A grifola frondosa-derived beta-glucosidase and its use in gypenoside conversion

By cloning a highly specific β-glucosidase from Grifola frondosa and expressing it in Pichia pastoris, the problem of insufficient glycosidic bond specificity of existing enzymes in the conversion of Gynostemma pentaphyllum saponins was solved, achieving high-purity preparation of ginsenosides Rd and F2 and reducing production costs.

CN122189142APending Publication Date: 2026-06-12SOUTH CHINA AGRICULTURAL UNIVERSITY

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
SOUTH CHINA AGRICULTURAL UNIVERSITY
Filing Date
2026-03-27
Publication Date
2026-06-12

AI Technical Summary

Technical Problem

Existing β-glucosidases exhibit poor glycosidic bond specificity in the conversion of ginsenosides from Gynostemma pentaphyllum, resulting in low purity of ginsenosides Rd and F2, generating various byproducts, increasing the difficulty and cost of separation and purification, and making it difficult to meet industrial needs.

Method used

A β-glucosidase with high glycosidic bond specificity was cloned from Grifola frondosa. It was expressed and purified in Pichia pastoris GS115 by constructing a Pichia pastoris expression vector. It was then applied to the targeted transformation of Gynostemma pentaphyllum saponins Gyp III and Gyp XVII to avoid non-specific hydrolysis.

🎯Benefits of technology

It improves the purity of ginsenosides Rd and F2, reduces the difficulty and cost of subsequent separation and purification, expands the resource library of β-glucosidase, and is suitable for the application of medicinal fungal enzymes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122189142A_ABST
    Figure CN122189142A_ABST
Patent Text Reader

Abstract

The present application belongs to the technical field of genetic engineering, and particularly relates to a kind of β-glucosidase from Grifola frondosa and its application in gypenoside conversion.The present application clones a kind of β-glucosidase from Grifola frondosa, which has the characteristics of strong specificity of glycosidic bond recognition and no by-product generation, and when applied to gypenoside conversion, can accurately catalyze Gyp III to be converted into ginsenoside Rd and Gyp XVII to be converted into ginsenoside F2.The β-glucosidase can effectively improve the purity of target products ginsenoside Rd and F2, and the enzyme is novel in origin, provides a new candidate for mining and application of medicinal fungal β-glucosidase, and can provide support for related product development in the medical and health care industries.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a β-glucosidase derived from Grifola frondosa and its application in the conversion of Gynostemma pentaphyllum saponins. Background Technology

[0002] Ginsenoside Rd and ginsenoside F2 both belong to the dammarane-type triterpenoid glycosides and possess various pharmacological activities, including antitumor, immunomodulatory, and cardiovascular protective effects, showing broad application prospects in the pharmaceutical and health product fields. However, ginsenoside F2 is extremely rare, found in very low amounts in natural raw materials such as ginseng and American ginseng. Furthermore, ginseng's long growth cycle (5-6 years), stringent environmental requirements, and challenging cultivation management result in high costs for natural raw materials, hindering the large-scale acquisition of ginsenosides Rd and F2. Additionally, their complex chemical structures lead to cumbersome steps, demanding reaction conditions, numerous byproducts, and low yields in their complete chemical synthesis, which also poses environmental pollution risks, failing to meet the demands of industrial production. Enzymatic biotransformation has become the mainstream technology for the large-scale preparation of rare ginsenosides due to its advantages such as mild reaction conditions, environmental friendliness, and high product specificity. Gynostemma pentaphyllum is a plant used for both food and medicine, with a short growth cycle, allowing for large-scale artificial cultivation and low raw material costs. Its gypenosides III and XVII belong to the dammarane-type triterpenoid glycosides, sharing high structural homology with ginsenosides, making them ideal substrates for the targeted conversion of rare ginsenosides Rd and F2, replacing ginseng as a raw material.

[0003] β-glucosidase is a key enzyme catalyzing the hydrolysis and targeted conversion of Gynostemma pentaphyllum saponins into rare ginsenosides. Its core function is to specifically recognize and hydrolyze the glucosidic bonds on the glycosidic side chains of Gynostemma pentaphyllum saponins, removing excess glycosyl groups to obtain rare ginsenosides with higher activity. Specifically, Gynostemma pentaphyllum saponins III and XVII require the hydrolysis of specific glucosidic bonds to be precisely converted into ginsenoside Rd and ginsenoside F2. This conversion process demands extremely high glycosidic bond specificity from β-glucosidase; it is only permitted to hydrolyze the target glycosidic bonds and cannot hydrolyze glycosidic bonds at other sites. Otherwise, byproducts will be generated, reducing product purity and increasing the difficulty and cost of subsequent separation and purification.

[0004] Currently, the β-glucosidases reported both domestically and internationally mainly originate from common microorganisms such as Trichoderma, Aspergillus niger, and yeast. Although some genes of these enzymes have been cloned and heterologously expressed, there are still significant technical shortcomings: the glycosidic bond specificity of enzymes from most strains is poor, making it impossible to accurately identify the target glucosidic bonds on Gynostemma pentaphyllum saponin III (Gyp III) and Gynostemma pentaphyllum saponin XVII (Gyp XVII). During hydrolysis, they non-specifically cleave glycosidic bonds at other sites, generating various byproducts, ultimately leading to low product purity and high costs for subsequent separation and purification.

[0005] Grifola frondosa is a valuable medicinal fungus, rich in various active ingredients and abundant in glycosidases. However, there are currently no reports, either domestically or internationally, of cloning β-glucosidase from Grifola frondosa, nor any research on using Grifola frondosa-derived β-glucosidase for the conversion of Gynostemma pentaphyllum saponins. Existing technologies for β-glucosidase generally suffer from poor glycosidic bond specificity and the easy generation of byproducts during the conversion process, making it difficult to meet the high-purity preparation requirements of ginsenosides Rd and F2. Therefore, discovering and obtaining highly specific β-glucosidases is of great significance for overcoming existing technological bottlenecks. Summary of the Invention

[0006] To overcome the shortcomings of the prior art, this invention clones a β-glucosidase with glycosidic bond specificity from Grifola frondosa, enabling the targeted and precise conversion of Gynostemma pentaphyllum saponins Gyp III and Gyp XVII, avoiding non-specific hydrolysis and the generation of byproducts, thereby effectively improving the purity of ginsenosides Rd and F2. Furthermore, the β-glucosidase and its conversion method of this invention are applicable to the discovery and application of enzymes derived from medicinal fungi, and can be extended to the targeted conversion of other saponin substrates, possessing broad promotional value and industrial application potential.

[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows: The first aspect of this invention provides the application of β-glucosidase derived from Grifola frondosa in the conversion of Gynostemma pentaphyllum saponins, wherein the conversion of Gynostemma pentaphyllum saponins refers to the directed conversion of Gynostemma pentaphyllum saponin Gyp III into ginsenoside Rd, and / or the directed conversion of Gynostemma pentaphyllum saponin Gyp XVII into ginsenoside F2; the cDNA sequence of the gene encoding the β-glucosidase is shown in SEQ ID No. 1.

[0008] Preferably, the method for obtaining the β-glucosidase is as follows: cloning the β-glucosidase gene of Grifola frondosa, constructing the Pichia pastoris pPIC9K expression vector, transforming it into the Pichia pastoris GS115 expression strain, inducing expression, and then isolating and purifying it to obtain Grifola frondosa β-glucosidase.

[0009] More preferably, the method for obtaining the β-glucosidase is as follows: cloning the β-glucosidase gene from Grifola frondosa using the upstream and downstream primers shown in SEQ ID No. 2 and SEQ ID No. 3, designing homologous arm primers shown in SEQ ID No. 4 and SEQ ID No. 5 at both ends of the target gene, constructing the Pichia pastoris pPIC9K expression vector, and then transforming it into the Pichia pastoris GS115 expression strain. After methanol induction expression, the vector is isolated and purified to obtain Grifola frondosa β-glucosidase.

[0010] Preferably, the induction expression of recombinant Pichia pastoris strains is carried out in BMMY medium, with 1-3% (v / v) methanol added daily to induce expression.

[0011] Preferably, after induction of expression, β-glucosidase is separated and purified by Ni ion affinity chromatography.

[0012] The second aspect of this invention also provides a method for converting Gynostemma pentaphyllum saponins into ginsenosides, specifically: dissolving Gynostemma pentaphyllum saponins Gyp III or Gyp XVII in a citrate-disodium hydrogen phosphate buffer solution to prepare a reaction solution; then adding β-glucosidase derived from Grifola frondosa to the Gyp III or Gyp XVII reaction solution; after the reaction, Gynostemma pentaphyllum saponins Gyp III can be directionally converted into ginsenoside Rd, or Gynostemma pentaphyllum saponins Gyp XVII can be directionally converted into ginsenoside F2; the cDNA sequence of the gene encoding the β-glucosidase is shown in SEQ ID No. 1.

[0013] Preferably, in the conversion system of Gynostemma pentaphyllum saponin Gyp III, the reaction temperature is 37 ℃, the pH is 5.5, the amount of β-glucosidase added is 50-100 U / mL (50 U / mL), and the reaction time is 4-6 h (5 h).

[0014] More preferably, in the conversion system of Gynostemma pentaphyllum saponin Gyp III, the reaction temperature is 37 °C, the pH is 5.5, the amount of β-glucosidase added is 50 U / mL, and the reaction time is 5 h.

[0015] Preferably, in the conversion system of Gynostemma pentaphyllum saponin Gyp XVII, the reaction temperature is 37 ℃, the pH is 5.5, the amount of β-glucosidase added is 50-100 U / mL (50 U / mL), and the reaction time is 3-4 h (4 h).

[0016] More preferably, in the conversion system of Gynostemma pentaphyllum saponin Gyp XVII, the reaction temperature is 37 ℃, the pH is 5.5, the amount of β-glucosidase added is 50 U / mL, and the reaction time is 4 h.

[0017] Preferably, the concentration of the Gyp III reaction solution or the Gyp XVII reaction solution is 1 to 1 mg / mL.

[0018] Preferably, the concentration of the citrate-disodium hydrogen phosphate buffer solution is 40–70 mM.

[0019] Compared with the prior art, the beneficial effects of the present invention are: (1) The present invention clones a β-glucosidase from Grifola frondosa. By utilizing its strong glycosidic bond recognition specificity, it can avoid the problem of non-specific hydrolysis and the generation of multiple by-products during the conversion of Gynostemma pentaphyllum saponins by existing β-glucosidase catalysis, thereby effectively improving the purity of ginsenosides Rd and F2 and reducing the difficulty and production cost of subsequent separation and purification processes.

[0020] (2) The β-glucosidase of Grifola frondosa cloned in this invention can precisely catalyze the directional conversion of Gyp III to ginsenoside Rd and the directional conversion of Gyp XVII to ginsenoside F2, which can overcome the problem of insufficient specificity of existing enzyme conversion, making the conversion process of Gynostemma pentaphyllum saponins easier to control and improving the yield of target products.

[0021] (3) This invention is the first to apply β-glucosidase from Grifola frondosa to the directional conversion of Gynostemma pentaphyllum saponins, overcoming the problems of single source of existing β-glucosidase and insufficient exploitation of medicinal fungal enzymes, and enriching the resource pool of β-glucosidase. Attached Figure Description

[0022] Figure 1 Electrophoresis diagram of total RNA extracted from Grifola frondosa; Note: 1~2: total RNA from Grifola frondosa.

[0023] Figure 2 Electrophoretic identification diagram of the target gene vector construction; Note: M: DNA Marker; 1~2: 19T-Gf-bglX.

[0024] Figure 3 Electrophoretic identification diagram of the target gene expression vector; Note: M: DNA Marker; 1~2: 9K-Gf-bglX.

[0025] Figure 4 Electrophoretic identification of Pichia pastoris GS115 expression strain; Note: M: DNA Marker; 1~4: GS115-Gf-bglX.

[0026] Figure 5 SDS-PAGE image of β-glucosidase; Note: M: protein marker; 1: Gf-bglX protein.

[0027] Figure 6 The effect of temperature on β-glucosidase activity.

[0028] Figure 7 The effect of pH on β-glucosidase activity.

[0029] Figure 8The hydrolysis of Gynostemma pentaphyllum saponin III by β-glucosidase; Note: 1: Standard; 2: Blank control without enzyme solution; 3: Gf-bglX + GypIII.

[0030] Figure 9 The hydrolytic effect of β-glucosidase on Gynostemma pentaphyllum saponin XVII; Note: 1: Standard; 2: Blank control without enzyme solution; 3: Gf-bglX + GypXVII.

[0031] Figure 10 The effect of temperature on the conversion of Gynostemma pentaphyllum saponins III; Note: Different lowercase letters indicate significant differences (P<0.05).

[0032] Figure 11 The effect of pH on the conversion of Gynostemma pentaphyllum saponins III; Note: Different lowercase letters indicate significant differences (P<0.05).

[0033] Figure 12 The effect of enzyme addition amount on the conversion of Gynostemma pentaphyllum saponin III; Note: Different lowercase letters represent significant differences (P<0.05).

[0034] Figure 13 The effect of reaction time on the conversion of Gynostemma pentaphyllum saponin III; Note: Different lowercase letters indicate significant differences (P<0.05).

[0035] Figure 14 The effect of temperature on the transformation of Gynostemma pentaphyllum saponins XVII; Note: Different lowercase letters indicate significant differences (P<0.05).

[0036] Figure 15 The effect of pH on the conversion of Gynostemma pentaphyllum saponins XVII; Note: Different lowercase letters indicate significant differences (P<0.05).

[0037] Figure 16 The effect of enzyme addition amount on the conversion of Gynostemma pentaphyllum saponins XVII; Note: Different lowercase letters represent significant differences (P<0.05).

[0038] Figure 17 The effect of reaction time on the conversion of Gynostemma pentaphyllum saponins XVII; Note: Different lowercase letters indicate significant differences (P<0.05). Detailed Implementation

[0039] The specific embodiments of the present invention will be further described below. It should be noted that these descriptions are for the purpose of aiding understanding the present invention, but do not constitute a limitation thereof. Furthermore, the technical features involved in the various embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0040] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, and the experimental materials used in the following embodiments are all available through conventional commercial channels.

[0041] Currently, although β-glucosidase is a key catalytic enzyme for the targeted conversion of Gynostemma pentaphyllum saponins to ginsenosides Rd and F2, existing enzyme preparations still have significant shortcomings. Most β-glucosidases exhibit poor glycosidic bond specificity, failing to accurately identify the target glycosidic bonds on Gyp III and Gyp XVII of Gynostemma pentaphyllum saponins. This leads to the generation of various byproducts during the conversion process, which not only reduces the purity of ginsenosides Rd and F2 but also makes subsequent separation and purification processes cumbersome and significantly increases costs, making it difficult to meet the demands of high-purity industrial-scale preparation.

[0042] To overcome the shortcomings and deficiencies of existing β-glucosidases in the conversion of Gynostemma pentaphyllum saponins, this invention provides a β-glucosidase cloned from Grifola frondosa and its application method in the conversion of Gynostemma pentaphyllum saponins. This enzyme features strong glycosidic bond recognition specificity and no byproduct generation, and can precisely catalyze the directional conversion of Gyp III to ginsenoside Rd and the directional conversion of Gyp XVII to ginsenoside F2. Compared with existing technologies, the β-glucosidase of this invention can effectively improve the purity of the target products ginsenosides Rd and F2. Furthermore, the enzyme's novel origin provides a new candidate for the discovery and application of β-glucosidases from medicinal fungi, and can support the development of related products in the pharmaceutical and health product industries.

[0043] To fully and clearly present the technical solution and significant advantages of the present invention, the present invention will be described in detail below with reference to specific embodiments.

[0044] Example 1: 1. Experimental Methods (1) Obtaining the β-glucosidase gene Based on the cDNA sequence of Grifola frondosa β-glucosidase from the GenBank database (GenBank: LUGG01000044.1), corresponding cloning primers were designed: upstream primer (SEQ ID No. 2): 5′-ATGTTGTCGGATGCATGTGTTGTC-3′; downstream primer (SEQ ID No. 3): 5′-CTACGCCTGCACCGTCAAAT-3′. Simultaneously, total RNA was extracted from Grifola frondosa using the STE method, and cDNA templates were prepared using a reverse transcription kit for PCR amplification. The amplification conditions were: 95 ℃ pre-denaturation for 5 min, 95 ℃ denaturation for 30 s, 57 ℃ annealing for 30 s, 72 ℃ extension for 30 s / kb, and 72 ℃ final extension for 10 min, for a total of 35 cycles. The amplified PCR product was excised from the gel, A was added to the end, and it was ligated into the cloning vector pMD-19T. The ligation was then carried out into E. coli competent cells DH5α. Positive clones were screened using LB resistant plates containing ampicillin (Amp), and the plasmid was extracted and sequenced to obtain the cloning vector pMD-bglX.

[0045] The cDNA sequence of the gene encoding the β-glucosidase (SEQ ID No. 1):

[0046] (2) Construction of recombinant expression vector A Pichia pastoris expression vector was constructed using homologous recombination. Homologous arm primers were designed at both ends of the target gene, and the proximal signal peptide was removed. Upstream primer (SEQ ID No. 4): 5′- CTGAAGCTTACGTAGAATTC TTTCCTCTTCATGCTCGTGGCAC-3′; Downstream primer (SEQ ID No. 5): 5′- GCGAATTAATTCGCGGCCGCATGATGATGATGATGATG CGCCTGCACCGTCAAATTTGT-3′, where the underlined portion of the primers indicates a homologous arm. Using the constructed cloning vector pMD-bglX as a template, PCR amplification was performed, and the product was recovered. The target gene fragment containing the homologous arm was obtained and ligated to the Pichia pastoris expression vector pPIC9K, which was digested with EcoRI and Not I. This ligation was then performed into *E. coli* competent cells DH5α, and positive clones were selected using LB agar plates containing Amp. The plasmid was extracted and sequenced to obtain the expression vector pPIC9K-bglX.

[0047] (3) Obtaining recombinant Pichia pastoris strains will The expression vector, after being digested with enzyme II, was transformed into Pichia pastoris GS115 competent cells, plated on MD plates for screening, and cultured at 30 ℃ for 2 days. Single colonies were selected for PCR identification (the primers used for identification were 5AOX1: 5′-GACTGGTTCCAATTGACAAGC-3′; 3AOX1: 5′-GCAAATGGCATTCTGACATCC-3′).

[0048] 2. Experimental Results (1) Extraction of total RNA The integrity of the extracted total RNA from Grifola frondosa was examined by 1% agarose gel electrophoresis. Figure 1 The electrophoresis image clearly shows three characteristic bands: 28S rRNA, 18S rRNA, and 5S rRNA, without tailing or diffusion. The 28S rRNA and 18S rRNA bands are particularly bright, indicating that the extracted RNA is of good quality and can be used for subsequent reverse transcription.

[0049] (2) Construction of the target gene cloning vector High-quality RNA was extracted and reverse transcribed into cDNA using a reverse transcription kit. This cDNA strand was then used as a template to amplify the corresponding β-glucosidase gene from *Grifola frondosa*. After gel extraction and recovery, A-terminal addition was performed, followed by cloning with the pMD cloning vector. TM-19T ligation was performed, and the transformed cells were introduced into *E. coli* competent cells DH5α. Randomly selected transformants were then subjected to PCR verification. If the target gene was successfully inserted into the vector, a specific band containing the target fragment and approximately 100–200 bp longer than the original sequence (vector sequence portion) would be amplified. Figure 2 It can be seen that the target gene band is between 2000 and 3000 bp, which preliminarily indicates that the target gene and the cloning vector have been successfully ligated.

[0050] (3) Construction of the target gene expression vector Homologous arms were added to both ends of the target gene, and the anterior signal peptide was removed. The target gene with the correct band size was then gel-cleaved and recombined with the linearized empty expression vector pPIC9K to construct an expression vector. This vector was then transformed into *E. coli* competent cells DH5α, and corresponding recombinant transformants were randomly selected for PCR verification. The PCR results are as follows: Figure 3 As shown, all selected recombinant transformants amplified bands of the expected size, indicating that the target gene and expression vector were successfully ligated.

[0051] (4) Obtaining the Pichia pastoris GS115 expression strain Using restriction endonucleases II. The recombinant expression vector was linearized and transformed into Pichia pastoris GS115 strain to obtain Mut. + Phenotypic expression strains. Figure 4 Electrophoresis patterns showed that each group of transformants exhibited two clear bands: a high-brightness band of approximately 2100 bp representing the original Pichia pastoris GS115 band, and a lower-brightness band above it representing the target gene fragment integrated into the AOX1 genome. Since the target gene is typically integrated as a single copy, its copy number is lower than that of the host's intrinsic fragment, hence the band brightness is relatively weak. The band size was consistent with expectations, and there were no obvious extraneous bands or tails, indicating that the target gene had been successfully integrated into the Pichia pastoris GS115 genome, resulting in a genetically stable Mut+ type expression strain, which can be used for subsequent induction expression and enzymatic property studies.

[0052] Example 2: 1. Experimental Methods (1) Induced expression of recombinant Pichia pastoris strains The recombinant strain was inoculated into YPD medium and cultured overnight at 30 °C. Then, 2% (V / V) bacterial solution was inoculated into BMGY medium and cultured at 30 °C until the logarithmic phase. After centrifugation, the bacterial sludge was collected. The obtained bacterial sludge was resuspended in ultrapure water and transferred to BMMY medium for fermentation. 2% (V / V) methanol was added daily to induce expression for a total of 6 days.

[0053] (2) Purification of recombinant β-glucosidase After expression, the supernatant of the fermentation broth was collected by centrifugation at 4000 rpm and 25 °C for 5 min. The pH was adjusted to 6.5, and the mixture was filtered through a 0.22 µm aqueous filter membrane. 0.5 mL of Ni packing material was added, and the mixture was intermittently shaken for 1 h to adsorb the protein. The supernatant and Ni packing material were transferred together to an affinity chromatography column (Wuqiao Jinyang Filter Material Factory, JY-AC-012G2520) for purification. The lower stopper of the purification column was opened, and the flow-through was collected for later use. The column was washed 2–3 times with 0.01 M PBS buffer (pH 7.4), and then the column was plugged. 2 mL of 250 mM imidazole was added to elute the protein, and the eluent was collected. This elution was repeated 2–3 times. Finally, the Ni packing material was washed with 500 mM imidazole, and 1 mL of 20% ethanol was added to collect the Ni packing material, which was then stored at 4 °C for later use.

[0054] (3) Assay of recombinant β-glucosidase activity Using pNPG as the reaction substrate, a colorimetric method was employed for determination. The principle is as follows: β-glucosidase specifically hydrolyzes the glycosidic bond of pNPG, releasing yellow pNP. This product exhibits a characteristic absorption peak at 405 nm under alkaline conditions. By measuring the absorbance of the reaction solution at 405 nm and referring to the p-nitrophenol standard curve, the amount of pNP produced by enzyme catalysis can be calculated, thereby determining enzyme activity. The specific operational steps are as follows: 1) Add 50 µL of 5 mM pNPG substrate solution (prepared with 50 mM citrate-disodium hydrogen phosphate buffer at pH 5.5) to a 1.5 mL centrifuge tube, and place it in a 55 °C water bath for a period of time to preheat. 2) Then quickly add 1 µL of enzyme solution diluted 1:1, immediately vortex to mix, and incubate for 10 min. For the control group, add inactivated enzyme solution; the remaining steps are exactly the same. 3) After the reaction is complete, immediately add 50 µL of 1 M Na2CO3 solution to terminate the reaction and vortex to mix.

[0055] 4) Add 1.15 mL of distilled water to the terminated reaction solution to make the final volume of the system 1.25 mL, and mix thoroughly again.

[0056] 5) Using the blank group as a reference for zeroing, the absorbance value of the sample was measured at a wavelength of 405 nm.

[0057] The enzyme activity of β-glucosidase is defined as the amount of enzyme required to catalyze the hydrolysis of pNPG to produce 1 µmol of product pNP per minute, which is one unit of enzyme activity (U).

[0058] (4) Enzymatic properties of recombinant β-glucosidase 1) Optimal temperature and temperature stability of β-glucosidase The activity of β-glucosidase was determined at temperatures of 30, 40, 50, 55, 60, 70, and 80 °C to identify the optimal temperature. The enzyme solution was incubated within these temperature ranges for 2 hours, and the residual activity of β-glucosidase was measured. The relative enzyme activity was calculated as the ratio of enzyme activity at each temperature to the highest enzyme activity.

[0059] 2) Optimal pH and pH stability of β-glucosidase The activity of β-glucosidase was determined at pH values ​​of 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, and 8.5 to identify the optimal pH. The enzyme solution was incubated within these pH ranges for 2 hours, and the residual activity of β-glucosidase was measured. The relative enzyme activity was calculated as the ratio of enzyme activity at each pH value to the highest enzyme activity.

[0060] 2. Experimental Results (1) SDS-PAGE identification of β-glucosidase expression After inducing expression of the recombinant Pichia pastoris strain with methanol, the supernatant was collected by centrifugation, the crude enzyme solution was purified, and identified by SDS-PAGE gel electrophoresis. Figure 5 As shown, the expressed β-glucosidase exhibits a single, clear protein band in the 72 kDa–100 kDa range, without significant interference from other protein bands. Based on the molecular weight of the band, the molecular weight of β-glucosidase is approximately 84 kDa.

[0061] (2) Determination of the optimum temperature and temperature stability of β-glucosidase like Figure 6 It is known that the optimal temperature for β-glucosidase is 55 °C. Before reaching this optimal temperature, enzyme activity gradually increases with rising temperature because warming accelerates the enzymatic reaction rate. However, beyond the optimal temperature, further heating causes enzyme activity to decrease because high temperatures denature and inactivate the enzyme, destroying its higher-order structure. Regarding temperature stability, β-glucosidase is more stable at 40 °C. At temperatures of 60 °C and above, enzyme activity shows a significant downward trend. When the temperature reaches 70–80 °C, the relative residual enzyme activity of each enzyme is almost completely lost, indicating that this enzyme is a mesophilic enzyme with good stability under medium to low temperature conditions, making it suitable for continuous production processes such as biomass conversion and food fermentation.

[0062] (3) Determination of the optimal pH value and pH stability of β-glucosidase like Figure 7It is known that the optimal catalytic pH for β-glucosidase is 5.5. Within the pH range of 3.5 to 5.5, enzyme activity gradually increases with increasing pH. However, when the pH exceeds 5.5, enzyme activity begins to decrease. This is because increasing pH alters the dissociation state of key amino acid residues in the active site, disrupting the specific binding between the enzyme and substrate. Under alkaline conditions, β-glucosidase lacks activity, indicating that excessive alkalinity can lead to conformational changes and even inactivation of the enzyme protein. Regarding pH stability, after incubation at pH 5.5 for 2 hours, the relative residual enzyme activity remains at a high level, indicating that this pH has little impact on the spatial conformational stability of the enzyme, and the enzyme molecule can maintain its intact catalytic structure. However, when the pH exceeds 5.5, enzyme activity begins to decrease, especially under alkaline conditions, where activity is almost completely lost. This is because β-glucosidase is an acidophilic enzyme, and excessive alkalinity disrupts the hydrogen bonds and ionic bonds that maintain the conformational stability of the enzyme protein, leading to denaturation and inactivation. This indicates that the enzyme is a weakly acid-biased catalytic enzyme, exhibiting good catalytic activity and conformational stability within the pH range of 5.0 to 6.0, but exhibiting poor tolerance under extreme pH conditions.

[0063] Example 3: 1. Experimental Methods (1) Hydrolytic effect of β-glucosidase on gypenosides III and XVII To investigate the hydrolytic activity of β-glucosidase on Gyp III (CAS No.: 41753-43-9) and Gyp XVII (CAS No.: 80321-69-3), 500 µL of 1 mg / mL Gyp III reaction solution and 500 µL of 1 mg / mL Gyp XVII reaction solution were prepared, respectively. After adding 10 U / mL of enzyme solution, the reaction was carried out at 37 ℃ and pH 5.5 for 12 h. After the reaction was completed, an equal volume of chromatographic grade methanol was added to terminate the reaction, and the results were analyzed by high performance liquid chromatography.

[0064] (2) Single-factor investigation of the transformation conditions of Gynostemma pentaphyllum saponin III and Gynostemma pentaphyllum saponin XVII 1) Investigation on the conversion temperature of gypenosides III and XVII Weigh appropriate amounts of Gyp III and Gyp XVII separately, dissolve them in 50 mM citrate-disodium hydrogen phosphate buffer (pH 5.5) to prepare a 1 mg / mL reaction solution. Add 10 U / mL enzyme solution to 500 µL of the reaction solution and react at 25, 37, 50, 60, and 70 °C for 4 h each. After the reaction is complete, add an equal volume of chromatographic grade methanol to terminate the reaction. Analyze the results using high-performance liquid chromatography (HPLC) and calculate the corresponding conversion rates of Gyp III and Gyp XVII.

[0065] 2) Investigation on the pH value of the conversion of Gynostemma pentaphyllum saponin III and Gynostemma pentaphyllum saponin XVII Weigh appropriate amounts of Gyp III and Gyp XVII separately, and dissolve them in 50 mM citrate-disodium hydrogen phosphate buffer solutions with pH values ​​of 4.5, 5.0, 5.5, 6.0, 6.5, and 7.0 to prepare reaction solutions of 1 mg / mL. Add 10 U / mL enzyme solution to 500 µL of the reaction solution and react at 37 °C for 4 h. After the reaction is complete, add an equal volume of chromatographic grade methanol to terminate the reaction. Analyze the results using high-performance liquid chromatography (HPLC) and calculate the corresponding conversion rates of Gyp III and Gyp XVII.

[0066] 3) Investigation on the amount of enzyme solution added for the conversion of Gynostemma pentaphyllum saponin III and Gynostemma pentaphyllum saponin XVII Weigh appropriate amounts of Gyp III and Gyp XVII separately, dissolve them in 50 mM citrate-disodium hydrogen phosphate buffer (pH 5.5) to prepare a 1 mg / mL reaction solution. Add 500 µL of the reaction solution to enzyme solutions of 10, 20, 50, 100, 150, and 200 U / mL, respectively, and react at 37 °C for 4 h. After the reaction is complete, add an equal volume of chromatographic grade methanol to terminate the reaction. Analyze the results using high-performance liquid chromatography (HPLC) and calculate the corresponding conversion rates of Gyp III and Gyp XVII.

[0067] 4) Investigation on the transformation time of gypenosides III and XVII Weigh appropriate amounts of Gyp III and Gyp XVII separately, dissolve them in 50 mM citrate-disodium hydrogen phosphate buffer (pH 5.5) to prepare a 1 mg / mL reaction solution. Add 500 µL of the reaction solution to 50 U / mL enzyme solution and react at 37 °C for 6 h. After the reaction is complete, add an equal volume of chromatographic grade methanol to terminate the reaction. Analyze the results using high-performance liquid chromatography (HPLC) and calculate the corresponding conversion rates of Gyp III and Gyp XVII.

[0068] In the above steps, the detection method using high-performance liquid chromatography is as follows: The mobile phase consisted of water (A) and acetonitrile (C), and elution was performed using the following program: 0–5 min (32%→35% C); 5–13 min (35%→40% C); 13–23 min (40%→50% C); 23–34 min (50%→60% C); 34–37 min (60%→32% C); 37–40 min (32% C). The flow rate was 1 mL / min, the detection wavelength was 203 nm, and the injection volume was 10 µL.

[0069] 2. Experimental Results (1) Hydrolytic effect of β-glucosidase on Gynostemma pentaphyllum saponin III like Figure 8 As shown, in the reaction system using Gyp III as a substrate, after action by β-glucosidase, the characteristic peak of Gyp III almost completely disappeared, while the product peak of Gin Rd was generated. Analysis based on the saponin structure indicates that Gyp III can hydrolyze the β-1,6 glycosidic bond at the C20 position under the action of this enzyme, removing one molecule of glucose to generate Gin Rd.

[0070] (2) Hydrolytic effect of β-glucosidase on Gynostemma pentaphyllum saponin XVII like Figure 9 As shown, in the reaction system using Gyp XVII as a substrate, after action by β-glucosidase, the characteristic peak of Gyp XVII almost completely disappeared, and a product peak of Gin F2 was generated. This indicates that Gyp XVII can generate Gin F2 by hydrolyzing the β-1,6 glycosidic bond at the C20 position under the action of this enzyme. This enzyme has the catalytic property of hydrolyzing β-1,6 glycosidic bonds, and the glycosidic bond it acts on is specific, without producing other byproducts in this process.

[0071] (3) Effect of temperature on the transformation of Gynostemma pentaphyllum saponin III like Figure 10 As shown, when the reaction temperature increases from 25 °C to 37 °C, the conversion rate shows an upward trend, reaching a peak at 37 °C with a conversion rate of approximately 44.92%. This indicates that β-glucosidase is relatively stable at 37 °C during the conversion process, can adapt to long-term reactions, and exhibits high catalytic activity.

[0072] (4) Effect of pH on the conversion of Gynostemma pentaphyllum saponins III like Figure 11 As shown, when the pH of the reaction system increased from 4.5 to 5.5, the conversion rate increased from 14.39% to 45.16%, reaching its highest value at pH 5.5. This indicates that β-glucosidase exhibits higher catalytic activity in a slightly acidic environment during this conversion process. This result is consistent with the optimal pH value of β-glucosidase, indicating its good pH stability. Therefore, the optimal pH value for the conversion of Gyp III is 5.5.

[0073] (5) Effect of enzyme addition amount on the conversion of Gynostemma pentaphyllum saponin III like Figure 12As shown, the effect of enzyme concentration on the conversion efficiency of Gyp III exhibits an overall trend of rapid increase followed by stabilization. When the enzyme concentration increased from 10 U / mL to 50 U / mL, the conversion rate increased from 46.51% to 93.62%. This is because the increased number of enzyme molecules allows more catalytically active sites to bind to the substrate Gyp III, effectively improving the reaction rate and conversion efficiency. When the enzyme concentration exceeded 50 U / mL, the increase in conversion rate slowed significantly, increasing by only about 2% from 50 U / mL to 100 U / mL, until reaching 100% at 150 U / mL and remaining stable. This indicates that when the enzyme concentration exceeds 50 U / mL, the substrate gradually becomes the limiting factor for the reaction, and further increasing the enzyme concentration has limited effect on improving conversion efficiency, while also wasting enzyme resources and increasing costs. Considering both conversion efficiency and enzyme resource utilization efficiency, 50 U / mL was chosen as the enzyme concentration for subsequent experiments.

[0074] (6) Effect of reaction time on the conversion of Gynostemma pentaphyllum saponin III like Figure 13 As shown, under the conditions of reaction temperature of 37 ℃, pH value of 5.5, and enzyme solution addition of 50 U / mL, Gyp III can be completely converted to Gin Rd after 5 h of reaction, with a conversion rate of 100%.

[0075] (7) Effect of temperature on the transformation of Gynostemma pentaphyllum saponins XVII like Figure 14 As shown, the effect of temperature on the conversion efficiency of Gyp XVII is similar to that of Gyp III, exhibiting a trend of first increasing and then decreasing, with the highest conversion rate of 58.52% at 37 °C. As the reaction temperature further increases, the conversion efficiency gradually decreases, a phenomenon consistent with that of Gyp III. This is because high temperatures disrupt the spatial structure of the enzyme protein, leading to conformational changes in the catalytic active site and thus reducing catalytic efficiency. Compared to Gyp III, Gyp XVII shows higher conversion efficiencies at all temperature conditions. This suggests that β-glucosidase may have a higher catalytic affinity for Gyp XVII, and its substrate structure is more compatible with the enzyme's active site, resulting in higher overall conversion efficiency for Gyp XVII compared to Gyp III under the same temperature conditions. In conclusion, the optimal temperature for Gyp XVII conversion is also 37 °C.

[0076] (8) Effect of pH on the transformation of Gynostemma pentaphyllum saponins XVII like Figure 15As shown, the effect of pH on the conversion efficiency of Gyp XVII generally shows a trend of first increasing and then decreasing, with the optimal pH being 5.5, at which point the conversion efficiency reaches a peak of 54.54%, higher than that of Gyp III under the same pH conditions. In a slightly acidic environment, the spatial conformation of β-glucosidase and its binding compatibility with Gyp XVII gradually increases, and the dissociation state of the enzyme's active site is more conducive to the catalytic reaction, thus promoting an increase in conversion efficiency. When the pH deviates from the optimal range, the enzyme conformation changes, leading to a decrease in catalytic efficiency.

[0077] (9) Effect of enzyme addition amount on the conversion of Gynostemma pentaphyllum saponins XVII like Figure 16 As shown, the effect of enzyme concentration on the conversion efficiency of Gyp XVII exhibits an overall trend of first increasing and then leveling off, with its conversion efficiency being higher than that of Gyp III under all enzyme concentration conditions. When the enzyme concentration increased from 10 U / mL to 50 U / mL, the conversion rate increased from 53.48% to 94.61%. Further increases in enzyme concentration resulted in a gradual plateauing of the conversion rate increase, indicating that the binding of the enzyme to the substrate tended to saturate at an enzyme concentration of 50 U / mL. Therefore, an enzyme concentration of 50 U / mL was chosen for subsequent experiments.

[0078] (10) Effect of reaction time on the conversion of Gynostemma pentaphyllum saponins XVII like Figure 17 As shown, under the conditions of a reaction temperature of 37 °C, a pH of 5.5, and an enzyme addition of 50 U / mL, the conversion rate of Gyp XVII gradually increased with the progress of the reaction, reaching 100% after 4 h. Compared with Gyp III, the complete conversion time of Gyp XVII was shortened by 1 hour, indicating that β-glucosidase has a stronger catalytic preference for Gyp XVII, which may be related to its smaller steric hindrance of the glycosidic bond in its molecular structure and its tighter binding to the enzyme active site.

[0079] The embodiments of the present invention have been described in detail above, but the present invention is not limited to the described embodiments. For those skilled in the art, various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principles and spirit of the present invention, and these variations still fall within the protection scope of the present invention.

Claims

1. The application of β-glucosidase derived from Grifola frondosa in the conversion of Gynostemma pentaphyllum saponins, characterized in that, The conversion of Gynostemma pentaphyllum saponins refers to the directional conversion of Gynostemma pentaphyllum saponin Gyp III into ginsenoside Rd, and / or the directional conversion of Gynostemma pentaphyllum saponin Gyp XVII into ginsenoside F2; the cDNA sequence of the gene encoding the β-glucosidase is shown in SEQ ID No.

1.

2. The application according to claim 1, characterized in that, The method for obtaining the β-glucosidase is as follows: clone the β-glucosidase gene of Grifola frondosa, construct the Pichia pastoris pPIC9K expression vector, transform it into the Pichia pastoris GS115 expression strain, induce expression, and then isolate and purify to obtain Grifola frondosa β-glucosidase.

3. The application according to claim 2, characterized in that, The method for obtaining the β-glucosidase is as follows: the β-glucosidase gene is cloned from Grifola frondosa using the upstream and downstream primers shown in SEQ ID No. 2 and SEQ ID No.

3. Then, homologous arm primers shown in SEQ ID No. 4 and SEQ ID No. 5 are designed at both ends of the target gene to construct the Pichia pastoris pPIC9K expression vector. Subsequently, the vector is transformed into the Pichia pastoris GS115 expression strain. After methanol induction for expression, the vector is isolated and purified to obtain Grifola frondosa β-glucosidase.

4. The application according to claim 3, characterized in that, The recombinant Pichia pastoris strain was induced to express in BMMY medium, with 1–3% (v / v) methanol added daily to induce expression.

5. The application according to claim 3, characterized in that, After induction of expression, β-glucosidase was isolated and purified by Ni ion affinity chromatography.

6. A method for converting Gynostemma pentaphyllum saponins into ginsenosides, characterized in that, Gynostemma pentaphyllum saponins Gyp III or Gyp XVII are dissolved in a citrate-disodium hydrogen phosphate buffer solution to prepare a reaction solution. Then, β-glucosidase from Grifola frondosa is added to the Gyp III or Gyp XVII reaction solution. After the reaction, Gynostemma pentaphyllum saponins Gyp III can be directionally converted into ginsenoside Rd, or Gynostemma pentaphyllum saponins Gyp XVII can be directionally converted into ginsenoside F2. The cDNA sequence of the gene encoding the β-glucosidase is shown in SEQ ID No.

1.

7. The method for converting Gynostemma pentaphyllum saponins into ginsenosides according to claim 4, characterized in that, In the conversion system of Gynostemma pentaphyllum saponin Gyp III, the reaction temperature was 37 ℃, the pH was 5.5, the amount of β-glucosidase added was 50-100 U / mL, and the reaction time was 4-6 h.

8. A method for converting Gynostemma pentaphyllum saponins into ginsenosides according to claim 4, characterized in that, In the conversion system of Gynostemma pentaphyllum saponin Gyp XVII, the reaction temperature was 37 ℃, the pH was 5.5, the amount of β-glucosidase added was 50-100 U / mL, and the reaction time was 3-4 h.

9. A method for converting Gynostemma pentaphyllum saponins into ginsenosides according to claim 4, characterized in that, The concentration of GypIII or Gyp XVII reaction solution is 1–1 mg / mL.

10. A method for converting Gynostemma pentaphyllum saponins into ginsenosides according to claim 4, characterized in that, The concentration of the citrate-disodium hydrogen phosphate buffer solution is 40–70 mM.