription factors that directly and / or indirectly affect gene expression.

[0252] To identify the set of TFs for a given transformation, compare the sorted lists from the source cell and target cell types. If a TF from the target cell type list is already expressed in the source target, it can be removed from that list.

[0253] Removing transcriptionally redundant TFs from the sorted list for each cell type can be done by any of the methods described herein, including by comparing the list of genes directly regulated by each TF. For a given TF, if there is a higher-sorted TF that regulates more than 98% of the genes it regulates, it can be removed. Therefore, the resulting predictions include TFs that differ in their range of regulatory influence.

[0254] The process of reprogramming cells alters the types of offspring that cells can produce and includes different processes such as forward programming and transdifferentiation. In some embodiments, forward programming of multipotent cells (or pluripotent cells) provides cells exhibiting at least one characteristic of a cell type that has a more differentiated phenotype than the multipotent cell. In other embodiments, transdifferentiation of a somatic cell provides cells exhibiting at least one characteristic of another somatic cell type.

[0255] This invention provides compositions and methods for directly reprogramming or transdifferentiating source cells into target cells, without the source cells becoming induced pluripotent stem cells (iPS) before becoming target cells. Transdifferentiation is highly efficient compared to iPS cell technology and carries a very low risk of teratoma formation for downstream applications. Furthermore, transdifferentiation can be used in vivo to directly convert one cell type into another, which iPS cell technology cannot do.

[0256] The source cell can be any cell type described herein, including somatic cells or diseased cells. The somatic cell can be an adult cell or a cell derived from an adult that displays one or more detectable characteristics of adult or non-embryonic cells. The diseased cell can be a cell that displays one or more detectable characteristics of a disease or condition; for example, the diseased cell can be a cancer cell that displays one or more clinical or biochemical markers of cancer. Examples of source cells include hematopoietic cells, such as lymphocytes, myeloid cells; buccal mucosal cells, epidermal cells, mesenchymal cells, keratinocytes, and hepatocytes. Examples of source cells are shown in Tables 4a and 4b.

[0257] As used herein, the term "somatic cell" refers to any cell that forms the body of an organism, as opposed to germ cells. In mammals, germ cells (also called "gametes") are sperm and eggs, which fuse during fertilization to produce a cell called a zygote, from which the entire mammalian embryo develops. Every other cell type in a mammalian body—besides sperm and eggs, the cells that make them (gametocytes), and undifferentiated stem cells—is a somatic cell: internal organs, skin, bones, blood, and connective tissue are all made up of somatic cells. In some embodiments, a somatic cell is a "non-embryonic somatic cell," meaning a somatic cell that is not present in or derived from an embryo and is not derived from the in vitro proliferation of such cells. In some embodiments, a somatic cell is an "adult somatic cell," meaning a cell that is present in or derived from an organism other than an embryo or fetus, or is the result of the in vitro proliferation of such cells. Somatic cells can be immortalized to provide an unlimited supply of cells, for example, by increasing the level of telomerase reverse transcriptase (TERT). For example, TERT levels can be increased by increasing TERT transcription from endogenous genes or by introducing transgenes through any gene delivery method or system.

[0258] Unless otherwise instructed, methods for reprogramming somatic cells can be performed in vivo and in vitro (wherein in vivo is performed when somatic cells are present in the subject and in vitro is performed where isolated somatic cells held in a culture are used).

[0259] Embryonic cells (such as embryonic stem cells) may be derived from embryonic cell lines rather than directly from the embryo or fetus. Alternatively, embryonic cells may be derived from the embryo or fetus, but the cells may be obtained or isolated without disrupting or negatively affecting the development of the embryo or fetus.

[0260] In the method of this invention, differentiated somatic cells (including cells derived from fetuses, newborns, juveniles, or adult primates, including humans) are suitable source cells. Suitable somatic cells include, but are not limited to, bone marrow cells, epithelial cells, endothelial cells, fibroblasts, hematopoietic cells, keratinocytes, hepatocytes, intestinal cells, mesenchymal cells, myeloid progenitor cells, and spleen cells. Alternatively, somatic cells may be cells capable of self-proliferation and differentiation into other cell types, including hematopoietic stem cells, muscle / skeletal stem cells, brain stem cells, and liver stem cells. Suitable somatic cells are readily accepting or can be made to accept the uptake of transcription factors (including the genetic material encoding these transcription factors) using methods generally known in the scientific literature. Uptake enhancement methods may vary depending on cell type and expression system. Exemplary conditions for preparing receptive somatic cells with suitable transduction efficiency are well known to those skilled in the art. The starting somatic cells may have a doubling time of approximately twenty-four hours.

[0261] As used herein, the term "isolated cell" refers to a cell that has been removed from the organism in which it was originally discovered, or a descendant of such a cell. Optionally, the cell has been cultured in vitro, for example, in the presence of other cells. Optionally, the cell is subsequently introduced into a second organism or reintroduced into the organism from which it was isolated (or the cell from which it was passed down).

[0262] As used herein, the term "separated population" in relation to a separated cell population refers to a cell population that has been removed and separated from a mixed or heterogeneous cell population. In some embodiments, a separated population is a substantially pure cell population compared to a heterogeneous population from which cells have been isolated or enriched.

[0263] Regarding a specific cell population, the term "substantially pure" means a cell population that is at least about 75%, preferably at least about 85%, more preferably at least about 90%, and most preferably at least about 95% pure relative to the cells constituting the total cell population. Similarly, the terms "substantially pure" or "essentially pure" regarding a target cell population refer to a cell population containing less than about 20%, more preferably less than about 15%, 10%, 8%, 7%, and most preferably less than about 5%, 4%, 3%, 2%, 1%, or less than 1% of cells that are not target cells or their progeny as defined herein.

[0264] As used herein, the term “cancer” refers to cells with autonomous growth capacity, that is, an abnormal state or condition characterized by rapidly proliferating cell growth. The term is intended to include all types of cancerous growth or carcinogenic processes, metastatic tissue, or malignant transformation of cells, tissues, or organs, regardless of histopathological type or stage of invasiveness. The term “cancer” includes malignant tumors of various organ systems, such as those affecting the lungs, breast, thyroid, lymph nodes, gastrointestinal tract, and genitourinary tract, as well as adenocarcinomas, including most colon cancers, renal cell carcinomas, prostate and / or testicular tumors, non-small cell lung cancer, small bowel cancer, and esophageal cancer. The term “carcinoma” is recognized in the field and refers to malignant tumors of epithelial or endocrine tissues, including respiratory cancers, gastrointestinal cancers, genitourinary cancers, testicular cancers, breast cancers, prostate cancers, endocrine system cancers, and melanomas. Exemplary cancers include those arising from cervical, lung, prostate, breast, head and neck, colon, and ovarian tissues. The term "cancer" also includes carcinosarcoma, for example, which includes malignant tumors containing both carcinomatous and sarcomatous tissue. "Adenocarcinoma" refers to cancer originating from glandular tissue or cancer in which tumor cells form identifiable glandular structures. The term "sarcoma" is the generally accepted term in the field and refers to a mesenchymal-derived malignant tumor.

[0265] As used herein, references to “target cell” may refer to any one or more cells referred to herein as target cells or target cell types (such as those in the top row of Tables 4a and 4b).

[0266] When a source cell exhibits at least one characteristic of a target cell type, the source cell is determined to have been converted into a target cell or become a target-like cell by the method of the present invention. For example, when a cell exhibits at least one characteristic of a target cell type, a human fibroblast is identified as having been converted into a keratinocyte-like cell. Typically, the cell will exhibit 1, 2, 3, 4, 5, 6, 7, 8, or more characteristics of the target cell type. For example, when the target cell is a keratinocyte, the cell is identified or determined to be a keratinocyte-like cell when upregulation of any one or more keratinocyte markers and / or changes in cell morphology can be detected, preferably keratinocyte markers including keratin 1, keratin 14, and epidermal proteins, and the cell morphology is cobblestone-like. In any aspect of the invention, target cell characteristics can be determined by analyzing cell morphology, gene expression profiles, activity assays, protein expression profiles, surface marker profiles, or differentiation capacity. Examples of characteristics or markers include those described herein and those known to those skilled in the art. Other examples of relevant biomarkers include, for example, biomarkers for the conversion of keratinocytes to hematopoietic stem cells (HSCs): CD45 (pan-hematopoietic biomarker), CD19 / 20 (B cell biomarker), CD14 / 15 (myeloid), CD34 (progenitor / SC biomarker), CD90 (SC), and α-integrin (keratinocyte biomarker not expressed by HSCs); and biomarkers for the conversion of human embryonic stem cells to hematopoietic stem cells: RUNX1 (GFP), CD45 (pan-hematopoietic biomarker), CD19 / 20 (B cell biomarker). Transcriptional markers (CD14 / 15 (myeloid), CD34 (progenitor / SC marker), CD90 (SC), Tra-1-160 (ESC marker not expressed in HSCs); Rejuvenation of aged or adult HSCs: Comparison between transcriptional markers in young and aged HSCs (e.g., using RNA-seq), and functional characterization of “rejuvenated HSCs” obtained by transplanting rejuvenated cells into animals and then assessing them at 1, 3, and 6 months to determine myeloid bias, where the disappearance of myeloid bias indicates “rejuvenated” HSCs. Examples of many of the markers for the conversions described herein are shown in Table 1 below.

[0267] Table 1: Exemplary biomarkers for target cells

[0268] The transcription factors mentioned herein are referred to by the HUGO Gene Nomenclature Committee (HGNC) symbols. Exemplary nucleotide sequences for each transcription factor are shown in Tables 2a, 2b, and 3 below. These nucleotide sequences were derived from the Ensembl database (Flicek et al. (2014). Nucleic Acids Research Volume 42, Issue D1. Pp. D749-D755 [Nucleic Acids Research Volume 42, Issue D1. Pp. D749-D755]) 83rd edition. Any homologs, orthologs, or paralogs of the transcription factors mentioned herein are also considered for use in this invention.

[0269] Tables 2a and 2b below show the Ensemb1 gene accession number (nucleotide sequence; NT seq) and exemplary transcription factors (TFs) that can be used according to the methods described herein. The source cell type is shown in the leftmost column, and the target cell type is shown in the top row. Transcription factors that can be used to convert source cell types into cells exhibiting at least one characteristic of the target cell type are shown.

[0270] Table 2a:

[0271]

[0272]

[0273]

[0274] Table 2b:

[0275] The term "variant" refers to a polypeptide that is at least 70%, 80%, 85%, 90%, 95%, 98%, or 99% identical to a full-length polypeptide. This invention contemplates the use of variants of the transcription factors described herein, including the sequences listed in Tables 2a and 2b. The variant can be a fragment of the full-length polypeptide or a naturally occurring splice variant. The variant can be a polypeptide that is at least 70%, 80%, 85%, 90%, 95%, 98%, or 99% identical to a fragment of the polypeptide, wherein the fragment is at least 50%, 60%, 70%, 80%, 85%, 90%, 95%, 98%, or 99%, provided that the full-length wild-type polypeptide or its domain has the functional activity of interest, such as the ability to promote conversion of a source cell type to a target cell type. In some embodiments, the domain is at least 100, 200, 300, or 400 amino acids long, starting from any amino acid position in the sequence and extending toward the C-terminus. Variations known in the art that eliminate or substantially reduce protein activity are preferably avoided. In some embodiments, the variant lacks the N-terminal and / or C-terminal portions of the full-length polypeptide, for example, lacking up to 10, 20, or 50 amino acids from either end. In some embodiments, the polypeptide has the sequence of a mature (full-length) polypeptide, meaning a polypeptide in which one or more portions (such as a signal peptide) have been removed during normal intracellular protein hydrolysis (e.g., during co-translation or post-translational processing). In some embodiments where the protein is not produced by purifying it from a cell that naturally expresses it, the protein is a chimeric polypeptide, meaning it contains portions from two or more different species. In some embodiments where the protein is not produced by purifying it from a cell that naturally expresses it, the protein is a derivative, meaning the protein contains additional sequences unrelated to the protein, provided these sequences do not substantially diminish the protein's biological activity. Those skilled in the art will recognize or will readily be able to determine whether a particular polypeptide variant, fragment, or derivative is functional using assays known in the art. For example, the ability of a variant of a transcription factor to convert a source cell to a target cell type can be assessed using assays disclosed in the examples herein. Other convenient assays include measuring the ability to activate reporter construct transcription, the reporter construct containing a transcription factor binding site operatively linked to a nucleic acid sequence encoding a detectable marker such as luciferase. In some embodiments of the invention, the functional variant or fragment has at least 50%, 60%, 70%, 80%, 90%, 95% or more of the activity of the full-length wild-type polypeptide.

[0276] The term "increase in the amount of" in relation to increasing the amount of transcription factors refers to increasing the amount of transcription factors in cells of interest (e.g., source cells such as fibroblasts or keratinocytes). In some embodiments, the amount of transcription factors is "increased" in cells of interest (e.g., cells in which an expression cassette encoding a polynucleotide that directs the expression of one or more transcription factors is introduced) when the amount of transcription factors is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more relative to a control (e.g., fibroblasts or keratinocytes in which none of the expression cassettes are introduced). However, any method of increasing the amount of transcription factors is considered, including any method of increasing the amount of transcription factors (or the pre-mRNA or mRNA encoding them), transcription rate or efficiency, translation, stability or activity. Furthermore, downregulation or interference with negative regulators of transcriptional expression, increasing the efficiency of existing transcription (e.g., SINEUP), is also considered.

[0277] As used herein, the term "reagent" refers to any compound or substance, such as, but not limited to, small molecules, nucleic acids, polypeptides, peptides, pharmaceuticals, ions, etc. "Reagent" can be any chemical, entity, or portion, including but not limited to synthetic and naturally occurring protein and non-protein entities. In some embodiments, the reagent is a nucleic acid, nucleic acid analog, protein, antibody, peptide, aptamer, nucleic acid oligomer, amino acid, or carbohydrate, including but not limited to proteins, oligonucleotides, ribozymes, DNases, glycoproteins, siRNA, lipoproteins, aptamers, and modifications, and combinations thereof. In some embodiments, the reagent is a small molecule having a chemical moiety. For example, the chemical moiety includes unsubstituted or substituted alkyl, aromatic, or heterocyclic moieties, including macrolides, leptomycin, and related natural products or analogues thereof. The compound may be known to have the desired activity and / or properties, or may be selected from a library of diverse compounds.

[0278] When used in relation to proteins, genes, nucleic acids, or polynucleotides in cells or organisms, the term "exogenous" means a protein, gene, nucleic acid, or polynucleotide introduced into that cell or organism by artificial or natural means; or, when related to cells, it means a cell isolated by artificial or natural means and subsequently introduced into another cell or organism. Exogenous nucleic acids can originate from different organisms or cells, or they can be one or more additional copies of nucleic acids naturally present within that organism or cell. Exogenous cells can originate from different organisms, or they can originate from the same organism. By way of non-limiting example, exogenous nucleic acids are nucleic acids located at a different chromosomal position than those in natural cells, or otherwise flanked by nucleic acid sequences different from those found in nature. Exogenous nucleic acids can also be extrachromosomal, such as augmentative vectors.

[0279] Screening one or more candidate reagents for the ability to increase the amount of one or more transcription factors required to convert a source cell type to a target cell type may include the steps of contacting a system that allows the expression of a product or transcription factor with the candidate reagent and determining whether the amount of the transcription factor has been increased. This system may be in vivo, such as in tissues or cells of an organism; or in vitro, cells isolated from an organism or in vitro transcription assay; or ex vivo, in cells or tissues. The amount of the transcription factor may be measured directly or indirectly, and by measuring the amount of protein or RNA (e.g., mRNA or pre-mRNA). The candidate reagent acts by increasing the amount of the transcription factor or increasing the translation of the corresponding mRNA through increasing any step in the transcription of the gene encoding the transcription factor. Alternatively, the candidate reagent may reduce the repressive activity of a transcriptional repressor of the gene encoding the transcription factor or reduce the activity of molecules that cause degradation of the mRNA encoding the transcription factor or the protein of the transcription factor itself.

[0280] Suitable detection methods include the use of labeled substances such as radioactive nucleotides, enzymes, coenzymes, fluorescent agents, chemiluminescent agents, chromogens, enzyme substrates or cofactors, enzyme inhibitors, cofactor complexes, free radicals, particles, dyes, etc. Such labeled reagents can be used in a variety of well-known assays, such as radioimmunoassays, enzyme immunoassays (e.g., ELISA), and fluorescence immunoassays. See, for example, U.S. Patent Nos. 3,766,162; 3,791,932; 3,817,837; and 4,233,402.

[0281] The methods of this invention include high-throughput screening applications. For example, a high-throughput screening assay can be used, which includes any assay according to the invention, wherein aliquots of a system that allows expression of a product or transcription factor are exposed to a variety of candidate reagents in different wells of a multi-well plate. Furthermore, in any type of miniaturized assay system, the high-throughput screening assay according to this disclosure involves aliquots of a system that allows expression of a product or transcription factor, which are exposed to a variety of candidate reagents.

[0282] In the assay system, the method of the present invention can be "miniaturized" by any acceptable miniaturization method, including but not limited to multiwell plates (such as 24, 48, 96, or 384 wells per plate), microchips, or glass slides. The size of the assay can be reduced to be performed on a microchip support, advantageously involving smaller amounts of reagents and other materials. Any miniaturization of the method that facilitates high-throughput screening is within the scope of the present invention.

[0283] In any method of the present invention, the target cells can be transferred into the same mammal from which the source cells were obtained. In other words, the source cells used in the methods of the present invention can be autologous cells, i.e., obtained from the same individual from whom the target cells are to be given. Alternatively, the target cells can be allogeneically transferred into another individual. Preferably, in methods for treating or preventing a medical condition in an individual, the cells are autologous to the subject.

[0284] The term "cell culture medium" (also referred to herein as "culture medium" or "medium") as used herein is a culture medium containing nutrients that maintain cell viability and support proliferation for culturing cells. This cell culture medium may contain any of the following (in a suitable combination): one or more salts, one or more buffer solutions, amino acids, glucose or other one or more sugars, antibiotics, serum or serum substitutes, and other components such as peptide growth factors. Cell culture media commonly used for specific cell types are known to those skilled in the art. Exemplary cell culture media used in the methods of the present invention are shown in Table 9.

[0285] Table 3: Accession numbers for the nucleotide and amino acid sequences of the transcription factors mentioned in this article.

[0286]

[0287] Nucleic acids or vectors containing nucleic acids as described herein may include one or more sequences mentioned in Table 3 or sequences encoding any one or more amino acid sequences listed in Table 3.

[0288] The term “expression” refers to the cellular processes involved in the production of RNA and proteins, and (where appropriate) the secretion of proteins, including (where applicable) but not limited to, for example, transcription, translation, folding, modification and processing.

[0289] As used herein, the terms “isolated” or “partially purified” in the case of nucleic acids or peptides refer to nucleic acids or peptides isolated from at least one other component (e.g., nucleic acid or peptide) present together with the nucleic acid or peptide as found in its natural source and / or when expressed by a cell (or secreted in the case of a secreted peptide). Chemically synthesized nucleic acids or peptides, or nucleic acids or peptides synthesized using in vitro transcription / translation, are considered “isolated”.

[0290] The term "vector" refers to a DNA molecule into which a DNA sequence can be inserted for introduction into a host or source cell. Preferred vectors are those capable of autonomously replicating the nucleic acids linked to them and / or expressing the nucleic acids linked to them. Vectors capable of directing the expression of genes operatively linked to them are referred to herein as "expression vectors." Thus, an "expression vector" is a specialized vector containing the necessary regulatory regions required for the expression of a gene of interest in a host cell. In some embodiments, the gene of interest is operatively linked to another sequence in the vector. The vector can be a viral vector or a non-viral vector. If a viral vector is used, it is preferably a replication-deficient vector, which can be achieved, for example, by removing all viral nucleic acids encoding replication. A replication-deficient viral vector will retain its infectivity and enter the cell in a manner similar to a replicating adenovirus vector, but once inside the cell, the replication-deficient viral vector will not reproduce or replicate. Vectors also include liposomes and nanoparticles, as well as other means of delivering DNA molecules into cells.

[0291] The term "operably ligated" refers to placing a regulatory sequence necessary for the expression of a coding sequence at the appropriate position within the DNA molecule relative to the coding sequence in order to achieve the expression of that coding sequence. This same definition sometimes applies to the arrangement of the coding sequence and transcriptional control elements (e.g., promoters, enhancers, and termination elements) in an expression vector. The term "operably ligated" includes having an appropriate start signal (e.g., ATG) preceding the polynucleotide sequence to be expressed and maintaining the correct reading frame to allow expression of the polynucleotide sequence under the control of the expression control sequence and to produce the desired polypeptide encoded by that polynucleotide sequence.

[0292] The term "viral vector" refers to the use of a virus or virus-associated vector as a delivery vehicle for nucleic acid constructs to enter cells. Constructs can be integrated and packaged into the genome of a non-replicating defective virus, such as adenovirus, adeno-associated virus (AAV), or herpes simplex virus (HSV), or others, including retroviral and lentiviral vectors, for infecting or transducing cells. The vector may or may not be incorporated into the cell's genome. If desired, the construct can contain a viral sequence for transfection. Alternatively, the construct can be incorporated into vectors capable of appendage replication (e.g., EPV and EBV vectors).

[0293] As used in this article, the term "adenovirus" refers to viruses of the Adenoviridae family. Adenoviruses are medium-sized (90-100 nm) non-enveloped (naked) icosahedral viruses composed of a nucleocapsid and a double-stranded linear DNA genome.

[0294] As used herein, the term "non-integrating viral vector" refers to a viral vector that does not integrate into the host genome; the expression of the gene delivered by the viral vector is transient. Because it integrates almost entirely into the host genome, non-integrating viral vectors have the advantage of inserting at random points in the genome without causing DNA mutations. For example, non-integrating viral vectors remain extrachromosomal and do not insert their genes into the host genome, potentially disrupting the expression of endogenous genes. Non-integrating viral vectors may include, but are not limited to, adenoviruses, alphaviruses, picornaviruses, and vaccinia viruses. These viral vectors are referred to herein as "non-integrating" viral vectors, although in rare cases any of them may integrate viral nucleic acids into the host cell's genome. Crucially, the viral vectors used in the methods described herein typically, or as a major part of their life cycle, do not integrate their nucleic acids into the host cell's genome.

[0295] The vectors described herein can be constructed and engineered using methods generally known in the scientific literature to enhance their safety for use in therapy, including the selection and enrichment of biomarkers and, if desired, optimization of the expression of the nucleotide sequences contained thereon. These vectors should include structural components that allow the vector to self-replicate in the source cell type. For example, the known Epstein-Barr (EBV) oriP / nuclear antigen-1 (EBNA-I) combination (see, e.g., SE and B. Sugden, The plasmid replicon of Epstein-Barr virus: mechanistic insights into efficient, licensed, extrachromosomal replication in human cells, Plasmid [Plasmid] 58:1 (2007), as set forth herein, is incorporated herein by reference in its entirety) is sufficient to support vector self-replication, and other combinations known to function in mammalian (particularly primate) cells may also be employed. The standard techniques used to construct expression vectors suitable for this invention are well known to those skilled in the art and can be found in publications such as Sambrook J et al., “Molecular cloning: a laboratory manual,” (3rd ed. Cold Spring Harbor Press, Cold Spring Harbor, NY 2001) (as set forth herein, the entire text of which is incorporated herein by reference).

[0296] In the method of this invention, genetic material encoding relevant transcription factors required for conversion is delivered into source cells via one or more reprogramming vectors. Each transcription factor can be introduced into the source cell as a polynucleotide transgene encoding a transcription factor operatively linked to a heterologous promoter that can drive the expression of the polynucleotide in the source cell.

[0297] Suitable reprogramming vectors are any of those described herein, including augmentative vectors, such as plasmids, that do not encode all or part of a viral genome sufficient to produce an infectious or replicating competent virus, although these vectors may contain structural elements derived from one or more viruses. One or more reprogramming vectors can be introduced into a single source cell. One or more transgenes can be provided on a single reprogramming vector. A strong constitutive transcription promoter can provide transcriptional control for multiple transgenes, which can be provided as an expression cassette. Individual expression cassettes on a vector can be under the transcriptional control of individual strong constitutive promoters, which can be copies of the same promoter or can be different promoters. Various heterologous promoters are known in the art and can be used depending on factors such as the desired expression level of transcription factors. As illustrated below, it may be advantageous to use different promoters with different strengths in the source cell to control the transcription of individual expression cassettes. Another consideration in selecting a transcription promoter is the rate of silencing of one or more promoters. Those skilled in the art will understand that reducing the expression of one or more transgenes or transgene expression cassettes may be advantageous after the product of one or more genes has completed or substantially completed its role in the reprogramming method. Exemplary promoters include the human EF1α extension factor promoter, the CMV cytomegalovirus immediate early promoter, and the CAG chicken albumin promoter, as well as corresponding homologous promoters from other species. In human cells, both EF1α and CMV are strong promoters, but the CMV promoter silences more effectively than the EF1α promoter, resulting in transgene expression being shut down more quickly under the former's control than under the latter's. These transcription factors can be expressed in source cells at relative ratios that can be altered to regulate reprogramming efficiency. Preferably, when multiple transgenes are encoded on a single transcript, an internal ribosome entry site is provided upstream of one or more transgenes, away from the transcription promoter. Although the relative ratios of factors can vary depending on the delivered factors, an optimal ratio of factors can be determined by one of ordinary skill in the art with this disclosure.

[0298] Those skilled in the art will understand that introducing all factors via a single vector, rather than multiple vectors, is more efficient, but introducing the vector becomes increasingly difficult as the total vector size increases. Those skilled in the art will also understand that the position of transcription factors on the vector can affect their temporal expression and the resulting reprogramming efficiency. Therefore, the applicant employs various factor combinations with vector combinations. Several such combinations to support reprogramming are shown here.

[0299] After the introduction of one or more reprogramming vectors, and while the source cells are reprogrammed, these vectors can persist in the target cells, and the introduced transgenes are transcribed and translated. In cells already reprogrammed to the target cell type, transgene expression can be advantageously downregulated or turned off. The one or more reprogramming vectors may remain extrachromosomal. With very low efficiency, the one or more vectors can be integrated into the cell's genome. The following examples are intended to illustrate and are in no way limiting of the invention.

[0300] Suitable methods for converting nucleic acid delivery in cells, tissues or organisms suitable for the present invention are considered to substantially include any method that can introduce nucleic acids (e.g., DNA) into cells, tissues or organisms, as described herein or as known to those skilled in the art (e.g., Stadtfeld and Hochedlinger, Nature Methods 6(5):329-330 (2009); Yusa et al., Nat. Methods 6:363-369 (2009); Woltjen et al., Nature 458, 766-770 (April 9, 2009)). Such methods include, but are not limited to, direct delivery of DNA, such as by in vitro transfection (Wilson et al., Science, 244:1344-1346, 1989; Nabel and Baltimore, Nature, 326:711-713, 1987), optionally with lipid-based transfection reagents such as Fugene6 (Roche) or Lipofectamine (Invitrogen), by injection (US Patent Nos. 5,994,624, 5,981,274, 5,945,100, 5,780,448, 5,736,524, 5,702,932, 5,656,610, 5,589,466 and 5,580,859, each incorporated herein by reference), including microinjection (Harland and Weintraub, J. Cell). Biol. [Journal of Cell Biology], 101:1094-1099, 1985; US Patent No. 5,789,215, incorporated herein by reference); by electroporation (US Patent No. 5,384,253, incorporated herein by reference; Tur-Kaspa et al., Mol. Cell Biol. [Molecular and Cell Biology], 6:716-718, 1986; Potter et al., Proc. Nat'l Acad. Sci. USA [Proceedings of the National Academy of Sciences of the United States of America], 81:7161-7165, 1984); by calcium phosphate precipitation (Graham and Van Der Eb, Virology [Virusology], 52:456-467, 1973; Chen and Okayama, Mol. Cell Biol. [Molecular and Cell Biology], 7(8):2745-2752, 1987; Rippe et al., Mol. Cell Biol.[Molecular and Cell Biology], 10:689-695, 1990); by using DEAE-dextran followed by polyethylene glycol (Gopal, Mol. Cell Biol. [Molecular and Cell Biology], 5:1188-1190, 1985); by direct acoustic loading (Fechheimer et al., Proc. Nat'l Acad. Sci. USA [Proceedings of the National Academy of Sciences], 84:8463-8467, 1987); by liposome-mediated transfection (Nicolau and Sene, Biochim. Biophys. Acta [Acta Biochimica Sinica], 721:185-190, 1982; Fraley et al., Proc. Nat'l Acad. Sci. USA [Proceedings of the National Academy of Sciences], 76:3348-3352, 1979; Nicolau et al., MethodsEnzymol. [Enzymatic Methods], 149:157-176, 1987; Wong et al., Gene, 10:87-94, 1980; Kaneda et al., Science, 243:375-378, 1989; Kato et al., J Biol. Chem., 266:3361-3364, 1991) and receptor-mediated transfection (Wu and Wu, Biochemistry, 27:887-892, 1988; Wu and Wu, J. Biol. Chem., 262:4429-4432, 1987); and any combination of such methods, each of which is incorporated herein by reference.

[0301] Many peptides capable of mediating the introduction of relevant molecules into cells have been previously described, and these peptides are applicable to the present invention. See, for example, Langel (2002) Cell Penetrating Peptides: Processes and Applications, CRC Press, Pharmacology and Toxicology Series. Examples of polypeptide sequences that enhance transmembrane transport include, but are not limited to, the Drosophila homeotype protein Anthrapodiform (AntHD) (Joliot et al., New Biol. 3:1121-34, 1991; Joliot et al., Proc. Natl. Acad. Sci. USA, 88: 1864-8, 1991; Le Roux et al., Proc. Natl. Acad. Sci. USA, 90: 9120-4, 1993); the herpes simplex virus structural protein VP22 (Elliott and O'Hare, Cell 88: 223-33, 1997); and the HIV-1 transcription activator TAT protein (Green and Loewenstein, Cell 55: 1179-1188, 1988; Frankel and Pabo, Cell 55: 1). 289-1193, 1988); Kaposi's FGF signaling sequence (kFGF); Protein transduction domain-4 (PTD4); Transmembrane peptide, M918, Transporter-10; Nuclear localization sequence, PEP-1 peptide; Amphiphilic peptide (e.g., MPG peptide); Delivery-enhancing transporters, such as those described in U.S. Patent No. 6,730,293 (including, but not limited to, peptide sequences containing at least 5-25 or more consecutive arginines in a continuous set of 30, 40, or 50 amino acids; including, but not limited to, peptides having sufficient guanidino or amidine moieties, such as at least 5 guanidino or amidine moieties); and commercially available Penetratin™ 1-peptide and Diatos peptide carriers (“DPV”) of the Vectocell® platform available from Daitos SA, Paris, France. See also WO / 2005 / 084158 and WO / 2007 / 123667 and other transporters described therein. These proteins can not only cross the plasma membrane, but the attachment of other proteins (such as transcription factors described herein) is sufficient to stimulate cellular uptake of these complexes.

[0302] Table 4a. Exemplary conversions of the present invention. The leftmost column shows the source cell type, and the top row shows the target cell type. The transcription factors required to convert the source cell type into a cell exhibiting at least one characteristic of the target cell type are shown.

[0303]

[0304]

[0305] Table 4b. Other exemplary transformations of the present invention. The source cell types are shown in the leftmost column, and the target cell types are shown in the top row. The transcription factors required to transform the source cell types into cells exhibiting at least one characteristic of the target cell type are shown.

[0306]

[0307] The present invention includes the following non-limiting embodiments.

[0308] Example Example 1 To predict the set of TFs required for each cell transition, we identified those TFs that exerted regulatory influence not only on differentially expressed genes between cell types but also on other differentially expressed genes in the local network (see [link to relevant documentation]). Figure 1A By combining logarithmic multiple changes and adjustments p A single score is used to define the differential expression of each gene in each cell type. This is achieved by analyzing known interactosets (such as those defined by STRING and MARA, see [reference]). Figure 1C The regulatory effect of each TF in each cell type is calculated by performing a weighted summation of differential expression scores. This sum is weighted by two factors: (1) by the directness of regulation, i.e., how many intermediates are between the TF and the downstream gene, and (2) by specificity, i.e., the number of other genes that the upstream TF also regulates. This weighted sum allows TFs to be ranked in each cell type according to their effects. The final step is to select the optimal set of TFs that has the greatest combined effect on genes differentially expressed in the target cell type compared to the source cell. This can be done by adding TFs to the set in order of their differential effects, omitting those that do not increase the effect of the set, until the combined effect reaches 98% of the expressed target cell genes (see [link to relevant documentation]). Figure 1D (and the methods described below). From a biological perspective, Mogrify identifies the following TFs, which are the portions of the regulatory networks that are most responsible for controlling the identity of target cell types.

[0309] Mogrify may include one or more steps, which are outlined below and described in more detail in the following sections: 1. Collect expression data for each gene (x) in each sample (s).

[0310] 2. Calculate the differential expression of each gene in each sample against a tree-based background, and then perform a logarithmic fold change (...). ) and adjusted P-value ( The combination of these elements yields the gene score. ).

[0311] 3. For each TF in each sample ( x ), through two different subnets centered on each TF ( and The network score (N) is calculated by performing a weighted summation of gene scores on the network. S ).

[0312] 4. Based on and The combinations of scores are sorted into TFs.

[0313] 5. Based on comparisons from sorted lists for each cell type, calculate the set of transcription factors used for conversion between any two cell types.

[0314] 6. Remove redundant transcriptional TFs from these lists.

[0315] 7. Create a cell transformation landscape by arranging cell types on a 2D plane based on the required TFs and adding height based on the average coverage of the required genes (directly regulated by the selected TFs).

[0316] Step 1: Representation data from the FANTOM5 dataset Mogrify used 700 clustered CAGE tag libraries, which provided TSS locations. These were mapped to their corresponding genes (provided by the FANTOM5 consortium (Forrest, ARR et al., Nature [Nature] 507, 462–470 (2014)). Tag counts were created for each gene in each library using this data. In at least one sample, a total of 15,878 distinct genes (1,408 of which were TFs) were expressed at at least 20 TPM (tags per million).

[0317] Step 2: Tree-based differential representation Computing differential expression is a common problem when analyzing biological data, and many techniques exist to do so. We chose to use DESeq for this work because it performs well in benchmarks, allows for the analysis of some non-replicated datasets, and has a short runtime. To compute differential expression, it is necessary to identify two groups: the sample set in which differential expression is to be identified and the background to be compared. Choosing the right background is crucial. Too many irrelevant samples reduce the statistical power of the test. A background sample set that is too narrow or too small makes it impossible to determine which genes are truly differentially expressed. One solution is to exhaustively compute pairwise tests between each cell type. This approach has two problems: first, it is computationally very expensive, and second, it does not reveal the genes that are differentially expressed between the sample and the average background, but rather the genes that are differentially expressed precisely between the two samples. For Mogrify, we are interested in genes that are important for a given cell type in all cases and therefore for the sample set. To do this, we implemented a tree-based background selection method based on the FANTOM5 cell ontology (…). Figure 1B The principle behind this method is to exclude cell types whose ontology is very similar, while including other cell types in the tree that are close to the background. This is achieved by selecting points near the top of the tree that will act as breakpoints. Samples in the same clade as the cell type being analyzed are removed, and those not in the same clade but still below this point are included. The result is a sample set that is broad enough to provide reliable results, yet narrow enough to keep the statistical power at a manageable level.

[0318] This tree-based background selection, performed by running DEseq on all FANTOM5 libraries (grouped by repeats), creates logarithmic fold change and FDR adjustment for each gene in each sample. p Values. Due to the presence of a non-uniform background, the results of each differential expression calculation cannot be directly compared. Therefore, for the remaining steps, these numbers are used to rank the genes in each sample, and it is a ranking for comparison.

[0319] Since we are only interested in identifying high-impact TFs, we use the following equation to adjust for logarithmic multiples and FDRs. p Value converted to a single positive score ( ): Equation 1: , in ● It represents the logarithmic fold change of gene x in sample s.

[0320] ● It is the adjusted p-value of gene x in sample s.

[0321] This formula ensures high logarithmic multiple changes and low adjusted values. p Those genes with high scores are those with low scores, and vice versa. This applies to every gene in every sample, creating 700 samples from a matrix of 15,878 differentially expressed genes.

[0322] Step 3: Calculate the influence range based on the TF network To assess the importance of each TF, two network information sources were used to calculate its impact on its local neighborhood: the STRING database and Motif Activity Response Analysis (MARA). These two techniques, described below, contain different types of interactions. MARA provides protein-DNA interactions between TFs with known binding sites in gene promoter regions. This represents a low-level, directed regulatory network of interactions. STRING is an interaction meta-database containing various types of interactions, including protein-protein, protein-DNA, protein-RNA, and biological pathways. This provides a view of interactions that directly and indirectly affect gene expression.

[0323] To calculate this effect, a weighted summation of the gene effect (from step 2) is performed over the local network neighborhood of the transcription factor. This local network is restricted to a maximum of 3 edges, and the effect of each node is further reduced from its seed TF and dependent on the out-degree of its parent. Figure 1C Distance weighting is used to reduce the impact of genes that are increasingly distant from directly regulated genes on the score. Margin weighting is used to compensate for highly prevalent transcription factors and to prevent them from receiving artificially high scores by regulating a large number of genes with negligible differential expression. We consider regulating 10 genes with... = 100 genes TF ratio regulate 1000 genes with The TF of genes with a value of 1 is more important.

[0324] The equation used to perform this weighted summation is: Equation 2:

[0325] in: ● These are the nodes (V) that make up the local subnets of TFs. x Each gene (r) in the set.

[0326] ● Is r far away from network n? The level (or number of steps).

[0327] ● It is the degree of the parent of r in network n.

[0328] This was performed on the MARA and STRING networks, resulting in two TF impact lists ( and ).

[0329] Step 4: Sort TF based on the results of Steps 2 and 3 The results of steps 3 and 4 are based on , and For each sample, three ranked lists of TFs are generated. To obtain the final ranking of each TF in each sample, its ranking in each of the three lists is summed together. The ranking is limited to a maximum of 100, as we observed that the remaining regulatory effects are very small after the top 100 TFs. If a TF does not appear in a particular list, then it is given a score of 100. The result is a single ranked list of TFs for each cell type; those with the lowest scores / ranks are those that predict promoting cell conversion.

[0330] Step 5: Calculate all pairwise experimental comparisons to create predictions To predict the set of TFs for a given transformation, compare sorted lists from source and target cell types. If a TF from the target cell type list is already expressed in the source target (greater than 20 TPM), remove it from that list.

[0331] Step 6: Remove redundant transcriptional TFs Once the final ranking is complete, regulatory redundancy is removed. This is done by comparing the list of genes directly regulated by each TF. For a given TF, if a higher-ranked TF exists that regulates more than 98% of the genes it regulates, it is removed. This means that the resulting predictions include TFs with different regulatory influence ranges. This cutoff is empirically chosen to minimize the number of predictors while maximizing network coverage. Figure 5 ).

[0332] Step 7: Create a cell reprogramming landscape based on steps 1-6 To create a reprogramming landscape, we are independent of Z Coordinates were calculated X and Y Coordinates. To reduce landscape complexity, we averaged the gene expression profiles of individual samples from cell ontology groups provided by FANTOM5. The result was an ensemble of 314 ontologies containing at least three samples from which we obtained the average gene expression. These profiles were calculated using multidimensional scaling (MDS). X and Y Coordinates. The result of MDS is a projection of the data, where the distances between points are maintained from multidimensional reality to two-dimensional dimensionality reduction. The result is that in the landscape... X - YTwo points adjacent to each other in a plane have similar expression profiles and therefore represent similar cell types. Landscape coverage is calculated by considering the regulatory coverage of the top 8 Mogrify-predicted TFs. Z Axis. For each transformation, we examine the set of genes expressed in the ontology, and the number of these directly regulated by each TF. We calculate the area under the curve of the cumulative coverage of the top 8 TFs normalized to the maximum possible AUC to retrieve values ​​between 0 and 1 as height for each ontology. Thus, height 1 indicates an ontology where all desired genes are directly regulated by the highest-ranked TF, and height 0 indicates that none of the top 8 TFs directly regulates any desired gene. This is then used in the R package plot3D. X , Y and Z Values ​​were calculated to generate landscapes using the image2D and persp3D packages. Gene set enrichment scores of 0.41 were found for different stem cells at the highest positions. p The value is 0.011.

[0333] Example 2 To evaluate Mogrify's predictive power, we first determined how Mogrify counteracts well-known, previously published direct cell conversions, focusing on those involving human cells. These should not be considered as an absolutely perfect combination, but rather as positive examples for comparison. Figure 2 As shown, in almost every case, Mogrify predicts the complete set of TFs previously proven to work, but sometimes includes upstream TFs instead of the published factors. For example, it is known that by introducing... OCT4 (also known as) POU5F1), SOX2, KLF4 and MYC or OCT4, SOX2, NANOG and LIN28 It can convert human fibroblasts into iPS cells. Mogrify predicts... NANOG, OCT4 and SOX2As the first three TFs for this conversion, a combination that has also been experimentally validated. Previous work has demonstrated that the expression of CEBPa and PU.1 (also known as SPI1) can convert B cells and fibroblasts into macrophage-like cells (Xie, H., Ye, M., Feng, R. & Graf, T. Cell [Cell] 117, 663–676 (2004); Rapino, F. et al. Cell Rep. [Cell Communications] 3, 1153–63 (2013)), and Mogrify fully predicted this. For the conversion of human dermal fibroblasts into cardiomyocytes, we chose not to use data from the FANTOM5 set because it lacks many key cardiomyocyte genes (indicating insufficient sample availability). However, using heart samples (a heterogeneous and less than ideal tissue), Mogrify's prediction list included four of the five TFs (or closely related factors) used in human conversion (Fu, J.-D. et al. Stem cell reports [Stem Cell Communications] 1, 235–47 (2013)). There are many reports in the literature about the transdifferentiation of various cell types into neurons in mice and humans (Table 5).

[0334] Table 5: Leading to changes in neuronal phenotype. In each case, the set of transcription factors used to convert the source cell type to the target cell type is shown.

[0335]

[0336] The TF sets used were diverse (possibly due to the heterogeneity and complexity of neurons), however, Mogrify predicted factors common to all experiments (Table 6).

[0337] Table 6: Mogrify predictions for transdifferentiation between human dermal fibroblasts and neurons. TFs are ranked according to their Mogrify scores, and those shown in italics are those selected by Mogrify as non-redundant for other higher-ranked TFs.

[0338]

[0339] Finally, between human fibroblasts and hepatocytes, Mogrify predicted a high degree of similarity between the combination of TFs required for conversion and maturation. Figure 2 ).use Figure 2Based on the transformations shown in the figure, we evaluated the ability of Mogrify, CellNet, and entropy-based methods from D'Alessio et al. to recover these known factors (Stem Cell Reports, Volume 5, Issue 5, 10 November 2015, Pages 763–775). The average recovery rates of the reported transcription factors were 84% for Mogrify, 31% for CellNet, and 51% for D'Alessio et al. Figure 6 ).exist Figure 2 Of the ten transformations, Mogrify recovered 100% of the required TFs, meaning that if Mogrify were used to provide the TF sets for these transformations, the experiment could potentially succeed on the first try. On the other hand, CellNet and D'Allesio et al. only recovered all factors from one of the ten transformations.

[0340] Mogrify maps the landscape of human cell types based on their natural states and transitions, capturing a core set of control TFs describing each cell type, even though Mogrify's primary goal is to predict TFs for cell transitions. This is thought to help researchers reveal the roles of different TFs in their preferred cell types. In practice, Mogrify represents a significant advancement over current laboratory strategies for cell reprogramming, helping to predict TFs whose overexpression will induce targeted cell transitions. Mogrify has pre-calculated transitions between all possible combinations of 307 FANTOM5 tissue / cell types, resulting in 93,942 targeted transitions. If expression markers (e.g., RNAseq or CAGE) are known, Mogrify can be applied to many other cell types not included in FANTOM5. Mogrify provides a starting point and systematic approach for exploring novel transitions in humans. Because Mogrify incorporates a TF redundancy step, it is able to provide a limited set of TFs as predictions of cell transitions, which is more useful than simply sorting all TFs.

[0341] To compare Mogrify's performance with other methods, benchmark experiments were conducted. First, the impact on performance using the full Mogrify algorithm was evaluated, compared to using MARA, STRING, and differentially expressed components alone. Second, comparisons were made with CellNet and D'Allesio et al. These are currently the only other techniques that provide a means to compute transcription factor sets for a wide range of cell types. For comparison, data from... Figure 2The published set of converted transcription factors shown is used as a true positive. The benchmark assay consists of evaluating the performance of each technique in recovering these TFs using the following steps: 1) For each conversion, the number of transcription factors to be considered is determined: Mogrify is the only method that provides a set of TFs rather than a sorted list of all TFs, and since the goal is to compare other methods with Mogrify, the information generated by Mogrify regarding the number of factors to use is shared with other methods; that is, no method allows the use of more factors than other methods. For example, for the conversion between B cells and macrophages, Mogrify predicts that 8 TFs should be sufficient, so for all methods, the first 8 TFs are used for comparison.

[0342] 2) For each method, identify whether the correct transcription factors have been predicted: For each published set of transcription factors, compare the predictions of each method and extract two statistics. First, the recovery rate of the published transcription factors (i.e., 100% if all published factors are included in the prediction set), and second, the average rank of the published factors (i.e., summing the ranks for each correctly identified TF and dividing by the total number of correctly identified TFs).

[0343] The results of these two steps can be found in Tables 7 and 8, and a summary of the comparison between Mogrify and CellNet and D'Allesio et al. can be found in... Figure 6 Found it.

[0344] To extract the CellNet results, we used publicly available datasets of fibroblasts (GSE14897) and B cells (GSE65136) as our starting point, and used the CellNet web interface (cellnet.hms.harvard.edu) for... Figure 2 Each transformation in the model provides a prediction. D'Allessio et al. provided sorted TF sets for many cell types and used these sorted lists for comparison.

[0345] Table 7: Benchmark detection results comparing the performance of Mogrify, CellNet, and D'Alessio et al. (For...) Figure 2For each transformation, a prediction for each technology is shown. The ranking lists from CellNet and D'Alessio et al. are cut off by the size of the collection from Mogrify. To compare these collections, the average ranking and overall recovery efficiency of the published collections were extracted. These statistics serve as a guide to show the performance achievable for each technology in these transformations. Failure to identify published transcription factors does not necessarily mean that the predicted transcription factors from each technology will not transform these cells; this benchmark test was designed to evaluate performance based solely on available data. For CellNet's predictions for myoblasts, skeletal muscle GRNs were used.

[0346]

[0347]

[0348] Table 8: Benchmark test results comparing the performance of Mogrify and its individual components (MARA, STRING, and differential expression). For Figure 2 For each transformation, the predictions for Mogrify and each individual component of Mogrify are shown. The ordination lists from MARA, STRING, and differentially expressed components are cut off at the size of the set predicted by Mogrify. To compare these sets, the mean ordination and overall recovery efficiency of the published sets were extracted. These statistics serve as a guide to show the performance achievable by each technology in these transformations. Failure to identify published transcription factors does not necessarily mean that the predicted transcription factors from each technology will not transform these cells; this benchmark assay is designed to evaluate performance solely based on available data.

[0349]

[0350]

[0351] Example 3 To empirically demonstrate Mogrify's predictive ability, we performed 11 novel cell transformations using human cells: • Fibroblasts to keratinocytes (results are in Example 4); • Keratinocytes to endothelial cells (results are in Example 5); • Fibroblasts to endothelial cells (results are in Example 6); • Embryonic stem cells to endothelial cells (results are shown in Example 7); • Induction of pluripotent stem cells into endothelial cells (results are shown in Example 8); • Fibroblasts to astrocytes (results in Example 9); • Embryonic stem cells to astrocytes (results are in Example 10); • Induction of pluripotent stem cells into astrocytes (results are shown in Example 11); • Bone mesenchymal stem cells to astrocytes (results are in Example 12). • Embryonic stem cells to keratinocytes (results in Example 13); and • Induction of pluripotent stem cells into keratinocytes (results are shown in Example 14).

[0352] Materials and methods are described in this embodiment.

[0353] Lentiviral generation For lentiviral generation, 293T human embryonic kidney (HEK; Sigma) cells were cultured in T-75 flasks. Once they reached 90-95% confluence, they were transfected with LTX lipoamine (Ingenie) transfection agent using the -lv165 vector expressing (from the EF1α promoter) related transcription factors (e.g., CDH1, FOS, FOXQ1, HOXB6, IRF1, MAFB, REL, SMAD1, SOX9, SOX17, TAL1, TCF7L1, MXD4, NFKB1, SOX2, ARNT2, RUNX2, PAX6, SNAI2, HMGB2, E2F1, MYC, FOSL2, or TFAP2A) and IRES2-eGFP (GeneCopoeia), as well as the second-generation Trono laboratory packaging plasmids psPAX2 and pMD2.G (Addgene). Viral supernatants were collected at 24 and 36 hours post-transfection and concentrated using an ultracentrifuge filter (Millipore). The viral concentrate was then stored at -80ºC. Titration was performed based on eGFP expression as determined by flow cytometry. The cell lines used in these experiments were tested negative for mycoplasma contamination.

[0354] Cell culture Before using them in experiments, human adult epidermal keratinocytes (HEKa; GIBCO) and human dermal fibroblasts (HDF; GIBCO) were sized at 2.5 x 10⁻⁶ cm⁻¹. 3 cells / cm 2Expand and passage at least 3 times. HEKa cells were cultured in serum-free keratinocyte medium (KSFM; GIBCO) containing 10% HKGS (GIBCO) and 1% Pen / Strep (GIBCO). Meanwhile, HDF cells were cultured in medium 106 (GIBCO) containing 10% LSGS (GIBCO) and 1% Pen / Strep. Cells were then frozen in liquid nitrogen for later use. For transdifferentiation of keratinocytes into endothelial cells, cells were thawed and passaged at 2.5 x 10⁻⁶ cells / year. 3 cells / cm 2 Inoculate until they reach 90% confluence. Then in KSFM medium at 5.0 x 10⁻⁶ cm⁻¹. 3 cells / cm 2 They were re-inoculated for two days, then infected in KSFM medium with concentrated lentiviral particles containing HOXB6, IRF1, SMAD1, SOX17, TAL1, and TCF7L1 in the presence of polyglobulin (Millibert). After virus addition (12–24 hours), the medium was replaced with fresh KSFM medium. On day 4, the medium was replaced with serum-free human endothelial cell medium (GIBCO) containing 1% Pen / Strep human VEGF (50 ng / μl; PeproTech), human BMP4 (20 ng / μl; PeproTech), and human FGF2 (20 ng / μl; PeproTech). For transdifferentiation of fibroblasts into keratinocytes, cells were cultured at 2.5 x 10⁻⁶ cells / year. 3 cells / cm 2 Inoculate until they reach 90% confluence. Then in mouse fibroblast culture medium (MEFM) at 2.5 x 10⁻⁶. 3 cells / cm 2 Re-inoculate for 24 hours, then transduce for 24 hours in MEFM with lentiviral particles containing CDH1, FOS, FOXQ1, MAFB, REL, and SOX9 in the presence of polyglobulin. On day 4, replace the medium with KSFM medium containing 1% Pen / Strep, retinoic acid, and human BMP4 (R&D). Add fresh medium at least once every two days throughout all experiments. Each experiment was repeated 3–4 times.

[0355] Table 9. The table below shows the cell culture media that can be used to culture other cell types.

[0356]

[0357] Flow cytometry At different time points, positively differentiated cells were dissociated with 0.25% trypsin-EDTA (GIBCO) at 37ºC for 3 min. Cells were then prepared for flow cytometry analysis or sorting. They were incubated with anti-human CD31-APC (17-0319-41, eBioscience) at 4ºC for 15 min, washed with DPBS (GIBCO), centrifuged at 1000 rpm for 7 min, and then resuspended in medium containing propidium iodide (Sigma-Aldrich). An LSR-II analyzer (BD Bioscience) and an Influx cell sorter (BD Bioscience) were used for data analysis and sorting, respectively.

[0358] qPCR Total RNA was extracted using the RNeasy microreactor kit (Qiagen) according to the manufacturer's instructions. The extracted RNA was reverse transcribed into cDNA using the Superscript III kit (Ingenieur). Real-time quantitative PCR reactions were established in triplicate using Brilliant II SYBR Green qPCR premix (Stratagene) and then run on a 7500 real-time PCR system. The primer sequences for qPCR are: F-CD31: CCTTCTGCTCTGTTCAAGCC R-CD31: GGGTCAGGTTCTTCCCATTT F-VE:ATGAGAATGACAATGCCCCG R-VE:TGTCTATTGCGGAGATCTGCAG F-VEGFR2:GGCCCAATAATCAGAGTGGCA R-VEGFR2: CCAGTGTCATTTCCGATCACTTT F-KERATIN1:AGAGGTGGACCAACTGAAGAGT R-KERATIN1:ATTCTCTGCATTTGTCCGCTT F-KERATIN14:AGACCAAAGGTCGCTACTGC R-KERATIN14:AGGAGAACTGGGAGGAGGAG F-epidermal protein: CTGCCTCAGCCTTACTGTGA R-epithelial protein: GGAGGAGGAACAGTCTTGAGG F-β-actin: CATGTACGTTGCTATCCAGGC R-β-actin: CTCCTTAATGTCACGCACGAT Immunofluorescence Cells were fixed with 4% paraformaldehyde in DPBS for 10 minutes at room temperature. Permeabilization was not necessary as the markers of interest were expressed on the cell surface. Cells were blocked with 5% donkey serum in DPBS for 30 minutes and then incubated overnight at 4ºC with primary antibodies (goat polyclonal anti-CD31, sc-1506; Santa Cruz; and rabbit polyclonal anti-VE-cadherin, ab33168; abcam). The next day, cells were incubated for 2 hours at room temperature with secondary antibodies (donkey anti-goat Alexa Flour-555 (Ingenieur) and donkey anti-rabbit Alexa Flour-647 (Ingenieur)). Finally, cells were covered with 4',6-diamidinyl-2-phenylindole (DAPI; Life Technologies) for 1 minute. All images were taken using an inverted Nikon Eclipse T with a Nikon Digital Sight DS-U2 camera. i Images were captured using an epifluorescence microscope and processed and analyzed using FIJI software.

[0359] Example 4 - Transformation of human fibroblasts into keratinocytes (iKer) For this conversion, cells were analyzed using Mogrify-predicted FOXQ1, SOX9, MAFB, CDH1, FOS, and REL ( Figure 3 (A in Table 10) Transduction.

[0360] Table 10: Mogrify predictions for transdifferentiation between human dermal fibroblasts and keratinocytes. The order in this table represents the original sorting, and those in italics are those selected by Mogrify as a non-redundant set to be used for reprogramming.

[0361]

[0362] By day 16 post-transduction, keratinocyte-associated markers keratin 1, keratin 14, and epidermal protein were significantly upregulated in transdifferentiated cells. Figure 3(C in the text). Furthermore, within three weeks, most transduced cells exhibited a cobblestone morphology, a classic characteristic of keratinocytes. Adjacent untransduced GFP-negative cells or control cells transduced with GFP virus only maintained their fibroblast morphology (…). Figure 3 (The arrow in D in the diagram). This morphological and molecular characterization of the reprogrammed cells indicates that Mogrify successfully predicted the TFs necessary for inducing the conversion of human fibroblasts into keratinocyte-like cells.

[0363] Example 5 - Adult keratinocytes (HEKa) to microvascular endothelial cells (iEC) For this conversion, we selected SOX17, TAL1, SMAD1, IRF1, and TCF7L1 from the six TFs recommended by Mogrify. Figure 4 Use as per Table 11).

[0364] Table 11: Mogrify predictions for transdifferentiation between human keratinocytes and microvascular endothelial cells. The order in this table represents the original sorting, and those in italics are those selected by Mogrify as a non-redundant set to be used for reprogramming.

[0365]

[0366] These five TFs are predicted to regulate approximately 92% of the genes required for iEC. Once these TFs are overexpressed in HEKa cells, we determined that the cells need to be maintained in their culture medium until day four. Figure 4 B in the text). We used FACS by using the well-established endothelial cell marker CD31 (… Figure 4 We used qPCR (C) to track the dynamics of cell reprogramming, and on day 14 post-transduction, we detected upregulated CD31 in over 2% of infected cells, and nearly 10% on day 18. At that point, we isolated those CD31 cells and evaluated endothelial-associated genes (EIAs) by qPCR. CD31 VE-cadherin and VEGFR2 The expression of ) leads to significant reactivation of all assessed genes ( Figure 4 (D in the original text). Finally, we performed immunofluorescence (IF) to verify the morphology and expression of the transdifferentiated cells. Figure 4 As shown in E, only cells transduced with the predicted TF, rather than control cells, exhibited the correct morphology and expressed CD31 and VE-cadherin on their surface. This morphological and molecular characterization of the reprogrammed cells indicates that human keratinocytes have successfully transformed into human endothelial-like cells.

[0367] Example 6 - Fibroblasts to Endothelial Cells Transcription factors used: SOX17, SMAD1, TAL1, IRF1, TCF7L1, and MXD4. (Mogrify also identified the factor JUNB, but did not use it).

[0368] Transdifferentiation strategy: Human dermal fibroblasts were cultured in LSGS (Life Technologies) medium 106 at a rate of 5,000 cells / cm² for 24 hours prior to viral transduction of transcription factors. 2 The cells were seeded into well plates. On the second day, the lentiviral particles encoding these transcription factors were transduced into cells in medium 106 using polyglobulin (Merck Millipore). The well plates were then centrifuged at 1900 rpm for 60 minutes immediately after transduction. On day 5, the medium was replaced with endothelial medium (medium 131, Lifesciences) supplemented with VEGF (50 ng / ml, Miltenyi Biotechnology), FGF2 (20 ng / ml, Miltenyi Biotechnology), and BMP4 (20 ng / ml, Miltenyi Biotechnology). The medium was changed every 2 days throughout the experiment.

[0369] Immunofluorescence analysis showed evidence of expression of the endothelial markers PeCAM and VE-cadherin at 18 days of transdifferentiation. Figure 8 (A in the middle).

[0370] qPCR analysis also revealed the expression levels of endothelial cell-related genes VEGFR2 and VE-cadherin at 18 days of transdifferentiation. Figure 8 (B in the middle).

[0371] Example 7 - Embryonic stem cells to endothelial cells Transcription factors used: SOX17, SMAD1, TAL1, NFKB1, and IRF1. (Mogrify also identified HOXB7 and JUNB, but did not use these).

[0372] Transdifferentiation strategy: Human embryonic stem cells (H9) were cultured in Essential 8 medium (Life Sciences, Inc.) at a concentration of 5,000 cells / cm² 24 hours before viral transduction of transcription factors. 2Cells were seeded into matrix gel-coated (BD Falcon) wells. On the second day, lentiviral particles encoding these transcription factors were transduced into cells in Essential 8 medium using polyglobulin (Merck Millipore). The wells were then centrifuged at 1900 rpm for 60 minutes immediately after transduction. On day 5, the medium was replaced with endothelial medium (medium 131, Life Sciences) supplemented with VEGF (50 ng / ml, Miltenyi Biotechnology), FGF2 (20 ng / ml, Miltenyi Biotechnology), and BMP4 (20 ng / ml, Miltenyi Biotechnology). The medium was changed every 2 days throughout the experiment.

[0373] Immunofluorescence analysis showed the expression of endothelial markers PeCAM and VE-cadherin at 18 days of transdifferentiation. Figure 9 (A in the middle).

[0374] qPCR analysis revealed the expression levels of endothelial cell-related genes VEGFR2 and VE-cadherin at 18 days of transdifferentiation. Figure 9 (B in the middle).

[0375] Figure 10 The results of flow cytometry analysis of PeCAM expression on days 12 and 18 of transdifferentiation are shown, as well as the quantification of PeCAM-positive cells on day 18 of transdifferentiation.

[0376] Example 8 - Pluripotent stem cells to endothelial cells Transcription factors used: SOX17, TAL1, NFKB1, IRF1, and SMAD1. (Mogrify also identified the factors HOXB7 and JUNB, but did not use them).

[0377] Transdifferentiation strategy: Human induced pluripotent stem cells (32F donor) were introduced into an essential 8-cell culture medium (Lifetech Corporation) at a concentration of 5,000 cells / cm² 24 hours before viral transduction of transcription factors. 2 The cells were seeded onto matrix gel-coated (BD Folcon) wells. On the second day, lentiviral particles encoding these transcription factors were transduced into cells in Essential 8 medium using polyglobulin (Merck Millipore). The wells were then centrifuged at 1900 rpm for 60 minutes immediately after transduction. On day 5, the medium was replaced with endothelial medium (medium 131, Life Sciences) supplemented with VEGF (50 ng / ml, Miltenyi Biotechnology), FGF2 (20 ng / ml, Miltenyi Biotechnology), and BMP4 (20 ng / ml, Miltenyi Biotechnology). The medium was changed every 2 days throughout the experiment.

[0378] Immunofluorescence analysis showed the expression of endothelial markers PeCAM and VE-cadherin at 18 days of transdifferentiation. Figure 11 (A in the middle).

[0379] qPCR analysis revealed the expression levels of endothelial cell-related genes VEGFR2 and VE-cadherin at 18 days of transdifferentiation. Figure 11 (B in the middle).

[0380] Figure 12 Flow cytometry analysis of PeCAM expression at days 12 and 18 of transdifferentiation is shown. FSC (forward scattering) and quantification of PeCAM-positive cells were performed on day 18 of transdifferentiation.

[0381] Example 9 - From fibroblasts to astrocytes Transcription factors used: SOX2, SOX9, ARNT2, SMAD1, and RUNX2. (Mogrify also identified factors E2F5 and PBX1, but did not use these).

[0382] Transdifferentiation strategy: Human dermal fibroblasts were cultured in LSGS (Life Technologies) medium 106 at a rate of 5,000 cells / cm² for 24 hours prior to viral transduction of transcription factors. 2 The cells were seeded into wells. On the second day, lentiviral particles encoding these transcription factors were transduced into cells in medium 106 using polyglobulin (Merck Millipore). The wells were then centrifuged at 1900 rpm for 60 minutes immediately after transduction. On day 5, the medium was replaced with astrocyte culture medium (Lifetechnologies) supplemented with IL1β (10 ng / ml, Sigma-Aldrich). On day 7, the medium was replaced with astrocyte culture medium. The medium was changed every 2 days throughout the experiment.

[0383] Immunofluorescence analysis showed the expression of the astrocyte marker GFAP on day 21 of transdifferentiation. Figure 13 ).

[0384] Example 10 - Embryonic stem cells (H9) to astrocytes Transcription factors used: IRF1, SOX9, ARNT2, PAX6, SNAI2, RUNX2. (Mogrify also predicted factor SOX5, but did not use it).

[0385] Transdifferentiation strategy: Human embryonic stem cells (H9) were cultured in Essential 8 medium (Life Sciences, Inc.) at a concentration of 5,000 cells / cm² 24 hours before viral transduction of transcription factors. 2The cells were seeded onto matrix gel-coated (BD Falcon) well plates. On the second day, lentiviral particles encoding these transcription factors were transduced into cells in Essential 8 medium using polyglobulin (Merck Millipore). The well plates were then centrifuged at 1900 rpm for 60 minutes immediately after transduction. On day 2, the medium was replaced with N2 medium supplemented with B27 (Lifetech) and 0.6 μM CHIR99021 (Medrin Biotech). On day 6, the medium was replaced with astrocyte culture medium (Lifetech) supplemented with IL1β (10 ng / ml, Sigma-Aldrich). On day 8, the medium was replaced with astrocyte culture medium. The medium was changed every 2 days throughout the experiment.

[0386] Immunofluorescence analysis showed the expression of the astrocyte marker GFAP on day 21 of transdifferentiation. Figure 14 ).

[0387] Example 11 - Pluripotent stem cells to astrocytes Transcription factors used: PAX6, SNAI2, RUNX2, HMGB2. (Mogrify also predicted factors POU3F2, E2F5, and SOX5, but these were not used).

[0388] Transdifferentiation strategy: Human induced pluripotent stem cells (32F donor) were introduced into an essential 8-cell culture medium (Lifetech Corporation) at a concentration of 5,000 cells / cm² 24 hours before viral transduction of transcription factors. 2 The cells were seeded onto matrix gel-coated (BD Folcon) wells. On the second day, lentiviral particles encoding these transcription factors were transduced into cells in Essential 8 medium using polyglobulin (Merck Millipore). The wells were then centrifuged at 1900 rpm for 60 minutes immediately after transduction. On day 2, the medium was replaced with N2 medium supplemented with B27 (Lifetech) and 0.6 μM CHIR99021 (Medrin Biotech). On day 6, the medium was replaced with astrocyte culture medium (Lifetech) supplemented with IL1β (10 ng / ml, Sigma-Aldrich). On day 8, the medium was replaced with astrocyte culture medium. The medium was changed every 2 days throughout the experiment.

[0389] Immunofluorescence analysis showed the expression of the astrocyte marker GFAP on day 21 of transdifferentiation. Figure 15 ).

[0390] Example 12 - Mesenchymal stem cells to astrocytes Transcription factors: SOX2, SOX9, ARNT2, MYBL2, E2F1, HMGB2. (Mogrify also identified factors HOXB7 and JUNB, but did not use them).

[0391] Transdifferentiation strategy: Bone marrow mesenchymal stem cells (7081 donor) were cultured in MSC medium (α-MEM containing 15% FBS, glutamine, penicillin, and streptomycin; Life Sciences, Inc.) at a concentration of 5,000 cells / cm² for 24 hours prior to viral transduction of transcription factors. 2 The cells were seeded into wells. On the second day, lentiviral particles encoding these transcription factors were transduced into MSC medium using polyglobulin (Merck Millipore). The wells were then centrifuged at 1900 rpm for 60 minutes immediately after transduction. On day 5, the medium was replaced with astrocyte culture medium (Lifetechnologies) supplemented with IL1β (10 ng / ml, Sigma-Aldrich). On day 7, the medium was replaced with astrocyte culture medium. The medium was changed every 2 days throughout the experiment.

[0392] Immunofluorescence analysis showed the expression of the astrocyte marker GFAP on day 21 of transdifferentiation. Figure 16 ).

[0393] Example 13 - Embryonic stem cells to keratinocytes Transcription factors used: SOX9, NFKB1, MYC, FOSL2. (Mogrify also predicted factors NR2F2, FOSL1, and AHR, but these were not used).

[0394] Transdifferentiation strategy: Human embryonic stem cells (H9) were cultured in Essential 8 medium (Life Sciences, Inc.) at a concentration of 5,000 cells / cm² 24 hours before viral transduction of transcription factors. 2 Cells were seeded into matrix gel-coated (BD Falcon) wells. On the second day, lentiviral particles encoding these transcription factors were transduced into cells in Essential 8 medium using polyglobulin (Merck Millipore). The wells were then centrifuged at 1900 rpm for 60 minutes immediately after transduction. On the second day, the medium was replaced with Essential 8 medium containing 3 μM retinoic acid. On the sixth day, the medium was replaced with EpiLife medium (Lifetech Corporation) supplemented with BMP4 (50 ng / ml, Miltenyi Biotechnology) and EGF (5 ng / ml, Miltenyi Biotechnology). The medium was changed every 2 days throughout the experiment.

[0395] Immunofluorescence analysis showed the expression of the keratinocyte marker pankeratin on day 21 of transdifferentiation. Figure 17 ).

[0396] Example 14 - Pluripotent stem cells to keratinocytes Transcription factors: TFAP2A, MYC, SOX9, NFKB1. (Mogrify also predicted factors TP63 and NFKBIA, but these were not used).

[0397] Transdifferentiation strategy: Human induced pluripotent stem cells (32F donor) were introduced into an essential 8-cell culture medium (Lifetech Corporation) at a concentration of 5,000 cells / cm² 24 hours before viral transduction of transcription factors. 2 Cells were seeded onto matrix gel-coated (BD Folcon) wells. On the second day, lentiviral particles encoding these transcription factors were transduced into cells in Essential 8 medium using polyglobulin (Merck Millipore). The wells were then centrifuged at 1900 rpm for 60 minutes immediately after transduction. On the second day, the medium was replaced with Essential 8 medium containing 3 μM retinoic acid. On the sixth day, the medium was replaced with EpiLife medium (Lifetech Corporation) supplemented with BMP4 (50 ng / ml, Miltenyi Biotechnology) and EGF (5 ng / ml, Miltenyi Biotechnology). The medium was changed every 2 days throughout the experiment.

[0398] Immunofluorescence analysis showed the expression of the keratinocyte marker keratin 14 (KRT14) on day 21 of transdifferentiation. Figure 18 (A in the middle).

[0399] qPCR analysis showed the expression levels of keratin 14 and keratin 1, keratinocyte-related genes, on day 21 of transdifferentiation. Figure 18 (B in 18 and C in 18).

[0400] Example 15 Several attempts have been made to generate representative cellular landscapes, but these have focused on one or two cell types and are based on path integral quasi-potentials, mechanistic modeling, or probabilistic landscapes. The inventors hypothesize that, in combination with transcriptional profiling, comparing all-against-all TF network differences identified by Mogrify will allow the creation of 3D landscapes representing human cell types. Figure 7 This landscape places those molecularly similar cell types that are clustered together in a specific location. x - y On a plane, the height is adjusted according to the likelihood that the cell type will become a good source of starting cells. z(See online resources and methods for details). Interestingly, we observed that different stem cells were placed at the highest points. This could indicate that the transcriptional networks of those cells at the highest points in the landscape are controlled by fewer TFs, and that the more differentiated the cells become (in the valleys), the more TFs are needed to fine-tune the transcriptional networks.

Claims

1. A computer-implemented method for determining transcription factors required to reprogram source cells into cells exhibiting at least one characteristic of a target cell type, the method comprising the steps of: - Determine the differential expression of genes in the source cell type and the target cell type; - Based on differential gene expression on at least one network, determine the network score for each transcription factor (TF) in each of the source cell type and the target cell type; wherein the network contains information on protein-protein interactions, protein-DNA interactions, and / or protein-RNA interactions, and / or wherein the network contains information on interactions between the transcription factor and gene regulatory regions; wherein the network score for each TF is calculated by weighted summation of differential expression information determined on at least one subnetwork centered on the TF; and - The TFs are ranked based on a combination of a TF ranking list based on regulatory network scores and a TF ranking list based on differential gene expression information; wherein the lowest-ranked TF is predicted to promote the reprogramming of the source cells into cells exhibiting at least one characteristic of the target cell type; thereby identifying a set of transcription factors for reprogramming the source cells into cells exhibiting at least one characteristic of the target cell type.

2. The method according to claim 1, wherein, The method further includes the following steps: removing TFs with transcriptional redundancy from the sorted list by comparing the list of genes directly regulated by each TF; and removing a given TF if a higher-ranked TF regulates more than 98% of the genes in the list regulated by the TF.

3. The method according to claim 1 or 2, wherein, A network score for each TF is calculated by weighted summation of differentially expressed information identified on at least one subnetwork centered on the TF, weighted by the distance to the TF and the out-degree of the parent node; and / or, wherein the subnetwork centered on the TF includes genes within 3 edges of the TF.

4. The method according to any one of claims 1 to 3, wherein, Determining differential gene expression in the source cell type and the target cell type includes: determining a gene score for each differentially expressed gene in the source cell type and the target cell type, wherein the gene score is a combination of the logarithmic fold change of differential expression and an adjusted p-value.

5. The method according to claim 4, wherein, The gene scores are calculated using tree-based methods or Bayesian clustering.

6. The method according to any one of claims 1 to 5, wherein, The at least one network contains information on protein-DNA interactions, protein-protein interactions, and / or protein-RNA interactions from the STRING database, a search tool for retrieving interacting genes / proteins. And / or, wherein the at least one network includes information on interactions between transcription factors and gene regulatory regions derived from motif activity response analysis (MARA).

7. A method for generating cells from source cells that exhibit at least one characteristic of target cells, the method comprising: - Using the method of any one of claims 1 to 6, determine the transcription factors required to reprogram source cells of the source cell type into cells exhibiting at least one characteristic of the target cell type; as well as - Increase the amount of transcription factors identified in the source cells.

8. The method according to claim 7, further comprising: The source cells are cultured for a sufficient time, under conditions that allow for reprogramming into target cells; Thus, cells generated from source cells exhibiting at least one characteristic of target cells; wherein the at least one characteristic of the target cells is the upregulation of any one or more target cell markers and / or changes in cell morphology.

9. The method according to claim 7 or claim 8, wherein, The target cells are selected from the group consisting of: chondrocytes, hair follicles, CD4+ T cells, CD8+ T cells, NK cells, hematopoietic stem cells (HSCs), adipose mesenchymal stem cells (MSCs), bone marrow mesenchymal stem cells (MSCs), oligodendrocytes, oligodendrocyte precursors, skeletal muscle cells, smooth muscle cells and fetal cardiomyocytes, endothelial cells, astrocytes, keratinocytes and epithelial cells.

10. The method according to any one of claims 7 to 9, wherein, The amount of one or more transcription factors in the source cells is increased by contacting the source cells with a reagent that increases the amount of one or more transcription factors, wherein the reagent is selected from: nucleotide sequences, proteins, aptamers, small molecules, ribosomes, RNAi reagents, and peptide-nucleic acid (PNA); or wherein the amount of one or more transcription factors is increased by introducing at least one nucleic acid sequence encoding a transcription factor protein.

11. The method according to any one of claims 7 to 10, wherein, The source cells are cultured for a sufficient time under conditions that allow reprogramming into target cells, including culturing the source cells for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 days.

12. The method according to any one of claims 1 to 11, wherein, Determining differential gene expression in the source and target cell types includes: for each differentially expressed gene, using Equation 1 to combine the logarithmic fold change of differential expression in the source and target cell types with an adjusted p-value as a gene score. Equation 1: , in, Let x be the logarithmic fold change of gene x in sample s. is the adjusted p-value for gene x in sample s.

13. The method according to any one of claims 1 to 12, wherein, The network score of transcription factor x in cell type s on network n ( Calculate using Equation 2: Equation 2: , in, It is the component of TF Nodes of the local subnet (V) x Each gene (r) in the set. It is the number of steps r takes to move away from x in network n. It is the gene score of gene r determined in the step of determining differential gene expression in the source cell type and the target cell type. It is the degree of the parent of r in network n.

14. The method according to any one of claims 1 to 13, wherein, Identifying a set of transcription factors for converting the source cell type into cells exhibiting at least one characteristic of the target cell type includes: comparing a sorted list of the target cell types with a set of genes identified as expressed in the source cell types; wherein, if a TF in the list of target cell types is already expressed in the source cell type, it is removed from the sorted list.

15. The method according to any one of claims 1 to 14, wherein, Based on differential gene expression on at least one network, determine the network score for each transcription factor (TF) in each of the source cell type and the target cell type, including: determining a first network score for each TF on a first network and a second network score for each TF on a second network, wherein the first network includes protein-DNA interactions between TFs having known binding sites in gene promoter regions, and the second network includes protein-protein, protein-DNA, and protein-RNA interactions.

Images