Nucleic acid molecules, vectors and pharmaceutical compositions targeting ifit1 for myocardial infarction therapy and uses thereof
By silencing IFIT1 mRNA through nucleic acid molecules targeting IFIT1, the problem of cardiomyocyte loss and insufficient regeneration capacity after myocardial infarction was solved, significantly improving cardiac function and reducing fibrosis, thus enhancing cardiac repair.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SHANGHAI SONGJIANG DISTRICT CENTRAL HOSPITAL
- Filing Date
- 2026-01-23
- Publication Date
- 2026-06-09
AI Technical Summary
In the existing technology, a large number of cardiomyocytes are lost after myocardial infarction and their regenerative capacity is limited. This is closely related to the deterioration of cardiac function and the development of heart failure. Abnormal activation of the IFIT1 signaling pathway weakens the efficacy of transplanted MSCs and CPCs, and there is a lack of effective intervention strategies to maintain or restore the cell repair potential.
Nucleic acid molecules targeting IFIT1, such as siRNA, shRNA, and ASO, are used to reduce IFIT1 protein expression by silencing IFIT1 mRNA, thereby enhancing MSC differentiation into cardiomyocytes. In vivo intervention is performed using IFIT1 gene interference vectors such as lentiviruses.
It significantly improves myocardial regeneration capacity, enhances cardiac function, reduces myocardial fibrosis, improves ventricular remodeling, enhances cardiac repair, significantly increases ejection fraction and cardiac function indicators, and reduces fibrosis area.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedical technology, specifically to a nucleic acid molecule, carrier, and pharmaceutical composition targeting IFIT1 mRNA for the treatment of myocardial infarction, and their uses. Background Technology
[0002] Myocardial infarction (MI), commonly known as a "heart attack," is a life-threatening emergency characterized by the sudden blockage of a coronary artery (the blood supply to the heart), leading to necrosis of a portion of the myocardium due to ischemia and hypoxia. In the acute phase of MI, ischemia-induced myocardial cell necrosis is the primary factor; in the subsequent post-ischemic injury phase, programmed cell death, such as apoptosis, is closely related to the continuous loss of myocardial cells. Apoptosis is a highly regulated form of programmed cell death that plays a crucial role in physiological processes such as organismal development, immune surveillance, and maintenance of tissue homeostasis. In MI-related injury, apoptotic events are frequently observed in damaged myocardial cells, and are often more prominent in the peri-infarct region. Furthermore, this type of programmed cell death is not limited to the infarct core area but can also affect non-infarcted areas to some extent, thus expanding the scope of effective myocardial loss. Moreover, elevated levels of myocardial cell apoptosis are closely related to the deterioration of cardiac function and the development of heart failure. Apoptosis not only directly reduces the number of cardiomyocytes, but may also affect the post-infarction repair process and ventricular remodeling by promoting local inflammatory responses, altering extracellular matrix components and the intercellular microenvironment, ultimately leading to progressive damage to cardiac structure and function. Therefore, developing intervention strategies that can reduce programmed cardiomyocyte death after myocardial infarction (MI), alleviate post-ischemic damage, and improve myocardial repair and remodeling is of great significance.
[0003] Currently, myocardial cell loss after myocardial infarction (MI) and its limited regenerative capacity lead to a significant degree of irreversible myocardial tissue damage, which can easily progress to ventricular remodeling and heart failure. Therefore, promoting myocardial repair and functional recovery after infarction remains a critical issue that urgently needs to be addressed in the cardiovascular field.
[0004] Cardiac progenitor cells (CPCs) are a population of progenitor cells found in embryonic and adult heart tissues. They possess the potential to differentiate into cardiovascular lineages such as cardiomyocytes, endothelial cells, and smooth muscle cells, playing a crucial role in cardiac development, regeneration, and repair. Mesenchymal stem cells (MSCs), also mesodermal-derived cells, have a wider range of tissue origins and are widely used in myocardial injury repair research. Overall, both CPCs and MSCs are considered to have potential applications in promoting cardiac repair; however, both often face the challenge of diminishing efficacy in the pathological microenvironment following myocardial injury (MI).
[0005] Following myocardial infarction (MI), severe local and systemic inflammatory responses occur. Abnormal or persistent activation of interferon (IFN)-related signaling pathways can significantly alter the biological state and functional performance of cells, thereby weakening the survival and repair effects of transplanted MSCs and potentially interfering with the self-renewal and differentiation processes of CPCs, ultimately leading to a decrease in the actual benefits of cell therapy or endogenous repair. Therefore, elucidating and intervening in IFN signaling-mediated cellular dysfunction after MI is one of the important directions for improving cardiac repair outcomes.
[0006] IFIT1 (interferon-induced protein with tetratricopeptide repeats 1) is a classic downstream effector molecule of the type I interferon pathway, involved in innate immune defense and immune homeostasis regulation. It is highly sensitive to interferon stimulation and is therefore often used as a biomarker reflecting the activation status of the type I interferon pathway. At the cell biology level, IFIT1 is also associated with cell proliferation, apoptosis, and RNA metabolism / homeostasis regulation, and plays a role in host-pathogen interactions. However, our understanding of the changes in IFIT1 expression under MI pathological conditions and its impact on CPC / MSC repair function remains insufficient, and there is a lack of clear regulatory strategies to maintain or restore cellular repair potential in the context of post-infarction inflammation / interferon hyperactivation. Summary of the Invention
[0007] In view of the shortcomings of the prior art described above, the purpose of this invention is to provide a nucleic acid molecule, carrier, and pharmaceutical composition targeting IFIT1 mRNA for the treatment of myocardial infarction, and its uses.
[0008] To achieve the above and other related objectives, the first aspect of this application provides the use of IFIT1 inhibitors in the preparation of products having at least one of the following effects:
[0009] 1) Treatment of myocardial infarction;
[0010] 2) Reduce the loss of mesenchymal cells;
[0011] 3) Improve myocardial regeneration capacity;
[0012] 4) Inhibits myocardial fibrosis;
[0013] 5) Improves ventricular remodeling after myocardial infarction.
[0014] A second aspect of the present invention provides a nucleic acid molecule that reduces IFIT1 protein in MSCs, the nucleic acid molecule being selected from siRNA, shRNA, or ASO, wherein the siRNA contains a nucleotide sequence capable of binding to IFIT1 mRNA; the shRNA contains a nucleotide sequence capable of binding to IFIT1 mRNA; and the ASO contains a nucleotide sequence capable of binding to IFIT1 mRNA.
[0015] A third aspect of this application provides nucleic acid molecule-related substances as described above, said substances comprising one or more of the following:
[0016] 1) A nucleic acid construct comprising the nucleic acid molecules described above;
[0017] 2) The IFIT1 gene interference vector is prepared by viral packaging of the aforementioned IFIT1 gene interference nucleic acid construct with the assistance of adenovirus packaging plasmids and cell lines;
[0018] 3) A pharmaceutical composition comprising the nucleic acid construct of 1); or, the IFIT1 gene-interfering lentivirus of 2).
[0019] The fourth aspect of the present invention provides the use of the nucleic acid molecule as described above, or substances related to the nucleic acid molecule as described above, for the preparation of products for the treatment of myocardial infarction.
[0020] In summary, this invention discloses a nucleic acid molecule, carrier, and pharmaceutical composition targeting IFIT1 for the treatment of myocardial infarction, as well as their uses, and achieves the following beneficial effects:
[0021] This application targets IFIT1 as an intervention for myocardial infarction. By silencing IFIT1 mRNA, it significantly reduces IFIT1 protein, enhances MSC differentiation into cardiomyocytes, and multiple intervention methods (siRNA, shRNA, ASO) are effective in vitro and in vivo. Using IFIT1 as an intervention target for myocardial infarction has the following effects: 1) Improved cardiac function: After ASO and shRNA treatment in MI mice, ejection fraction (EF) increased by approximately 11-14%, FS increased by 45%, and LVEDD and LVEDS decreased; 2) Anti-fibrosis: The fibrotic area was significantly reduced by approximately 8%; 3) Induction of myocardial differentiation: After IFIT1 silencing, ADSCs produced spontaneously beating myoid cells, and the expression of Myh6 and Tnnt2 significantly increased; 4) Clear mechanism: By inhibiting translation through the specific binding site (55–256 bp) of IFIT1 to E2F1 mRNA, the expression of E2F1 protein was significantly enhanced after IFIT1 silencing; 5) Wide applicability: Interfering RNA and ASO are applicable to ADSCs and other MSC subtypes. Attached Figure Description
[0022] Figure 1 For the validation of MSCs; (A) Detection of adipogenic and osteogenic differentiation potential of primary MSCs and immortalized MSCs cell line (SV40T); (B) Flow cytometry results of the validation of classic MSCs markers; (C) Screening of siRNA.
[0023] Figure 2 (A) Western blot verification of siRNA-mediated Ifit1 knockdown in primary MSCs (n = 4 / group); (B) Schematic diagram of dual-fluorescent reporter lentiviral plasmid driven by sMyh6 and Tnnt2 promoters; (C) Western blot detection of TNNT protein expression in MSCs transfected with scrambled (Sc) or sh-Ifit1, quantitatively expressed as the ratio of TNNT to total protein expression (n = 3 / group); (D) Representative image of primary MSCs transfected with empty vector (si-c) or si-Ifit1, showing mScarlet and mNeonGreen expression (n = 6 / group), scale bar = 50 μm; (E) Gray value quantification of the dual-fluorescent reporter system transfected with shIFIT1 lentivirus; (F) TNNT protein expression level in MSCs transfected with scrambled (Sc) or sh-Ifit1.
[0024] Figure 3To improve cardiac function after myocardial infarction through rAAV9-mediated in situ knockdown of IFIT1 in the heart, (A) an overview of the experiments involving injection of rAAV9-sc (WT-AAVSc) or rAAV9-sh-Ifit1 (WT-AAVshIfit1) in WT mice; (B) Kaplan-Meier survival curves of WT mice treated with AAVSc or AAVshIfit1 (n = 7 / group), Log-rank test (P>0.5); (C) LV weight and lung weight (mg) normalized to tibia length (mm) in WT mice treated with AAVSc or AAVshIfit1 (n = 6, 7). Data are expressed as mean ± standard error; (D, E) Representative left ventricular short-axis m-mode echocardiographic images (D) and analysis (E) ΔEF, FS, LVEDS, LVEDD (n = 6, 7), data are expressed as mean ± standard error (mean ± SEM); (F) Representative Masson trichrome staining of AAVSc and AAVshIfit1 mice (n = 6, 7) at D28 post-myocardial infarction, scale bar: 1.25 mm and 100 μm (inset); (G) Colocalization of E2F1 (red) with Ki67 (green) and α-SMA (cyan) in the infarct margin region of AAVSc and aavshifit1 treated mice 28 days post-myocardial infarction, 6 cases per group, scale bar: 100 μm and 25 μm (inset); (H) AAVSc and aavshifit1 treated mice (n = 70–120 cells / sample, n = (6 / group) Representative WGA staining at D28 after myocardial infarction, scale bar: 100 μm and 50 μm (inset); (I) Quantitative analysis of myocardial fibrosis, E2F1 expression, and cardiomyocyte size, data are expressed as mean ± SEM. *p < 0.05, **p < 0.01, ***p < 0.001. n, not significant.
[0025] Figure 4To demonstrate the significant restoration of cardiac systolic function after myocardial infarction using systemic inhibition of IFIT1 with ASO, (A) schematic diagram of ASO treatment in WT mice; (B) schematic diagram of ASO construction; (C) validation of ASO efficacy. The relative expression levels of Ifit1 mRNA in the hearts of mice treated with PBS or ASO were detected by RT-qPCR (n=4 / group). Data are expressed as mean ± standard error; (D) Liver function analysis of aspartate aminotransferase (AST), alanine aminotransferase (ALT), and alkaline phosphatase (ALP) after treatment with PBS or ASO in mice (n=6 / group). Data are expressed as mean ± SEM. (E, F) Representative left ventricular short-axis m-mode echocardiographic images (E) and corresponding analyses (F) for ΔEF, FS, LVEDS, and LVEDD (n=6, 7). Data are expressed as mean ± standard error (mean ± SEM); (G) Left ventricular and lung weights (mg) in PBS or ASO-treated WT mice (n = 6, 7), normalized to tibia length (mm). Data are expressed as mean ± SEM. (H) Representative Masson staining 28 days post-myocardial infarction in PBS or ASO-treated mice (n = 6 / group). Scale bar: 1.25 mm and 100 μm (inset); (I) Colocalization of E2F1 (red) with Ki67 (green) and α-SMA (cyan) in the infarct margin region 28 days post-myocardial infarction in PBS or ASO-treated WT mice. 6 cases per group. Scale bar: 100 μm and 25 μm (inset). (J) Representative WGA staining 28 days post-myocardial infarction in PBS or ASO-treated WT mice. (n = 70–120 cells / sample, n = 6 / group). Scale bars: 100 μm and 50 μm (inset); (K) Fibrosis quantification, E2F1 expression, and cardiomyocyte size assay results. Data are expressed as mean ± SEM. ***p < 0.05, p < 0.01, *****p < 0.001, p < 0.0001. n, not significant. Detailed Implementation
[0026] The technical solution of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some, not all, of the embodiments of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0027] Before further describing specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terminology used in the embodiments of the present invention is for describing specific embodiments and not for limiting the scope of protection of the present invention; in the specification and claims of the present invention, unless otherwise expressly stated in the text, the singular forms "a", "an" and "this" include the plural forms.
[0028] When numerical ranges are given in the embodiments, it should be understood that, unless otherwise stated in the present invention, both endpoints of each numerical range and any value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art. In addition to the specific methods, apparatus, and materials used in the embodiments, based on the knowledge of the prior art possessed by one of ordinary skill in the art and the description of this invention, any prior art methods, apparatus, and materials similar to or equivalent to those described, apparatus, and materials in the embodiments of this invention may be used to implement the present invention.
[0029] In this invention, the term "treatment" refers to a clinical intervention to alter the natural processes of an individual or cells to be treated, which can be performed during or to prevent a clinical pathological state. Desired therapeutic effects include preventing the onset or recurrence of disease, alleviating symptoms, reducing all direct or indirect pathological outcomes based on the disease, preventing metastasis, slowing the rate of disease progression, reducing or temporarily alleviating the disease condition, and demonstrating remission or improved prognosis. Preferably, in this invention, treatment refers to all actions of a composition containing a substance that inhibits IFIT1 that improves myocardial regeneration capacity. Furthermore, according to the invention, "prevention" refers to all actions of implementing a composition containing a substance that inhibits IFIT1 that enhances MSC myocardial differentiation capacity or improves cardiac function and reduces cardiac remodeling.
[0030] In this invention, the term "antisense oligonucleotide" refers to DNA, RNA, or a derivative thereof containing a nucleotide sequence complementary to a specific mRNA sequence, and used to inhibit mRNA translation into protein by binding to the complementary sequence in the mRNA. The antisense oligonucleotide sequence refers to a DNA or RNA sequence that can be complementary to and bind to IFIT1 mRNA. Antisense oligonucleotides can inhibit essential activities for IFIT1 mRNA translation, translocation to cytoplasm, maturation, or other overall biological functions. The length of an antisense oligonucleotide can be 6 to 100 bases, preferably 8 to 60 bases, more preferably 10 to 40 bases. Antisense oligonucleotides can be synthesized in vitro using conventional methods for in vivo administration, or can be synthesized in vivo. An example of in vitro synthesis of antisense oligonucleotides is the use of RNA polymerase. An example of in vivo synthesis of antisense RNA is the reverse transcription of antisense RNA using a vector with a multiple cloning site (MCS) origin. Antisense RNA is preferably not translated into a peptide sequence so that a translation stop codon is present in the sequence. The design of antisense oligonucleotides that can be used in this invention can be carried out according to methods known in the art, with reference to the nucleotide sequence of IFIT1.
[0031] In this invention, the term "aptamer" as a single-stranded oligonucleotide refers to a nucleic acid molecule having a size of about 20 to 60 nucleotides and binding activity to a predetermined target molecule. Aptamers can have various 3D structures depending on their sequence and can exhibit high affinity for specific substances, such as antigen-antibody reactions. Aptamers can inhibit the activity of a predetermined target molecule by binding to it. The aptamers of this invention can be RNA, DNA, modified nucleic acids, or mixtures thereof, and can be linear or circular. Preferably, the aptamer can inhibit the activity of IFIT1 by binding to it. Such aptamers can be prepared from the sequence of IFIT1 using methods known in the art.
[0032] In this invention, the terms "siRNA" and "shRNA" refer to nucleic acid molecules capable of mediating RNA interference or gene silencing and inhibiting the expression of target genes, serving as effective gene knockdown methods or gene therapy methods. shRNA forms a hairpin structure through the binding of complementary sequences between single-stranded oligonucleotides and is cleaved in vivo by a dicer to become siRNA, which is a double-stranded oligonucleotide fragment of small RNA of 21 to 25 nucleotides in size, specifically binding to mRNA with complementary sequences to inhibit expression. Therefore, the choice of which method to use, shRNA or siRNA, is determined by those skilled in the art, and if the mRNA sequences targeting shRNA and siRNA are identical, similar expression-reducing effects can be expected. For the purposes of this invention, shRNA and siRNA inhibit IFIT1 by specifically acting on IFIT1 to induce RNA interference (RNAi) to cleave IFIT1 mRNA molecules. siRNA can be chemically synthesized or enzymatically synthesized. There are no particular limitations on the method of preparing siRNA, and methods known in the art can be used. For example, the methods include methods for chemically synthesizing siRNA, methods for synthesizing siRNA by in vitro transcription, methods for synthesizing long double-stranded RNA by enzyme digestion through in vitro transcription, expression methods for intracellular delivery of siRNA expression plasmids or viral vectors, and expression methods for intracellular delivery of siRNA expression cassettes induced by polymerase chain reaction (PCR), but are not limited thereto.
[0033] The IFIT1 gene, or Interferon-Induced Protein with Tetratricopeptide Repeats 1 gene, NCBI Gene ID: 3434 (human) / 15957 (mouse).
[0034] In one embodiment, using the IFIT1 gene as a target to screen for myocardial infarction treatment drugs means: using IFIT1 as the target to screen candidate substances to find IFIT1 inhibitors as potential myocardial infarction treatment drugs, or using the IFIT1 gene as the target to screen siRNA, shRNA, or ASO that can reduce the expression level of the IFIT1 gene in mesenchymal stem cells as myocardial infarction treatment drugs.
[0035] This application also provides the use of IFIT1 inhibitors in the preparation of products having at least one of the following effects:
[0036] 1) Treatment of myocardial infarction;
[0037] 2) Reduce the loss of mesenchymal cells;
[0038] 3) Improves the heart's regenerative capacity;
[0039] 4) Inhibits myocardial fibrosis;
[0040] 5) Improves ventricular remodeling after myocardial infarction.
[0041] Preferably, the product includes an IFIT1 inhibitor, and uses the IFIT1 inhibitor as the active ingredient for the aforementioned effects.
[0042] In the product, the active ingredient that exerts the aforementioned effects may be only an IFIT1 inhibitor, or it may contain other molecules that can achieve the aforementioned effects.
[0043] In other words, IFIT1 inhibitors can be the sole or one of the active ingredients in a product. The product can be a single-component or multi-component substance. There are no particular restrictions on the form of the product; it can be common forms such as solid, liquid, gel, semi-liquid, or aerosol.
[0044] In this invention, the product for the prevention and / or treatment of myocardial infarction is primarily targeted at mammals. The mammals are preferably rodents, even-toed ungulates, perissodactyls, lagomorphs, primates, etc.
[0045] The product is a medicine.
[0046] The IFIT1 inhibitor can be a nucleic acid molecule, a small molecule chemical drug, an antibody drug, a peptide, a protein, or a virus.
[0047] The nucleic acid molecules include, but are not limited to: antisense oligonucleotides, double-stranded RNA, ribozymes, small interfering RNA (siRNA), short hairpin RNA (shRNA), and guide RNA (gRNA).
[0048] As illustrated in the embodiments of the present invention, the IFIT1 inhibitor can be a nucleic acid molecule that reduces the expression of the IFIT1 gene in mesenchymal stem cells. Specifically, it can be siRNA, shRNA, or ASO.
[0049] Furthermore, the target sequence of the siRNA, shRNA, or ASO is shown in SEQ ID NO: 1:
[0050] SEQ ID NO: 1: GGTCATGGAGAATCTGCTTCA.
[0051] The siRNA comprises a first strand and a second strand. The first strand of the siRNA is a strand of siRNA designed with the sequence shown in SEQ ID NO: 1 as the RNA interference target sequence and targeting the IFIT1 gene. The second strand is complementary to the sequence of the first strand.
[0052] Furthermore, the nucleotide sequence of the siRNA is as shown in any one of SEQ ID No. 2 to SEQ ID No. 4, which is the positive strand of the siRNA.
[0053] SEQ ID NO: 2: 5'-UCAUGGAGAAUCUGCUUCAUU-3';
[0054] SEQ ID No. 3: 5'-GUCAUGGAGAAUCUGCUUCUU-3';
[0055] SEQ ID No. 4: 5'-GGUCAUGGAGAAUCUGCUUUU-3'.
[0056] In some embodiments of the present invention, the shRNA further includes other structures, such as stem-loop structures.
[0057] Furthermore, the stem-loop sequence of the shRNA can be selected from TTCAAGAGA; the shRNA is processed into siRNA by Dicer in the cell to exert its function.
[0058] Furthermore, the nucleotide sequence of the shRNA is shown in SEQ ID No. 5.
[0059] SEQ ID No. 5: GGTCATGGAGAATCTGCTTCATTCAAGAGATGAAGCAGATTCTCCATGACCTTTTTT.
[0060] The nucleotide sequence of the ASO is shown in SEQ ID NO. 6~8.
[0061] SEQ ID NO.6: 5'-TGGCTCCATTGTTGCCAGAT-3';
[0062] SEQ ID NO.7: 5'-GTCCTGAGCTTCCACCTTGA-3';
[0063] SEQ ID NO. 8: 5'-CCATGGAGAATCTGCTTCAA-3'.
[0064] Preferably, the ASO further comprises a modified nucleotide, the modification being selected from any one or a combination of at least two of the following: thiomodification, phosphate thiomodification, cholesterol modification, or morpholine ring modification. More preferably, the ASO comprises a nucleotide modified with 2'-o-methylation. The alkoxy group is, for example, methoxy or ethoxy.
[0065] The virus is a lentivirus, retrovirus, adenovirus, or adeno-associated virus.
[0066] In some embodiments of the present invention, the IFIT1 inhibitor is a lentivirus, and the target sequence of the lentivirus is shown in SEQ ID NO: 1.
[0067] The present invention also provides a method for treating myocardial infarction by administering an IFIT1 inhibitor to a subject.
[0068] The object can be a mammal or a mammalian mesenchymal stem cell. The mammal is preferably a rodent, even-toed ungulate, perissodactyl, lagomorph, or primate. The mesenchymal stem cells can be any one of umbilical cord mesenchymal stem cells, adipose-derived mesenchymal stem cells, bone marrow-derived mesenchymal stem cells, dental pulp mesenchymal stem cells, or birth-related tissue-derived mesenchymal stem cells, and can be ex vivo mesenchymal stem cells.
[0069] The subject can be an individual suffering from or expecting treatment for myocardial infarction. Alternatively, the subject can be ex vivo mesenchymal stem cells from an individual suffering from or expecting treatment for myocardial infarction.
[0070] In some embodiments of the present invention, an effective amount of other myocardial infarction treatment drugs and / or other myocardial infarction treatment methods may also be administered to the subject. An effective amount of an IFIT1 inhibitor and at least one effective amount of other myocardial infarction treatment drugs may be administered simultaneously or sequentially.
[0071] Based on IFIT1, this invention proposes the use of IFIT1 inhibitors for the treatment of myocardial infarction and the promotion of myocardial regeneration. When used in combination with other myocardial infarction treatment drugs besides IFIT1 inhibitors, it can at least have an additive effect, further enhancing the therapeutic effect on myocardial infarction.
[0072] This application also provides a nucleic acid molecule that reduces the expression of the IFIT1 gene in MSCs. The nucleic acid molecule is selected from siRNA, shRNA, or ASO, wherein the siRNA contains a nucleotide sequence capable of hybridizing with the IFIT1 gene; the shRNA contains a nucleotide sequence capable of hybridizing with the IFIT1 gene; and the ASO contains a nucleotide sequence capable of hybridizing with the IFIT1 gene.
[0073] Furthermore, the target sequence of the siRNA, shRNA, or ASO is shown in SEQ ID NO: 1.
[0074] SEQ ID NO: 1: GGTCATGGAGAATCTGCTTCA.
[0075] The siRNA consists of a sense strand that is designed with the sequence shown in SEQ ID NO: 1 as the RNA interference target sequence and targets the IFIT1 gene. The other strand, the antisense strand, is complementary to the sequence of the first strand.
[0076] Furthermore, the nucleotide sequence of the siRNA is as shown in any one of SEQ ID No. 2 to SEQ ID No. 4, which is the positive strand of the siRNA.
[0077] SEQ ID NO: 2: 5'-UCAUGGAGAAUCUGCUUCAUU-3';
[0078] SEQ ID No. 3: 5'-GUCAUGGAGAAUCUGCUUCUU-3';
[0079] SEQ ID No. 4: 5'-GGUCAUGGAGAAUCUGCUUUU-3'.
[0080] In some embodiments of the present invention, the shRNA further includes other structures, such as stem-loop structures.
[0081] Furthermore, the stem-loop sequence of the shRNA can be selected from TTCAAGAGA; the shRNA is processed into siRNA by Dicer in the cell to exert its function.
[0082] Furthermore, the nucleotide sequence of the shRNA is shown in SEQ ID No. 5.
[0083] SEQ ID No. 5: GGTCATGGAGAATCTGCTTCATTCAAGAGA TGAAGCAGATTCTCCATGACCTTTTTT.
[0084] The nucleotide sequence of the ASO is shown in SEQ ID NO. 6~8.
[0085] SEQ ID NO.6: 5'-TGGCTCCATTGTTGCCAGAT-3';
[0086] SEQ ID NO.7: 5'-GTCCTGAGCTTCCACCTTGA-3';
[0087] SEQ ID NO. 8: 5'-CCATGGAGAATCTGCTTCAA-3'.
[0088] Preferably, the ASO further comprises a modified nucleotide, the modification being selected from any one or a combination of at least two of the following: thiomodification, phosphate thiomodification, cholesterol modification, or morpholine ring modification. More preferably, the ASO comprises a nucleotide modified with 2'-o-methylation. The alkoxy group is, for example, methoxy or ethoxy.
[0089] This application also provides nucleic acid molecule-related substances as described above, said substances including one or more of the following:
[0090] 1) A nucleic acid construct comprising the nucleic acid molecules described above;
[0091] 2) The IFIT1 gene interference vector is prepared by viral packaging of the aforementioned IFIT1 gene interference nucleic acid construct with the assistance of adenovirus packaging plasmids and cell lines;
[0092] 3) A pharmaceutical composition comprising the nucleic acid construct of 1); or, the IFIT1 gene-interfering adenovirus of 2).
[0093] The nucleic acid construct can be obtained by cloning a gene fragment encoding the aforementioned IFIT1 gene into a known vector.
[0094] The vector is prepared by viral packaging of various gene-interfering nucleic acid constructs with the assistance of packaging plasmids and cell lines. The known vectors are selected from plasmid vectors, lentiviral vectors, retroviral vectors, AAV vectors, and adenovirus-associated vectors. Preferably, the vector is an adeno-associated virus type 9 vector, which can infect mesenchymal stem cells and produce small interfering RNA targeting the IFIT1 gene, thereby inhibiting IFIT1 gene expression.
[0095] The virus packaging process is a conventional technique in the field, and this invention does not impose any particular limitations on it.
[0096] Preferably, the pharmaceutical composition further comprises pharmaceutically acceptable excipients. Pharmaceutically acceptable excipients are those that, when properly administered to animals or humans, do not produce adverse, allergic, or other adverse reactions. The pharmaceutically acceptable excipients should be compatible with the substance inhibiting IFIT1, i.e., miscible with it without significantly reducing the effectiveness of the substance inhibiting IFIT1 under normal circumstances. The pharmaceutically acceptable excipients are selected from one or more of carriers, diluents, binders, lubricants, and wetting agents. Specific examples of substances that can serve as pharmaceutically acceptable carriers, diluents, binders, lubricants, and humectants include sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium methylcellulose, ethylcellulose, and methylcellulose; tragacanth gum powder; malt; gelatin; talc; solid lubricants such as stearic acid and magnesium stearate; calcium sulfate; vegetable oils such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil, and cocoa butter; polyols such as propylene glycol, glycerin, sorbitol, mannitol, and polyethylene glycol; alginic acid; emulsifiers such as Tween; humectants such as sodium lauryl sulfate; colorants; flavoring agents; tableting agents; stabilizers; antioxidants; preservatives; pyrogen-free water; isotonic salt solutions; and phosphate buffers, etc. These substances are used as needed to aid in the stability of the formulation or to contribute to its activity or bioavailability, or to produce an acceptable taste or aroma when taken orally. The composition is available in one or more of the following dosage forms: solution, injection, spray, nasal drops, aerosol, powder, tablet, capsule, and granule. The composition can be introduced into the body, such as into muscles, intradermal, subcutaneous, veins, or mucous membranes, via injection, spray, nasal drops, eye drops, penetration, absorption, or physical or chemical mediated methods; or it can be introduced into the body after being mixed with or encapsulated by other substances. Preferably, it is administered intraperitoneally. The drug can also be used in combination with other treatment methods, including surgery, radiotherapy, chemotherapy, and targeted therapy.
[0097] The present invention also provides the use of the nucleic acid molecules or substances described above in the preparation of products for the prevention and / or treatment of myocardial infarction.
[0098] The following specific examples illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.
[0099] Example 1
[0100] 1. Isolation and culture of mouse adipose-derived mesenchymal stem cells
[0101] Three wild-type C57BL / 6J mice were anesthetized with 5% isoflurane and euthanized by cervical dislocation. The mice were then immersed in 75% alcohol for 15 minutes. Subcutaneous adipose tissue was subsequently dissected and rinsed three times with PBS. Blood vessels in the adipose tissue were dissected under a stereomicroscope. Then, using fine scissors, the adipose tissue was cut into 0.5–1 mm pieces. 3 Cells were fragmented to a small size, slightly drained of water, and then digested with 0.1% type I collagenase at 37 °C for 60 minutes, followed by centrifugation at 600 g for 10 minutes. Red blood cells were lysed using erythrocyte lysis buffer. After another centrifugation, the cells were resuspended in DMEM / F-12 medium supplemented with 10% (v / v) FBS and 50 units / mL penicillin-streptomycin. The cells were incubated for 6 hours in a 5% CO2, 37 °C, saturated humidity incubator, with the medium replaced promptly. Second and third generation MSCs were used for experiments.
[0102] P2 generation cells were cultured in MSC adipogenic induction medium for 14 days and MSC osteogenic induction medium for 21 days, with the medium changed every 3 days. After induction, the cells were stained with Oil Red O and Alizarin Red dye, respectively. Figure 1 As shown in Figure A, the extracted primary MSCs cells exhibit good differentiation potential. P3 generation MSCs cells cultured in MSC maintenance medium were analyzed by flow cytometry to detect surface-expressed biomarkers, such as... Figure 1 As shown in B, P3 generation MSCs expressed the classic MSC surface marker CD90.2+, but did not express CD45.
[0103] 2. siRNA screening
[0104] siRNA was designed and synthesized using an online siRNA design tool, based on the target IFIT1 sequence (SEQ ID No. 1). The siRNA was designed to ensure high specificity and efficient knockdown. The siRNA used in this embodiment was synthesized by Guangzhou Ruibo Biotechnology Co., Ltd. Mesenchymal stem cells (MSCs) were used in the experiment. Primary MSCs were transfected with the synthesized specific si-Ifit1 (nucleotide sequence: SEQ ID No. 2~SEQ ID No. 4) to silence IFIT1. An empty vector (si-c) was used as a control group. The specific steps were as follows: One day before transfection, MSCs were plated in 6-well plates. On the day of transfection (within 14-16 hours of plate formation), cell confluence reached approximately 60-80%. Opti-MEM medium was equilibrated to room temperature. Following the RNAiMAX transfection reagent instructions, siRNA and RNAiMAX transfection reagent were added to Opti-MEM medium in the specified proportions. Then, the siRNA dilution was added to the RNAiMAX dilution. After thorough mixing, the transfection complex was obtained and incubated at room temperature for 15 minutes. The transfection solution was added dropwise to the culture plate. The final transfection concentration was 100 nM. Cells were cultured under standard conditions for 72 hours before being harvested. After 72 hours, RNA was extracted from the cells, and qPCR was used to detect the RNA expression level in MSCs cells. Figure 1 As shown in C, si-Ifit1-1 can stably knock down the Ifit1 level in the target cells.
[0105] Using this si-RNA (i.e., si-Ifit1-1, hereinafter referred to as si-Ifit1) to mediate the knockdown of Ifit1 in MSCs, Western blot verification showed that IFIT1 protein decreased by more than 80% in primary MSCs. Figure 2 A).
[0106] 3. Lentiviral packaging and transfection
[0107] The siRNA sequence with the best interference effect (SEQ ID No. 2) was selected for designing and synthesizing shRNA (SEQ ID No. 5), and an shRNA interference plasmid was constructed. Sequencing was used to verify the sequence correctness. Lentiviral vectors were co-transfected into HEK293T cells with packaging plasmid (psPAX2) and envelope plasmid (pMD2.G) in a ratio of 3:2:1. The medium was changed every other day. The supernatant was collected 48 hours after medium change, and the medium was replaced with fresh medium. The cell supernatant was collected again 24 hours later. The cells were centrifuged at 2000 g for 30 minutes at 4°C to remove cell debris, and the viral supernatant was collected and filtered through a 0.45 μm PES filter. The filtered viral solution was mixed with PEG 6000 stock solution (16% PEG6000 0.1M NaCl) at a 1:1 ratio and incubated overnight at 4°C. The next day, the mixture was centrifuged at 3200 g for 1 hour at 4°C. The supernatant was discarded. Viral particles were resuspended in PBS or DMEM (both containing 25 mM HEPES) to obtain sh-IFIT1 lentivirus or sMyh6-Tnnt2 dual-fluorescent reporter lentivirus. Figure 2 B).
[0108] First, dual-fluorescent reporter MSCs (or primary cell lines) were constructed by transfecting MSCs with sMyh6-Tnnt2 dual-fluorescent reporter lentivirus to report the activation of the sMyh6 and Tnnt2 promoters. The primary reporter MSCs were then transfected with si-IFIT1, with si-scrambled (Sc) as a control. The results showed that the dual fluorescence driven by the sMyh6 and Tnnt2 promoters was significantly increased in the IFIT1 interference group, suggesting that these two myocyte characteristic genes are activated. Figure 2 C and 2D). In immortalized MSCs dual-fluorescent reporter lines, transfection with shIFIT1 lentivirus yielded results similar to those of primary cells. Figure 2 E). Western blotting was used to detect the expression of TNNT protein in MSCs transfected with scrambled (Sc) or sh-Ifit1. Figure 2 F). These results show that silencing IFIT1 mRNA activates myoblastic differentiation of MSCs.
[0109] Example 2
[0110] shRNA (SEQ ID No. 5) was designed and synthesized using the siRNA sequence with the best interference effect (SEQ ID No. 2). A shRNA sequence targeting IFIT1 was constructed, and an rAAV shuttle vector was constructed. After sequencing verification of sequence correctness, rAAV9-shIFIT1 was prepared using rAAV serotype 9 as a vector. Both the vector and recombinant adeno-associated virus type 9 (rAAV9) were constructed and packaged by Shanghai Heyuan Biotechnology Co., Ltd., China. rAAV9-shIFIT1 was packaged at a rate of 1×10⁻⁶. 9 In MI mice, the infarct junction was injected with a dose of vg. A control group was also injected with the same dose of rAAV9-scramble virus into the infarct junction. All mice underwent echocardiography before enrollment to record baseline cardiac function and exclude any potential cardiac malformations. On day 28, cardiac function was assessed using echocardiography. Parasternal long-axis sections were obtained on two-dimensional images, and parasternal short-axis sections were obtained on M-mode images. Left ventricular end-systolic diameter (LVESD) and left ventricular end-diastolic diameter (LVEDD) were measured on the parasternal short axis, and left ventricular ejection fraction (LVEF) and left ventricular short-axis shortening rate (LVFS) were calculated to compare changes in cardiac function among the groups. Paraffin sections of mouse hearts fixed on day 28 were dehydrated, embedded, and sectioned. The sections were then cleared with xylene, dewaxed using a gradient of ethanol, and washed sequentially with tap water and distilled water. Subsequently, the nuclei were stained with Regaud hematoxylin or Weigert hematoxylin for 5-10 min, washed thoroughly with water, stained with Masson's Ponceau S acid fuchsin for 5-10 min, rinsed briefly with 2% glacial acetic acid aqueous solution, differentiated with 1% phosphomolybdic acid aqueous solution for 3-5 min, stained directly with aniline blue or light green for 5 min without rinsing, then rinsed with 0.2% glacial acetic acid aqueous solution, dehydrated with 95% ethanol and anhydrous ethanol, cleared with xylene, and mounted with neutral resin. The degree of fibrosis was observed under a microscope. In mice treated with AAVSc and AAV-shIfit1, 28 days after myocardial infarction, co-localization of E2F1 (red), Ki67 (green), and α-SMA (cyan) was performed in the infarct margin region, and the expression of E2F1, Ki67, and α-SMA was detected.
[0111] The formulas for calculating left ventricular ejection fraction (LVEF) and short-axis systolic velocity (LVFS) are as follows:
[0112] LVEF (%) = (LV Vol; d – LV Vol; s) / LV Vol; d × 100%
[0113] LVFS(%)=(LVID;d-LVID;s) / LVID;d×100%.
[0114] The results are as follows Figure 3As shown, the rAAV9-mediated in situ knockdown of IFIT1 in the heart improved cardiac function after myocardial infarction. The experimental procedure for injecting rAAV9-sc (WT-AAVSc) or rAAV9-sh-Ifit1 (WT-AAVshIfit1) into WT mice is as follows. Figure 3 As shown in Figure A, the Kaplan-Meier survival curves of WT mice treated with AAVSc or AAV-shIfit1 are as follows: Figure 3 As shown in B, there was no significant difference in survival rates between the two groups; in WT mice treated with AAVSc or AAV-shIfit1, LV (left ventricle) weight and lung weight (mg) were normalized to tibia length (mm), and there was no significant difference in LV weight and lung weight between the two groups. Figure 3 C); Left ventricular short-axis M-mode echocardiography was performed on both groups of mice to assess left ventricular end-diastolic diameter (LVEDD), left ventricular end-systolic diameter (LVESD), fractional shortening (FS), and ejection fraction difference (ΔEF). An EF increase of 11% indicated that AAV-shIfit1 treatment could improve myocardial regeneration capacity in mice with myocardial infarction. Figure 3 D, E); Masson staining of the hearts of AAVSc and AAV-shIfit1 mice (n = 6, 7) on day 28 after myocardial infarction showed reduced fibrosis in AAV-shIfit1 mice, and quantitative detection of myocardial fibrosis revealed that the fibrosis rate in AAV-shIfit1 mice decreased to 19.9% compared to AAVSc mice, indicating that shIfit1 can inhibit myocardial fibrosis in mice with myocardial infarction. Figure 3 F, Figure 3 I); Co-localization of E2F1 (red) with Ki67 (green) and α-SMA (cyan) in the infarct margin region of mice treated with AAVSc and AAV-shIfit1 28 days after myocardial infarction suggests that in situ Ifit1 knockdown promotes increased E2F1 expression in cardiac myofibrosis. Figure 3 G and Figure 3 I). Furthermore, we unexpectedly found that in situ knockdown of Ifit1 in the heart significantly reduced cardiac hypertrophy in mice on day 28. Figure 3 H and Figure 3 I).
[0115] Example 3
[0116] An ASO was designed based on the core sequence of shRNA (SEQ ID No. 5: GGTCATGGAGAATCTGCTTCA). Due to slight upstream and downstream offsets in the core seed sequence, the ASO sequence was designed as shown in SEQ ID NOs 6-8, targeting the 560-580 region of the Ifit1 open reading frame. Based on the ASO sequence SEQ ID NO. 6, ASO was synthesized with a phosphate thioester backbone, modified with 2'-o-methylation at the 5' and 3' ends, and modified with cholesterol-TEG at the 5' end. After mouse myocardial infarction (MI) modeling, ASO (25 μg / g) was injected intraperitoneally on days 0, 3, 7, 14, and 21. Cardiac contractile function of MI mice was assessed on day 28.
[0117] Mouse hearts were fixed, dehydrated, and embedded. Heart tissue was trimmed down to below the coronary artery ligation point and sectioned at a thickness of 3 μm. The sections were baked to prevent detachment. Intact sections were then selected and stained using the Masson trichrome staining kit. Images of the heart sections were acquired using a Nikon ECLIPSE CI microscope and a Nikon DS-U3 imaging system. The ratio of left ventricular fibrosis area to left ventricular area (fibrosis area %) was measured using Image-Pro Plus 6.0 software (Media Cybernetics).
[0118] The results are as follows Figure 4 As shown, ASO administration significantly inhibited the expression of cardiac IFIT1 mRNA in mice and significantly restored cardiac contractile function after myocardial infarction. Figure 4 A shows a schematic diagram of ASO treatment in WT mice; the construction of ASO is as follows. Figure 4 As shown in Figure B, the relative expression levels of Ifit1 mRNA in the hearts of mice treated with PBS or ASO were detected by RT-qPCR. The results showed that the expression level of Ifit1 mRNA in the heart was significantly lower after ASO Ifit1 treatment compared with the PBS control group. Figure 4 C), Liver function analysis of aspartate aminotransferase (AST), alanine aminotransferase (ALT), and alkaline phosphatase (ALP) in mice after treatment with PBS or ASO showed that ASO Ifit1 had no hepatotoxicity in mice, meaning that there were no significant differences in ALT, AST, and ALP levels compared to the PBS control group. Figure 4 D); Left ventricular short-axis M-mode echocardiography was performed on both groups of mice to assess end-diastolic left ventricular diameter (LVEDD), end-systolic left ventricular diameter (LVESD), fractional shortening (FS), and ejection fraction (ΔEF). ΔEF and FS were found to be significantly increased in the PBS group compared to the PBS group. Figure 4E, F), indicating improved cardiac contractile function; in WT mice treated with PBS or ASO, LV weight and lung weight (mg) were normalized to tibia length (mm), and there were no significant differences in LV weight and lung weight between the two groups. Figure 4 G); Masson staining was performed on mice (n = 6 / group) 28 days after myocardial infarction in mice treated with PBS or ASO. The results are as follows: Figure 4 As shown in H, cardiac fibrosis was significantly reduced; 28 days after MI in ASO-treated WT mice, co-localization of E2F1 (red), Ki67 (green), and α-SMA (cyan) in the infarct margin region was observed, and E2F1 expression was significantly increased by 4.46 times compared to the control group. Figure 4 I); WAG staining showed that the cross-sectional area of myocardium in ASO-treated WT mice was reduced, indicating reduced myocardial hypertrophy and improved ventricular remodeling after myocardial infarction in mice. Figure 4 J); Quantitative detection of myocardial fibrosis in WT mice treated with PBS or ASO revealed that the fibrosis rate in WT mice treated with ASO decreased to 19.9% ( Figure 4 K); The expression level of E2F1 and the size of cardiomyocytes in WT mice treated with PBS or ASO were detected. The expression level of E2F1 was significantly increased and the size of cardiomyocytes was significantly reduced. Figure 4 (K) ASO treatment significantly improved cardiac function in WT mice. The results showed that ASO administration significantly reduced interstitial cell loss, improved myocardial regeneration capacity, inhibited myocardial fibrosis, and improved ventricular remodeling after myocardial infarction in mice.
[0119] In summary, the above description is merely a preferred embodiment of the present invention and does not constitute any limitation on the present invention in any form or substance. It should be noted that those skilled in the art can make various improvements and additions without departing from the method of the present invention, and these improvements and additions should also be considered within the scope of protection of the present invention. Any modifications, alterations, and equivalent changes made by those skilled in the art based on the above-disclosed technical content without departing from the spirit and scope of the present invention are equivalent embodiments of the present invention. Furthermore, any modifications, alterations, and evolutions made to the above embodiments based on the essential technology of the present invention still fall within the scope of the technical solution of the present invention.
Claims
1. Use of IFIT1 inhibitors in the preparation of products possessing at least one of the following functionalities: 1) Treatment of myocardial infarction; 2) Reduce the loss of interstitial cells; 3) Improve myocardial regeneration capacity; 4) Inhibits myocardial fibrosis; 5) Improves ventricular remodeling after myocardial infarction.
2. The use according to claim 1, characterized in that, The target sequence of the IFIT1 inhibitor is shown in SEQ ID NO:
1.
3. The use according to claim 1, characterized in that, The IFIT1 inhibitors are nucleic acid molecules, antibodies, small molecule chemicals, and viruses.
4. The use according to claim 3, characterized in that, The nucleic acid molecule is siRNA, shRNA, or ASO.
5. The use according to claim 3, characterized in that, The virus is a lentivirus, retrovirus, adenovirus, or adeno-associated virus.
6. The use according to claim 4, characterized in that, The nucleotide sequence of the siRNA is shown in SEQ ID No. 2 to SEQ ID No. 4; And / or, the nucleotide sequence of the shRNA is as shown in SEQ ID No. 5; And / or, the nucleotide sequence of the ASO is shown in SEQ ID NO. 6~8.
7. A nucleic acid molecule for reducing IFIT1 gene expression in MSCs, wherein the nucleic acid molecule is selected from siRNA, shRNA, or ASO, wherein, The siRNA contains a nucleotide sequence capable of hybridizing with the IFIT1 gene; the shRNA contains a nucleotide sequence capable of hybridizing with the IFIT1 gene; and the ASO contains a nucleotide sequence capable of hybridizing with the IFIT1 gene.
8. The nucleic acid molecule according to claim 7, characterized in that, The target sequence of the siRNA, shRNA, or ASO is shown in SEQ ID NO: 1; And / or, the nucleotide sequence of the siRNA is shown in SEQ ID No. 2 to SEQ ID No. 4; And / or, the nucleotide sequence of the shRNA is as shown in SEQ ID No. 5; And / or, the nucleotide sequence of the ASO is shown in SEQ ID NO. 6~8.
9. A nucleic acid molecule-related substance as described in claim 7 or 8, said substance comprising one or more of the following: 1) A nucleic acid construct comprising the nucleic acid molecule as described in claim 7 or 8; 2) IFIT1 gene interference adenovirus, which is prepared by viral packaging of the aforementioned IFIT1 gene interference nucleic acid construct with the assistance of adenovirus packaging plasmid and cell line; 3) A pharmaceutical composition comprising the nucleic acid construct of 1); or, the IFIT1 gene-interfering adenovirus of 2).
10. Use of the nucleic acid molecule as described in claim 7 or 8 or the substance as described in claim 9 in the preparation of a product for treating myocardial infarction.