Application of DzinCYP90G6 protein in catalyzing β-hydroxylation at C16 position of steroid skeleton
By integrating the DzinCYP90G6 and VvCPR gene expression cassettes into Saccharomyces cerevisiae, recombinant Saccharomyces cerevisiae was constructed, achieving efficient β-hydroxylation of the C16 position of the steroid backbone. This solved the problem of stereoselectivity and regioselectivity hydroxylation reactions that are difficult to achieve in existing technologies, and provided an efficient route for the production of steroid drugs.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
- Filing Date
- 2024-12-11
- Publication Date
- 2026-06-12
AI Technical Summary
Existing technologies struggle to efficiently perform β-hydroxylation at the C16 position of the steroid skeleton, particularly in catalyzing steroid drugs to introduce stereoselective and regioselective hydroxylation reactions.
Gene editing was performed on DzinCYP90G6 and VvCPR proteins in Saccharomyces cerevisiae to construct recombinant Saccharomyces cerevisiae, achieving β-hydroxylation of the C16 position of the steroid backbone. By integrating the DzinCYP90G6 and VvCPR gene expression cassettes, TE was catalyzed to convert to 16β-OH-TE and PG to convert to 16β-OH-PG.
This study achieved efficient β-hydroxylation at the C16 position of the steroid backbone, providing a key step in the production of high-value-added steroid drugs and demonstrating the catalytic activity and selectivity of the DzinCYP90G6 protein.
Smart Images

Figure BDA0005182440140000041 
Figure BDA0005182440140000042 
Figure BDA0005182440140000081
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology and relates to a new use of DzinCYP90G6 protein, namely, the application of DzinCYP90G6 protein in catalyzing β-hydroxylation at the C16 position of the steroid backbone. Background Technology
[0002] Steroids (also known as steroidal compounds, steroidal groups, or steroidal steroids) are a class of naturally occurring compounds widely found in nature, including phytosterols, bile acids, C21 steroids, insect metamorphic hormones, cardiac glycosides, steroidal saponins, steroidal alkaloids, and bufotoxin. A common structural feature of steroids is their cyclopentane-phenylenemonene skeleton, which is composed of three cyclohexanes and one cyclopentane. Steroids exhibit significant anti-inflammatory and immunosuppressive properties and are widely used in the treatment of various clinical diseases, including acute infections, post-inflammatory sequelae, connective tissue autoimmune diseases, COVID-19, and acquired immunodeficiency syndrome (AIDS).
[0003] The physiological activity and ideal solubility of steroids are influenced by the chemical modification of the cyclopentanoperhydrophenanthrene skeleton structure. Among these modifications, the introduction of hydroxyl groups into the cyclopentanoperhydrophenanthrene skeleton structure in a regioselective and stereoselective manner is particularly crucial. For example, hydrocortisone, a typical corticosteroid drug, achieves its pharmacological activity through specific hydroxylation modifications at the C11β, C17α, and C21 positions. Summary of the Invention
[0004] The purpose of this invention is to provide the application of DzinCYP90G6 protein in catalyzing β-hydroxylation at the C16 position of the steroid backbone.
[0005] This invention provides the application of the DzinCYP90G6 protein.
[0006] This invention also provides applications of DzinCYP90G6 protein-related biomaterials.
[0007] This invention also provides applications of DzinCYP90G6 protein and VvCPR protein.
[0008] This invention also provides the application of functional DNA molecules or recombinant microorganisms having functional DNA molecules.
[0009] The application described above is any one of the following (a1) to (a6):
[0010] (a1) Application in catalyzing β-hydroxylation at the C16 position of the steroid skeleton;
[0011] (a2) Application in the preparation of products for catalyzing β-hydroxylation at the C16 position of the steroid skeleton;
[0012] (a3) Application in the preparation of 16β-OH-TE using TE as a substrate;
[0013] (a4) Application in the preparation of 16β-OH-TE products using TE as a substrate;
[0014] (a5) Application in the preparation of 16β-OH-PG using PG as a substrate;
[0015] (a6) Application in the preparation of 16β-OH-PG products using PG as a substrate.
[0016] The present invention also provides the application of the aforementioned functional DNA molecule in the preparation of recombinant microorganisms.
[0017] The present invention also provides the application of the aforementioned functional DNA molecules and tool plasmids in the preparation of recombinant microorganisms.
[0018] Any of the recombinant microorganisms described above has any of the functions described in (d1) to (d6):
[0019] (d1) Catalyzes β-hydroxylation at the C16 position of the steroid skeleton;
[0020] (d2) Preparation of products for catalyzing β-hydroxylation at the C16 position of the steroid skeleton;
[0021] (d3) Preparation of 16β-OH-TE using TE as a substrate;
[0022] (d4) Preparation of 16β-OH-TE products using TE as a substrate;
[0023] (d5) Preparation of 16β-OH-PG using PG as a substrate;
[0024] (d6) Preparation of 16β-OH-PG product using PG as substrate.
[0025] The DzinCYP90G6 protein mentioned above is either (b1) or (b2) or (b3) or (b4) as follows:
[0026] (b1) The protein shown in SEQ ID NO: 4;
[0027] (b2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein described in (b1);
[0028] (b3) A protein that has the same function as (b1) by substitution and / or deletion and / or addition of one or more amino acid residues;
[0029] (b4) is a protein that has more than 80% identity with (b1) and has the same function.
[0030] The DzinCYP90G6 protein is derived from Dioscorea zingiberensis.
[0031] The DzinCYP90G6 protein-related biological materials are the DzinCYP90G6 gene, expression cassettes containing the DzinCYP90G6 gene, or recombinant microorganisms containing the DzinCYP90G6 gene.
[0032] The DzinCYP90G6 gene is the gene that encodes the DzinCYP90G6 protein.
[0033] Specifically, the coding region of the DzinCYP90G6 gene is shown as positions 851-2317 in SEQ ID NO: 3.
[0034] Specifically, the expression cassette containing the DzinCYP90G6 gene is shown in positions 51-2817 of SEQ ID NO: 3.
[0035] Specifically, the recombinant microorganism possessing the DzinCYP90G6 gene is a recombinant strain that integrates an expression cassette containing the DzinCYP90G6 gene into the genomic DNA of *Saccharomyces cerevisiae*. Specifically, the recombinant microorganism possessing the DzinCYP90G6 gene is a recombinant strain that integrates an expression cassette containing the DzinCYP90G6 gene at the ATF2 site in the genomic DNA of *Saccharomyces cerevisiae*. Specifically, the recombinant microorganism possessing the DzinCYP90G6 gene is a recombinant strain in which the segment from the upstream homologous arm to the downstream homologous arm in the genomic DNA of *Saccharomyces cerevisiae* has been replaced with an expression cassette containing the DzinCYP90G6 gene. Specifically, the *Saccharomyces cerevisiae* is *Saccharomyces cerevisiae* BY4742.
[0036] The VvCPR protein described above is either (c1) or (c2) or (c3) or (c4):
[0037] (c1) The protein shown in SEQ ID NO: 5;
[0038] (c2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein described in (c1);
[0039] (c3) A protein that has the same function as (c1) by substitution and / or deletion and / or addition of one or more amino acid residues.
[0040] (c4) is a protein that has more than 80% identity with (c1) and has the same function.
[0041] The VvCPR protein is derived from Vitis vinifera.
[0042] The above-mentioned 80% or more identity can be 85% or more identity, 90% or more identity, 95% or more identity, 96% or more identity, 97% or more identity, 98% or more identity, or 99% or more identity.
[0043] The functional DNA molecule is a DNA molecule containing the DzinCYP90G6 gene and the VvCPR gene.
[0044] The functional DNA molecule is a DNA molecule with a DzinCYP90G6 gene expression cassette and a VvCPR gene expression cassette.
[0045] The DzinCYP90G6 gene is the gene that encodes the DzinCYP90G6 protein.
[0046] The VvCPR gene is the gene that encodes the VvCPR protein.
[0047] Specifically, the coding region of the DzinCYP90G6 gene is shown in positions 851-2317 of SEQ ID NO: 3. Specifically, the coding region of the VvCPR gene is shown in positions 951-3068 of SEQ ID NO: 2. Specifically, the DzinCYP90G6 gene expression cassette is shown in positions 51-2817 of SEQ ID NO: 3. Specifically, the VvCPR gene expression cassette is shown in positions 51-3568 of SEQ ID NO: 2. Specifically, the functional DNA molecule is shown in positions 51-6335 of SEQ ID NO: 3. Specifically, the functional DNA molecule is shown in SEQ ID NO: 3.
[0048] Specifically, the recombinant microorganism possessing the functional DNA molecule is a recombinant bacterium that has integrated the functional DNA molecule into the genomic DNA of *Saccharomyces cerevisiae*. Specifically, the recombinant microorganism possessing the functional DNA molecule is a recombinant bacterium that has integrated the functional DNA molecule into the ATF2 site in the genomic DNA of *Saccharomyces cerevisiae*. Specifically, the recombinant microorganism possessing the functional DNA molecule is a recombinant bacterium in which the segment from the upstream homologous arm to the downstream homologous arm in the genomic DNA of *Saccharomyces cerevisiae* has been replaced with the functional DNA molecule. Specifically, the *Saccharomyces cerevisiae* is *Saccharomyces cerevisiae* BY4742.
[0049] Specifically, the upstream homologous arm is shown in bits 1-50 of SEQ ID NO: 3. Specifically, the downstream homologous arm is shown in bits 6336-6385 of SEQ ID NO: 3.
[0050] The tool plasmid is a gene editing tool plasmid targeting the ATF2 site.
[0051] Specifically, the tool plasmid contains the Cas9 gene, the URA3 gene, and the sgRNA gene. Specifically, the target sequence binding region of the sgRNA gene is shown in positions 9072-9091 of SEQ ID NO: 1. Specifically, the sgRNA gene is shown in positions 9072-9166 of SEQ ID NO: 1. Specifically, the Cas9 gene is shown in positions 2635-6774 of SEQ ID NO: 1. Specifically, the URA3 gene is shown in positions 7828-8631 of SEQ ID NO: 1. Specifically, the tool plasmid is shown in SEQ ID NO: 1.
[0052] The steroid skeleton refers to the cyclopentane-p-phenanthroline skeleton in steroids.
[0053] TE: Testosterone. Specifically, TE is the compound represented by formula (I).
[0054] PG: Progesterone. Specifically, PG is the compound represented by formula (II).
[0055] 16β-OH-TE is the compound represented by formula (Ⅲ).
[0056] 16β-OH-PG is the compound shown in formula (Ⅳ).
[0057] In the embodiments of this invention, the DzinCYP90G6 gene expression cassette and the VvCPR gene expression cassette were integrated into *Saccharomyces cerevisiae* to obtain recombinant *Saccharomyces cerevisiae*. This recombinant *Saccharomyces cerevisiae* can efficiently catalyze the conversion of TE to 16β-OH-TE, and can also efficiently catalyze the conversion of PG to 16β-OH-PG. The results indicate that the DzinCYP90G6 protein has the activity to catalyze β-hydroxylation at the C16 position of the steroid backbone, meaning that the DzinCYP90G6 protein can introduce hydroxyl groups at the C16 position of the steroid backbone in a β-conformation (with regioselectivity and stereoselectivity). This hydroxylation reaction is difficult to achieve through chemical methods. Activating the inert CH at the C16 position of the steroid is a key step in the production of high-value-added steroid drugs, and this invention provides important insights for the modification of steroid drug scaffolds. Attached Figure Description
[0058] Figure 1 This is a plasmid map of the pURA3-CRISPR-ATF2 plasmid.
[0059] Figure 2 HPLC chromatogram and MS mass spectrum when the substrate is testosterone.
[0060] Figure 3 HPLC chromatogram and MS mass spectrum when the substrate is progesterone.
[0061] Figure 4 The NOESY spectrum of the TE conversion product (600MHz, CDCl3).
[0062] Figure 5 The HSQC spectrum (600MHz, CDCl3) of the conversion product of TE.
[0063] Figure 6 The conversion product of TE 1 H- 1 H COSY spectrum (600MHz, CDCl3).
[0064] Figure 7 The HMBC spectrum (600MHz, CDCl3) of the TE conversion product.
[0065] Figure 8 The NOESY spectrum of the conversion product of PG (600MHz, CDCl3).
[0066] Figure 9 The HSQC spectrum (600MHz, CDCl3) of the conversion product of PG.
[0067] Figure 10 The conversion product of PG 1 H- 1 H COSY spectrum (600MHz, CDCl3).
[0068] Figure 11 The HMBC spectrum (600MHz, CDCl3) of the conversion product of PG. Detailed Implementation
[0069] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0070] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available. Saccharomyces cerevisiae strain BY4742 is also known as Saccharomyces cerevisiae strain BY4742.
[0071] SD-URA - Plate preparation method: Dissolve 1.6g of SD-URA in 60mL of water and autoclave to obtain solution A; dissolve 4g of agar powder in 120mL of water and autoclave to obtain solution B; prepare a 20g / 100mL glucose aqueous solution using glucose and water, then filter it through a 0.22μm pore size membrane for sterilization to obtain 20mL of solution C; mix 60mL of solution A, 120mL of solution B, and 20mL of solution C, and pour the mixture into plates. SD-URA: FUNGENOME, catalog number YGM003A-3.
[0072] Testosterone (TE): Chemical formula C 19 H 28 O2; molecular weight 288.42; CAS Registry Number 58-22-0; structural formula is shown in Formula (Ⅰ).
[0073]
[0074] Progesterone (PG): Chemical formula C 21 H 30 O2; molecular weight 314.462; CAS Registry Number 57-83-0; structural formula is shown in Formula (II).
[0075]
[0076] Example 1: Preparation of tool plasmids and donor DNA molecules
[0077] The tool plasmid is pURA3-CRISPR-ATF2 plasmid, and its plasmid map can be found in [link to image]. Figure 1 The plasmid is a circular plasmid, and its full sequence is shown in SEQ ID NO: 1. In SEQ ID NO: 1, nucleotides 2635-6774 form the Cas9 gene (coding strand), nucleotides 7828-8631 form the URA3 gene (template strand), and nucleotides 9072-9166 are transcribed to form sgRNA.
[0078] Donor DNA molecule I is a linear DNA molecule, as shown in SEQ ID NO: 2. In SEQ ID NO: 2, nucleotides 1-50 form the upstream homologous arm of the ATF2 site, nucleotides 51-950 form the promoter, nucleotides 951-3068 form the VvCPR gene (codon optimized based on Saccharomyces cerevisiae, 2118 bp), nucleotides 3069-3568 form the terminator, and nucleotides 3569-3618 form the downstream homologous arm of the ATF2 site. In SEQ ID NO: 2, nucleotides 51-3568 form the VvCPR gene expression cassette (coding strand).
[0079] Donor DNA molecule II is a linear DNA molecule, as shown in SEQ ID NO: 3. In SEQ ID NO: 3, nucleotides 1-50 form the upstream homologous arm of the ATF2 site, nucleotides 51-850 form the promoter, nucleotides 851-2317 form the DzinCYP90G6 gene (codon optimized based on Saccharomyces cerevisiae, 1467 bp), nucleotides 2318-2817 form the terminator, nucleotides 2818-3317 form the reverse complement sequence of the terminator, nucleotides 3318-5435 form the reverse complement sequence of the VvCPR gene, nucleotides 5436-6335 form the reverse complement sequence of the promoter, and nucleotides 6336-6385 form the downstream homologous arm of the ATF2 site. In SEQ ID NO: 3, nucleotides 51-2817 constitute the DzinCYP90G6 gene expression cassette (coding strand), and nucleotides 2818-6335 constitute the VvCPR gene expression cassette (template strand).
[0080] Example 2: Construction of recombinant bacteria
[0081] I. Construction of recombinant strain BY001
[0082] 1. Inoculate Saccharomyces cerevisiae BY4742 into liquid YPD medium and incubate at 30°C with shaking at 250 rpm until the culture system reaches OD. 600nm The concentration was set to 0.8-1.5. The cells were then centrifuged at 12000g for 1 minute, the supernatant was discarded, and the bacterial pellet was washed with distilled water and resuspended in 1 mL of pretreatment reagent. The pellet was then incubated at room temperature for 30 minutes, followed by centrifugation at 12000g for 1 minute. The supernatant was discarded, and the bacterial pellet was washed with 1M sorbitol aqueous solution pre-chilled in an ice bath. Pretreatment reagent: Contains 100 mM LiAc, 10 mM DTT, 0.6 M sorbitol, with the remainder being Tris-HCl buffer (pH 7.5, 10 mM).
[0083] 2. Mix pURA3-CRISPR-ATF2 plasmid and donor DNA molecule I in equal mass and resuspend in ddH2O to obtain DNA solution.
[0084] 3. Resuspend the bacterial pellet obtained in step 1 in 60 μL of 1M sorbitol aqueous solution pre-chilled on ice, then add 6 μL of the DNA solution prepared in step 2 (with a DNA content of 500-1000 ng), mix well, and incubate on ice for 5 minutes. Then perform electroporation using a Gene Pulse Analyzer II (Bio-Rad, Hercules, CA) at 2.7 kV. Immediately after electroporation, add 1 mL of 1M sorbitol aqueous solution pre-chilled on ice and incubate at 30°C and 250 rpm for 60 minutes.
[0085] 4. After completing step 3, centrifuge at 12000g for 1 minute, discard the supernatant, resuspend the bacterial pellet in 1M sorbitol aqueous solution, and then spread it onto SD-URA. - Plate incubation at 30℃ for 2-3 days.
[0086] 5. After completing step 4, pick a single colony, extract genomic DNA, and perform PCR identification using the genomic DNA as a template. The primer pair for PCR identification consists of primer ATF2-YF (ATF2-YF: AAAGACAACAACAAATGTGTAGGGC) and primer VVCPR-YR (VVCPR-YR: TCGAATGGGGATACCTTTACGGAG). If a 1060bp amplification product is obtained, the PCR identification is positive.
[0087] The recombinant strain that tested positive by PCR was a recombinant strain that integrated the VvCPR gene expression cassette into the ATF2 site of the genomic DNA of Saccharomyces cerevisiae BY4742 (specifically, a recombinant strain in which the segment from the upstream homologous arm to the downstream homologous arm of the genomic DNA of Saccharomyces cerevisiae BY4742 was replaced with donor DNA molecule I), and was named recombinant strain BY001.
[0088] II. Construction of recombinant strain BY002
[0089] 1. Same as step 1 in step one.
[0090] 2. Mix pURA3-CRISPR-ATF2 plasmid and donor DNA molecule II in equal mass and resuspend in ddH2O to obtain DNA solution.
[0091] 3. Resuspend the bacterial pellet obtained in step 1 in 60 μL of 1M sorbitol aqueous solution pre-chilled on ice, then add 6 μL of the DNA solution prepared in step 2 (with a DNA content of 500-1000 ng), mix well, and incubate on ice for 5 minutes. Then perform electroporation using a Gene Pulse Analyzer II (Bio-Rad, Hercules, CA) at 2.7 kV. Immediately after electroporation, add 1 mL of 1M sorbitol aqueous solution pre-chilled on ice and incubate at 30°C and 250 rpm for 60 minutes.
[0092] 4. After completing step 3, centrifuge at 12000g for 1 minute, discard the supernatant, resuspend the bacterial pellet in 1M sorbitol aqueous solution, and then spread it onto SD-URA. - Plate incubation at 30℃ for 2-3 days.
[0093] 5. After completing step 4, pick a single colony, extract genomic DNA, and perform PCR identification using the genomic DNA as a template. PCR identification uses primer pair 1 and primer pair 2. Primer pair 1 consists of primer ATF2-YF (ATF2-YF: AAAGACAACAACAAATGTGTAGGGC) and primer 90-YR (90-YR: CCAAGATTCATTAGCACCAGATCTC). Primer pair 2 consists of primer VVCPR-YF (VVCPR-YF: CACCTGATTCTGATGATACGTTTGA) and primer ATF2-YR (ATF2-YR: CAAGACTCCAAAACTTGTCATTGTC). If primer pair 1 yields a 1024 bp amplification product and primer pair 2 yields a 1138 bp amplification product, the PCR identification is positive.
[0094] The recombinant strain that tested positive by PCR was a recombinant strain that integrated the DzinCYP90G6 gene expression cassette and the VvCPR gene expression cassette at the ATF2 site in the genomic DNA of Saccharomyces cerevisiae BY4742 (specifically, the segment from the upstream homologous arm to the downstream homologous arm in the genomic DNA of Saccharomyces cerevisiae BY4742 was replaced with donor DNA molecule II), and was named recombinant strain BY002.
[0095] The characteristics of the originating bacteria and each recombinant bacteria are described in Table 1.
[0096] Table 1
[0097] Feature Description brewing yeast BY4742 MATα,his3Δ1,leu2Δ0,lys2Δ0,ura3Δ0 Recombinant strain BY001 <![CDATA[BY4742,ATF2::P ENO1 -VvCPR-T CPS1 ]]> Recombinant strain BY002 <![CDATA[BY4742,ATF2::P FBA1 -DzinCYP90G6-T ENO2 -T CPS1 -VvCPR-P ENO1 ]]>
[0098] Example 3: Detection of catalytic activity
[0099] The test strains were *Saccharomyces cerevisiae* BY4742, recombinant strain BY001, or recombinant strain BY002. The substrates were testosterone or progesterone. The substrate solution was prepared by dissolving the substrate in DMSO to a concentration of 10 g / L.
[0100] I. Culture of the test bacteria
[0101] 1. Inoculate a single clone of the test bacteria into liquid YPD medium and culture at 30°C and 250 rpm for 12 hours to obtain the seed culture.
[0102] 2. Inoculate 1 mL of the seed culture obtained in step 1 into 30 mL of liquid YPD medium and culture at 30°C and 250 rpm for 24 hours.
[0103] 3. After completing step 2, add substrate solution to the system (to make the concentration of substrate in the system 170 mg / L), and incubate at 30°C and 250 rpm for 72 hours with shaking.
[0104] II. Preparation of crude product
[0105] 1. After completing step 3 of step one, extract the fermentation supernatant three times with ethyl acetate and combine the organic phases. Dry the organic phases with anhydrous magnesium sulfate and filter them sequentially. Then collect the filtrate and evaporate the solvent under vacuum to obtain the crude product.
[0106] 2. Take the crude product obtained in step 1, dissolve it in methanol, then filter it through a 0.22 μm pore size filter membrane and collect the filtrate.
[0107] III. HPLC-MS Identification
[0108] Take the filtrate obtained in step 2 and perform HPLC-MS.
[0109] The HPLC parameters are as follows:
[0110] Chromatograph: Agilent 1260 high performance liquid chromatograph;
[0111] Chromatographic column: InertSustain C18 reversed-phase column (250mm×4.6mm, 5μm; Shimadzu, Japan);
[0112] Mobile phase: composed of 10 parts by volume of acetonitrile and 90 parts by volume of water; mobile phase flow rate: 0.8 mL / min;
[0113] Column temperature: 30℃; Detector: UV / Vis detector (254nm).
[0114] The MS parameters are as follows:
[0115] Mass spectrometer: Bruker-micrOTOF-II mass spectrometer equipped with an electrospray ionization (ESI) interface;
[0116] Mass spectrometry operating conditions: acquire spectra in positive ion mode in the range of 100-1200 m / z, dry gas flow rate of 6.0 L / min, drying temperature of 180 °C, nebulizer pressure of 1 bar, and capillary voltage of +4.5 kV.
[0117] When the substrate is testosterone, the HPLC chromatogram and MS mass spectrum are shown below. Figure 2 . Figure 2 Figure 'a' shows the chromatograms of testosterone standard and three tested bacteria under the same HPLC parameters. It can be observed that the filtrates obtained from the above steps for all three tested bacteria contained the substrate testosterone. Only the recombinant bacteria BY002 showed a new target peak before the testosterone target peak (the retention time corresponding to the peak value was 10.7 min). Figure 2 b is the MS mass spectrum of the testosterone standard. Figure 2 c represents the MS mass spectrum of the target peak of the new substance in the filtrate obtained from the above steps of recombinant bacteria BY002 by HPLC. The positive ion mass spectrometry (MS) of the new substance [M+H]... + The result was 305.2130, an increase of 16 compared to the testosterone standard. The results indicate that the molecular formula of the new substance is C0. 19 H 28 O3 is a product of testosterone hydroxylation.
[0118] When the substrate is progesterone, the HPLC chromatogram and MS mass spectrum are shown below. Figure 3 . Figure 3 Figure 'a' shows the chromatograms of progesterone standard and three tested bacteria under the same HPLC parameters. It can be observed that the filtrates obtained from the above steps for all three tested bacteria contain the substrate progesterone. Only the recombinant bacteria BY002 showed a new target peak before the progesterone target peak (the retention time corresponding to the peak value was 11.4 min). Figure 3 b is the MS mass spectrum of the progesterone standard. Figure 2 c represents the MS mass spectrum of the target peak of the new substance in the filtrate obtained from the above steps of recombinant bacteria BY002 by HPLC. The positive ion mass spectrometry (MS) of the new substance [M+H]... + The result was 331.2162, an increase of 16 compared to the progesterone standard. The results indicate that the molecular formula of the new substance is C0. 21 H 30 O3 is a product of progesterone hydroxylation.
[0119] Example 4: Detection of regioselectivity and stereoselectivity of catalysis
[0120] The test bacterium was recombinant strain BY002. The substrates were either testosterone or progesterone. The substrate solution was prepared by dissolving the substrate in DMSO to a concentration of 10 g / L.
[0121] I. Culture of the test bacteria
[0122] 1. Inoculate a single clone of the test bacteria into 3 mL of liquid YPD medium and culture at 30°C and 250 rpm for 12 hours to obtain the seed culture.
[0123] 2. Inoculate 3 mL of the seed culture obtained in step 1 into 500 mL of liquid YPD medium and incubate at 30°C with shaking at 250 rpm until the system reaches OD. 600nm The value is 6.
[0124] 3. After completing step 2, add substrate solution to the system (to make the concentration of substrate in the system 1 g / L), and incubate at 30℃ and 250 rpm for 72 hours with shaking.
[0125] II. Preparation of crude product
[0126] 1. After completing step 3 of step one, extract the fermentation supernatant three times with ethyl acetate and combine the organic phases. Dry the organic phases with anhydrous magnesium sulfate and filter them sequentially. Then collect the filtrate and evaporate the solvent under vacuum to obtain the crude product.
[0127] 2. Take the crude product obtained in step 1, dissolve it in methanol, then filter it through a 0.22 μm pore size filter membrane and collect the filtrate.
[0128] III. HPLC Purification
[0129] Take the filtrate obtained in step 2 and perform HPLC.
[0130] The HPLC parameters are as follows:
[0131] Chromatograph: Agilent 1260 high performance liquid chromatograph;
[0132] Column: Zorbax Eclipse XDB C18 column (Agilent Technologies, USA);
[0133] Mobile phase: composed of 10 parts by volume of acetonitrile and 90 parts by volume of water; mobile phase flow rate: 10 mL / min;
[0134] Column temperature: 30℃; Detector: UV / Vis detector (254nm).
[0135] Collect the post-column solution corresponding to the product peak (the chromatogram shows only two peaks, the first peak being the product peak and the second peak being the substrate peak), evaporate the solvent under vacuum, and obtain the product.
[0136] When the substrate is testosterone, the product obtained is called the conversion product of TE.
[0137] When the substrate is progesterone, the resulting product is called the conversion product of PG.
[0138] IV. NMR Identification
[0139] The TE conversion product or the PG conversion product were dissolved in deuterated chloroform, and then analyzed using an AVANCE III HDNMR spectrometer (Bruker, Germany). 1 H, 13 Identification was performed using C, COSY, HSQC, HMBC, and NOESY NMR.
[0140] TE conversion products 1 ¹H NMR (600MHz, CDCl₃) data are as follows: δ 5.73 (s, 1H), 3.37–4.17 (m, 2H), 2.28–2.56 (m, 4H), 1.89–2.23 (m, 3H), 1.65–1.86 (m, 3H), 1.30–1.58 (m, 3H), 0.81–1.11 (m, 4H), 17.4 (s, 3H), 11.9 (s, 3H). The conversion products of TE... 13 CNMR (150MHz, CDCl3) data are as follows: δ 199.7, 171.2, 123.9, 80.6, 69.9, 54.1, 47.0, 42.4, 38.7, 37.1, 35.7, 35.1, 35.0, 34.0, 32.7, 31.7, 20.4, 17.4, 11.9. The NOESY spectrum (600MHz, CDCl3) of the TE conversion product is shown below. Figure 4 The HSQC spectrum (600MHz, CDCl3) of the TE conversion product is shown below. Figure 5 TE conversion products 1 H- 1 H COSY spectrum (600MHz, CDCl3) see Figure 6 The HMBC spectrum (600MHz, CDCl3) of the TE conversion product is shown below. Figure 7 .
[0141] PG conversion products 1 ¹H NMR data were: (600 MHz, CDCl₃) δ 5.74 (s, 1H), 4.59 (m, 1H), 2.22–2.44 (m, 6H), 1.70–2.07 (m, 4H), 1.40–1.65 (m, 5H), 1.00–1.05 (m, 3H), 2.22 (s, 3H), 1.21 (s, 3H), 1.02 (s, 3H). The conversion products of PG... 13CNMR (150MHz, CDCl3) data are as follows: δ 212.9, 199.5, 170.8, 124.0, 72.2, 66.0, 53.8, 53.4, 43.9, 38.9, 38.6, 36.8, 35.7, 35.2, 33.9, 32.7, 32.5, 31.8, 20.7, 17.4, 14.7. The NOESY spectrum (600MHz, CDCl3) of the PG conversion product is shown below. Figure 8 The HSQC spectrum (600MHz, CDCl3) of the PG conversion product is shown below. Figure 9 PG conversion products 1 H- 1 H COSY spectrum (600MHz, CDCl3) see Figure 10 The HMBC spectrum (600MHz, CDCl3) of the PG conversion product is shown below. Figure 11 .
[0142] The results showed that the conversion product of TE was the compound shown in formula (Ⅲ).
[0143] The results showed that the conversion product of PG was the compound shown in formula (Ⅳ).
[0144]
[0145] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.
Claims
1. The application of DzinCYP90G6 protein is as described in any of (a1) to (a6) below: (a1) Application in catalyzing β-hydroxylation at the C16 position of the steroid skeleton; (a2) Application in the preparation of products for catalyzing β-hydroxylation at the C16 position of the steroid skeleton; (a3) Application in the preparation of 16β-OH-TE using TE as a substrate; (a4) Application in the preparation of 16β-OH-TE products using TE as a substrate; (a5) Application in the preparation of 16β-OH-PG using PG as a substrate; (a6) Application in the preparation of 16β-OH-PG products using PG as a substrate; The DzinCYP90G6 protein is as follows (b1) or (b2) or (b3) or (b4): (b1) The protein shown in SEQ ID NO: 4; (b2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein described in (b1); (b3) A protein that has the same function as (b1) by substitution and / or deletion and / or addition of one or more amino acid residues; (b4) is a protein that has more than 80% identity with (b1) and has the same function.
2. The application of DzinCYP90G6 protein-related biomaterials is as described in any one of (a1) to (a6) below: (a1) Application in catalyzing β-hydroxylation at the C16 position of the steroid skeleton; (a2) Application in the preparation of products for catalyzing β-hydroxylation at the C16 position of the steroid skeleton; (a3) Application in the preparation of 16β-OH-TE using TE as a substrate; (a4) Application in the preparation of 16β-OH-TE products using TE as a substrate; (a5) Application in the preparation of 16β-OH-PG using PG as a substrate; (a6) Application in the preparation of 16β-OH-PG products using PG as a substrate; The DzinCYP90G6 protein-related biological material is the DzinCYP90G6 gene, an expression cassette containing the DzinCYP90G6 gene, or a recombinant microorganism containing the DzinCYP90G6 gene. The DzinCYP90G6 gene is the gene encoding the DzinCYP90G6 protein as described in claim 1.
3. The application of DzinCYP90G6 protein and VvCPR protein is as described in any of (a1) to (a6) below: (a1) Application in catalyzing β-hydroxylation at the C16 position of the steroid skeleton; (a2) Application in the preparation of products for catalyzing β-hydroxylation at the C16 position of the steroid skeleton; (a3) Application in the preparation of 16β-OH-TE using TE as a substrate; (a4) Application in the preparation of 16β-OH-TE products using TE as a substrate; (a5) Application in the preparation of 16β-OH-PG using PG as a substrate; (a6) Application in the preparation of 16β-OH-PG products using PG as a substrate; The DzinCYP90G6 protein is the DzinCYP90G6 protein as described in claim 1; The VvCPR protein is either (c1) or (c2) or (c3) or (c4): (c1) The protein shown in SEQ ID NO: 5; (c2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein described in (c1); (c3) A protein that has the same function as (c1) by substitution and / or deletion and / or addition of one or more amino acid residues. (c4) is a protein that has more than 80% identity with (c1) and has the same function.
4. The application of functional DNA molecules or recombinant microorganisms containing functional DNA molecules, as described in any of (a1) to (a6) below: (a1) Application in catalyzing β-hydroxylation at the C16 position of the steroid skeleton; (a2) Application in the preparation of products for catalyzing β-hydroxylation at the C16 position of the steroid skeleton; (a3) Application in the preparation of 16β-OH-TE using TE as a substrate; (a4) Application in the preparation of 16β-OH-TE products using TE as a substrate; (a5) Application in the preparation of 16β-OH-PG using PG as a substrate; (a6) Application in the preparation of 16β-OH-PG products using PG as a substrate; The functional DNA molecule is a DNA molecule containing the DzinCYP90G6 gene and the VvCPR gene. The DzinCYP90G6 gene is the gene encoding the DzinCYP90G6 protein as described in claim 1; The VvCPR gene is the gene encoding the VvCPR protein as described in claim 3.
5. Application of functional DNA molecules in the preparation of recombinant microorganisms; said recombinant microorganisms having any of the functions described in (d1) to (d6): (d1) Catalyzes β-hydroxylation at the C16 position of the steroid skeleton; (d2) Preparation of products for catalyzing β-hydroxylation at the C16 position of the steroid skeleton; (d3) Preparation of 16β-OH-TE using TE as a substrate; (d4) Preparation of 16β-OH-TE products using TE as a substrate; (d5) Preparation of 16β-OH-PG using PG as a substrate; (d6) Preparation of 16β-OH-PG product using PG as substrate; The functional DNA molecule is the functional DNA molecule described in claim 4.
6. Application of functional DNA molecules and tool plasmids in the preparation of recombinant microorganisms; said recombinant microorganisms having any of the functions described in (d1) to (d6): (d1) Catalyzes β-hydroxylation at the C16 position of the steroid skeleton; (d2) Preparation of products for catalyzing β-hydroxylation at the C16 position of the steroid skeleton; (d3) Preparation of 16β-OH-TE using TE as a substrate; (d4) Preparation of 16β-OH-TE products using TE as a substrate; (d5) Preparation of 16β-OH-PG using PG as a substrate; (d6) Preparation of 16β-OH-PG product using PG as substrate; The functional DNA molecule is the functional DNA molecule described in claim 4; The tool plasmid is a gene editing tool plasmid targeting the ATF2 site.