A red carp gender-specific molecular marker, primer, kit, application in identifying red carp gender and preparation method of all-female red carp population

By screening sex-specific molecular markers and primers for red crucian carp using resequencing technology, and combining PCR identification and high-temperature regulation, the problem of sex identification of red crucian carp was solved, and the stable construction of an all-female red crucian carp population and the creation of new varieties were achieved, thus improving the efficiency of fish breeding and resource utilization.

CN122189171APending Publication Date: 2026-06-12HUNAN NORMAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
HUNAN NORMAL UNIVERSITY
Filing Date
2026-05-07
Publication Date
2026-06-12

AI Technical Summary

Technical Problem

Currently, there is a lack of stable and effective molecular markers for the sex of red crucian carp, making it difficult to efficiently identify the genetic sex of red crucian carp in the early stages. Furthermore, external environmental factors such as temperature have a significant impact on sex determination, and there is a lack of corresponding temperature-induced control schemes.

Method used

The genomic data of male and female red crucian carp were obtained by resequencing technology, and sex-specific molecular markers and primers were screened out. The sex of the red crucian carp was identified by PCR technology. Pseudo-male fish were screened by high temperature environment regulation, and an all-female red crucian carp population was prepared. New varieties were created by hybridizing all-female red crucian carp with other fish.

Benefits of technology

This method enables rapid and accurate sex identification of red crucian carp, reduces the use of hormones in the breeding stage, shortens the breeding period, and provides a stable method for constructing an all-female red crucian carp population, thus providing valuable germplasm resources for fish hybridization breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122189171A_ABST
    Figure CN122189171A_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of molecular marker, in particular to a red crucian gender-specific molecular marker, primer, kit, application in identifying the gender of red crucian and preparation method of all-female red crucian population. The nucleotide sequence of the molecular marker is shown in SEQ ID NO:1 and / or SEQ ID NO:2; the sample with the sequence of SEQ ID NO:1 and / or SEQ ID NO:2 is identified as male fish, otherwise as female fish. The present application provides a red crucian gender-specific molecular marker, primer and kit, which can quickly and effectively identify the genetic gender of red crucian by using these gender-specific primers based on PCR technology, combine with phenotype to distinguish pseudo-male and ordinary female individuals, and further confirm the stability and effectiveness of the gender molecular marker by using three red crucian populations and more than 300 samples of Hunan Normal University for genotyping analysis of two molecular markers.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular marker technology, and in particular to a sex-specific molecular marker, primer, reagent kit for red crucian carp, its application in identifying the sex of red crucian carp, and a method for preparing an all-female red crucian carp population. Background Technology

[0002] Red crucian carp (Carassius auratus) belongs to the Cyprinidae family of the order Cypriniformes and is mainly distributed in the Yangtze River basin of China. It is characterized by its omnivorous diet and strong adaptability. Red crucian carp has both edible and ornamental economic value. As an ornamental fish, it is highly sought after due to its vibrant colors and unique phenotype. In edible crucian carp farming, females typically grow faster and larger than males. Therefore, developing all-female breeding technology has significant commercial value and industrial demand.

[0003] Sex molecular markers are specific DNA sequences anchored to differences in the male and female genomes and are usually closely linked to genetic sex. They allow for efficient and rapid identification of genetic sex in fish at an early stage. With the rapid development of high-throughput sequencing technology, whole-genome sequencing is becoming increasingly common in fish, as seen in the development of sex molecular markers for species such as blunt snout bream, largemouth bass, and mandarin fish. However, female red crucian carp can transform into pseudo-males during early development through high-temperature induction, and currently, no stable and effective sex molecular markers have been developed for this species. Sex molecular markers provide an efficient technical approach for large-scale production of all-male or all-female populations. This is not only a transformative tool in modern aquaculture breeding but also lays a solid foundation for early identification of genetic sex in fish.

[0004] The developed sex molecular markers provide a solid guarantee for the preparation of monosex populations in fish sex-controlled breeding. Fish sex-controlled breeding is an extremely important core technology in modern aquaculture, its importance reflected in multiple aspects such as economic benefits, food safety, and germplasm resource management. Using fish sex-controlled breeding technology to prepare monosex populations can effectively avoid fish self-pollination, providing greater convenience for fish hybridization breeding. In addition to genetic factors, the sex determination of red crucian carp is also greatly influenced by the external environment, especially temperature. During early development, temperature control can induce sex reversal, and by combining sex molecular markers to screen for pseudo-males and mating them with ordinary females, an all-female population can be prepared. However, currently, there is a lack of sex molecular markers for red crucian carp in the field, and therefore, a corresponding temperature-induced control scheme is also lacking. Summary of the Invention

[0005] This invention provides a method for constructing an all-female red crucian carp population based on sex molecular markers. The invention utilizes resequencing technology to obtain the original genome sequencing data of male and female red crucian carp, extracting sex-specific molecular markers and primers for screening all-female red crucian carp. This aims to reduce the use of hormones in fish breeding and shorten the breeding period, while finding a reliable and stable method for constructing an all-female red crucian carp population. Furthermore, this all-female population can be used to create new varieties through hybridization with other fish, providing valuable germplasm resources for fish hybridization breeding research.

[0006] To achieve the above objectives, the present invention provides a sex-specific molecular marker for red crucian carp, wherein the nucleotide sequence of the molecular marker is shown in SEQ ID NO: 1 and / or SEQ ID NO: 2; samples with the sequence SEQ ID NO: 1 and / or SEQ ID NO: 2 are identified as male fish, otherwise as female fish.

[0007] Under the same technical concept, the present invention also provides a sex-specific molecular marker primer for red crucian carp, the primer comprising primer pair 1 and primer pair 2, the nucleotide sequence of primer pair 1 being shown in SEQ ID NO: 3 and SEQ ID NO: 4, and the nucleotide sequence of primer pair 2 being shown in SEQ ID NO: 5 and SEQ ID NO: 6.

[0008] Under the same technical concept, the present invention also provides a red crucian carp sex-specific molecular marker kit, the kit comprising the red crucian carp sex-specific molecular marker primers.

[0009] Under the same technical concept, the present invention also provides an application of a sex-specific molecular marker for red crucian carp in identifying the sex of red crucian carp. The application involves using the aforementioned sex-specific molecular marker primers to amplify the red crucian carp to be identified. If the amplified nucleotide sequence is as shown in SEQ ID NO: 1 and / or SEQ ID NO: 2, the fish is identified as male; otherwise, it is female.

[0010] Preferably, the amplified nucleotide sequence, such as the sequence shown in SEQ ID NO: 1 and / or SEQ ID NO: 2, is detected by electrophoresis of the PCR amplified band. When the band pattern is consistent with the nucleotide sequence shown in SEQ ID NO: 1 and / or SEQ ID NO: 2, the fish is identified as male; otherwise, it is female.

[0011] Under the same technical concept, the present invention also provides a method for preparing an all-female red crucian carp population, comprising the following steps: S1. Select female and male red crucian carp in the breeding period as parents, prepare red crucian carp fry by dry artificial insemination, hatch and raise them until sexual maturity; S2. Using the specific molecular marker as described in claim 1 or the specific molecular marker primer as described in claim 2, screen out pseudo-male and female fish from the population cultured to sexual maturity in S1; the pseudo-male fish are phenotypically male but genetically female; the ordinary female fish are both phenotypically and genetically female. S3. Pair the pseudo-male fish with the female fish to prepare an all-female red crucian carp population.

[0012] Preferably, the female and male red crucian carp in the breeding period mentioned in step S1 are: from March to May each year, at a water temperature of 18-22℃, female red crucian carp that are 1-2 years old, slightly larger in size and with a soft, swollen abdomen, and male red crucian carp that can squeeze out milky white semen are selected as parents; the breeding conditions for raising them to sexual maturity are to raise them in a high-temperature breeding environment of 27-29℃ for 2-3 months.

[0013] Preferably, in step S2, pseudo-male and female fish are selected from the sexually mature population cultured in S1; the pseudo-male fish are phenotypically male but genetically female; the ordinary female fish are both phenotypically and genetically female. a. Phenotypic sex of red crucian carp can be determined by differences in cloaca, degree of abdominal distension, and semen. b. Cut a small amount of tail fin strips from each red crucian carp to be tested and store them in a 1.5 ml EP tube containing 95% ethanol. Then, use an animal genomic DNA extraction kit to extract whole genomic DNA. c. Using the specific molecular marker primers as described in claim 2, perform PCR amplification with the DNA of red crucian carp as a template; d. The amplified PCR products were detected by 1.5% agarose gel electrophoresis: if the amplification product of primer pair 1 showed a clear band of 1024 bp or / and the amplification product of primer pair 2 showed a clear band of 1196 bp, then the fish was genotyped male; if no target band or other weak mixed bands were observed during electrophoresis, then the fish was genotyped female. e. Identify pseudo-males and females by combining phenotypic and genotypic sex: pseudo-males are phenotyped as male but genotyped as female; females are phenotyped as female and genotyped as female.

[0014] Preferably, the method for preparing the all-female red crucian carp population further includes: Using the specific molecular markers or the specific molecular marker primers, individuals with both female phenotype and genotype were screened from an all-female red crucian carp population, and then crossbred with male improved tetraploid crucian carp to prepare Xiangyun Crucian Carp No. 2.

[0015] The above-described solution of the present invention has the following beneficial effects: (1) This invention provides a sex-specific molecular marker, primers and kit for red crucian carp. Using these sex-specific primers, the genetic sex of red crucian carp can be quickly and effectively identified based on PCR technology. Combined with phenotype, pseudo-male and ordinary female individuals can be distinguished. Genotyping analysis of the two molecular markers was performed on three red crucian carp populations and more than 300 samples at Hunan Normal University, which further confirmed the stability and effectiveness of the sex molecular marker.

[0016] (2) The sex molecular markers developed in this invention are combined with the important influence of high temperature environment on sex reversal of red crucian carp. When preparing an all-female red crucian carp population, the occurrence of sex reversal can be greatly increased by controlling the water temperature. Then, combined with the sex molecular markers, pseudo-male fish (XX) and ordinary female fish (XX) can be screened from the red crucian carp after high temperature culture treatment. These two types of fish are mated to prepare an all-female (XX) red crucian carp population. Then, the all-female red crucian carp individuals are used as the maternal parent to prepare Xiangyun Crucian Carp No. 2. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 This is a genotyping band diagram of the red crucian carp in Example 1. Detailed Implementation

[0019] To make the technical problems, solutions, and advantages of this invention clearer, a detailed description will be provided below with reference to the accompanying drawings and specific embodiments. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0020] In the description of this invention, it should be noted that the terms "center," "upper," "lower," "left," "right," "vertical," "horizontal," "inner," and "outer," etc., indicate the orientation or positional relationship based on the orientation or positional relationship shown in the accompanying drawings. They are used only for the convenience of describing the invention and for simplifying the description, and do not indicate or imply that the device or element referred to must have a specific orientation, or be constructed and operated in a specific orientation. Therefore, they should not be construed as limitations on the invention. Furthermore, the terms "first," "second," and "third" are used for descriptive purposes only and should not be construed as indicating or implying relative importance.

[0021] In the description of this invention, it should be noted that, unless otherwise explicitly specified and limited, the terms "installation," "connection," and "linking" should be interpreted broadly. For example, they can refer to a locking connection, a detachable connection, or an integral connection; they can refer to a mechanical connection or an electrical connection; they can refer to a direct connection or an indirect connection through an intermediate medium; and they can refer to the internal connection of two components. Those skilled in the art can understand the specific meaning of the above terms in this invention based on the specific circumstances.

[0022] Furthermore, the technical features involved in the different embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0023] Example 1: Molecular marker screening: This embodiment utilizes resequencing technology to obtain raw sequencing data of the male and female red crucian carp genomes. The raw sequencing data was aligned to the male red crucian carp reference genome (https: / / www.ncbi.nlm.nih.gov / datasets / genome / GCA_013115835.1 / ) using bwa software. The compared data was then sorted and duplicates from PCR amplification were removed using picard software. Next, poolsex software was used to calculate and statistically analyze sex-specific SNPs and screen for genomic regions or fragments with significant differences in sequencing depth between male and female fish. Finally, potentially male-specific DNA fragments (i.e., DNA fragments in the male genome that only aligned to the male resequencing data and not to the female resequencing data) were identified. Sex-specific primers were designed based on these potentially male-specific DNA fragments. Genotyping analysis of the designed primers was performed on male and female red crucian carp to screen for sex-specific primers that were completely associated with the phenotype. The results were then validated in a large population to construct sex-specific molecular markers.

[0024] The primer pair is: Primer pair 1 (SEQ ID NO: 3) Forward primer: TCCTGCAGACCTTTCCACTGAG (SEQ ID NO: 4) Reverse primer: GGTGCTGCTCCAGATAACCTGG Primer pair 2 (SEQ ID NO: 5) Forward primer: GCTGACAGATAGCAGTTGAGTC (SEQ ID NO: 6) Reverse primer: CTCTCATCCATACATCCAGGTTG The molecular marker fragments amplified by primer pair 1 and primer pair 2 are as follows: Male-specific DNA molecular marker sequence for red crucian carp (SEQ ID NO: 1) DNA sequence length: 2171 bp Male-specific DNA molecular marker sequence for red crucian carp (SEQ ID NO: 2) DNA sequence length: 2037 bp The above primers and sequences were used to perform genotyping verification on red crucian carp. The specific steps are as follows: a. On November 18, 2021, 18 red crucian carp were selected, and their phenotypic sex was identified by differences in cloaca, degree of abdominal swelling, and semen. The red carp listed above are numbered as follows: 1. Male; 2. Female; 3. Male; 4. Male; 5. Female; 6. Female; 7. Male; 8. Female; 9. Female; 10. Male; 11. Female; 12. Male; 13. Female; 14. Male; 15. Male; 16. Male; 17. Male; 18. Male. b. Cut a small amount of tail fin rays from each red crucian carp to be tested and store them in a 1.5 ml EP tube containing 95% ethanol. Then, use an animal genomic DNA extraction kit to extract whole genomic DNA and construct DNA BOX1 for different red crucian carp populations. c. Using the developed sex-specific primers for red crucian carp, PCR amplification was performed using red crucian carp DNA as a template; the amplification conditions were as follows: Pre-denaturation at 94℃ for 5 min; denaturation at 94℃ for 35 s, annealing at 67℃ for 35 s, extension at 72℃ for 35 s, one set of 30 cycles, final extension at 72℃ for 5 min.

[0025] d. The amplified PCR products were detected by 1.5% agarose gel electrophoresis: if a 1024 bp band appeared in the electrophoresis of primer 1 amplification product or / and a 1196 bp band appeared in the electrophoresis of primer 2 amplification product, then the fish is a genotype male; if no target band or other weak mixed bands appeared in the electrophoresis, then the fish is a genotype female. Based on the electrophoresis band results as follows: Figure 1 As shown, bands 1, 3, 4, 7, 10, 12, 14, 15, 16, 17, and 18 of the male fish appeared in band M1, which is consistent with the actual results. The electrophoretic banding diagram for typing verification in the embodiment is as follows: Figure 1 As shown.

[0026] Example 2: A method for preparing an all-female red crucian carp population includes the following steps: 1. From April to June each year, when the water temperature is 18-22℃, select 1-2 year old female red crucian carp with slightly larger body size and soft, swollen abdomens, and male red crucian carp capable of extruding milky white semen as parent fish. Red crucian carp fry are prepared by dry artificial insemination. The hatched fry are raised in a high-temperature culture environment of 28℃ for 3 months (the high temperature of the red crucian carp increases sex reversal), and then transferred to ponds for further rearing until sexual maturity.

[0027] 2. Using sex molecular markers, pseudo-male (XX) and normal female (XX) fish were screened from a group of sexually mature red crucian carp cultured under high temperature (28℃) treatment. The specific steps are as follows: a. A total of 24 red crucian carp were collected from the collection site and numbered sequentially into three groups: red crucian carp numbered 1-10 were wild-type RCC group, red crucian carp numbered 11-20 were self-pollination enhancement group, and red crucian carp numbered 21-24 were wild-type RCC group; the phenotypic sex of the red crucian carp was identified by differences in cloaca, degree of abdominal swelling, and semen. b. Cut a small amount of tail fin rays from each red crucian carp to be tested and store them in a 1.5 ml EP tube containing 95% ethanol. Then, use an animal genomic DNA extraction kit to extract whole genomic DNA. c. Using the four pairs of sex-specific primers developed for red crucian carp, the three groups of red crucian carp DNA templates to be tested were amplified by PCR; d. The amplified PCR products were detected by 1.5% agarose gel electrophoresis: if a 1024 bp band appeared in the electrophoresis of primer 1 amplification product or / and a 1196 bp band appeared in the electrophoresis of primer 2 amplification product, then the fish is a genotype male; if no target band or other weak mixed bands appeared in the electrophoresis, then the fish is a genotype female. e. Identify pseudo-males and common females by combining phenotypic and genotypic sex: pseudo-males are phenotyped as male but genotyped as female; common females are phenotyped as female and genotyped as female. f. Pair pseudo-males (XX) with ordinary females (XX) to prepare an all-female (XX) red crucian carp population.

[0028] 3. All female (XX) red crucian carp were raised to sexual maturity. During the breeding season, the phenotypic sex of the adult fish was determined by the difference in vent opening, the degree of abdominal swelling and softness, and the presence or absence of semen. Their genotypic sex was detected using molecular markers.

[0029] Example 3: A method for preparing the Xiangyun Crucian Carp No. 2 population includes the following steps: using sex molecular markers, selecting red crucian carp individuals (♀) with both phenotypic and genotypic sex as female from an all-female red crucian carp population, and then hybridizing them with improved tetraploid crucian carp (♂) to prepare Xiangyun Crucian Carp No. 2.

Claims

1. A sex-specific molecular marker for red crucian carp, characterized in that, The molecular marker nucleotide sequence is shown in SEQ ID NO: 1 and / or SEQ ID NO: 2; samples with the sequence SEQ ID NO: 1 and / or SEQ ID NO: 2 are identified as male fish, otherwise as female fish.

2. A sex-specific molecular marker primer for red crucian carp, characterized in that, The primers comprise primer pair 1 and primer pair 2, the nucleotide sequences of primer pair 1 are shown in SEQ ID NO: 3 and SEQ ID NO: 4, and the nucleotide sequences of primer pair 2 are shown in SEQ ID NO: 5 and SEQ ID NO:

6.

3. A sex-specific molecular marker kit for red crucian carp, characterized in that, The kit contains the sex-specific molecular marker primers for red crucian carp as described in claim 2.

4. The application of a sex-specific molecular marker for red crucian carp in identifying the sex of red crucian carp, characterized in that, The application involves using the red crucian carp sex-specific molecular marker primers as described in claim 3 to amplify the red crucian carp to be identified. If the amplified nucleotide sequence is as shown in SEQ ID NO: 1 and / or SEQ ID NO: 2, it is identified as a male fish; otherwise, it is a female fish.

5. The application as described in claim 4, characterized in that, The amplified nucleotide sequence, as shown in SEQ ID NO: 1 and / or SEQ ID NO: 2, is detected by electrophoresis of the PCR amplified band. When the band pattern is consistent with the nucleotide sequence shown in SEQ ID NO: 1 and / or SEQ ID NO: 2, the fish is identified as male; otherwise, it is female.

6. A method for preparing an all-female red crucian carp population, characterized in that, Includes the following steps: S1. Select female and male red crucian carp in the breeding period as parents, prepare red crucian carp fry by dry artificial insemination, hatch and raise them until sexual maturity; S2. Using the specific molecular marker as described in claim 1 or the specific molecular marker primer as described in claim 2, screen out pseudo-male and female fish from the population cultured to sexual maturity in S1; the pseudo-male fish are phenotypically male but genetically female; the ordinary female fish are both phenotypically and genetically female. S3. Pair the pseudo-male fish with the female fish to prepare an all-female red crucian carp population.

7. The preparation method according to claim 6, characterized in that, The female and male red crucian carp mentioned in step S1 during the breeding season are specifically: From March to May each year, at a water temperature of 18-22℃, select 1-2 year old female red crucian carp with slightly larger body size and soft, swollen abdomen, and male red crucian carp capable of squeezing out milky white semen as parent animals; the cultivation conditions for raising them to sexual maturity are to raise them in a high-temperature breeding environment of 27-29℃ for 2-3 months.

8. The preparation method according to claim 6, characterized in that, In step S2, pseudo-male and female fish are selected from the sexually mature population cultured in S1. The pseudo-male fish are phenotypically male but genetically female. The ordinary female fish are both phenotypically and genetically female. a. Phenotypic sex of red crucian carp can be determined by differences in cloaca, degree of abdominal distension, and semen. b. Cut a small amount of tail fin rays from each red crucian carp to be tested and store them in a 1.5 ml EP tube containing 95% ethanol. Then, use an animal genomic DNA extraction kit to extract whole genomic DNA. c. Using the specific molecular marker primers as described in claim 2, perform PCR amplification with the DNA of red crucian carp as a template; d. The amplified PCR products were detected by 1.5% agarose gel electrophoresis: if the amplification product of primer pair 1 showed a clear band of 1024 bp or / and the amplification product of primer pair 2 showed a clear band of 1196 bp, then the fish was genotyped male; if no target band or other weak mixed bands were observed during electrophoresis, then the fish was genotyped female. e. Identify pseudo-males and females by combining phenotypic and genotypic sex: pseudo-males are phenotyped as male but genotyped as female; females are phenotyped as female and genotyped as female.

9. The preparation method according to claim 6, characterized in that, The method for preparing the all-female red crucian carp population also includes: Using the specific molecular markers as described in claim 1 or the specific molecular marker primers as described in claim 2, individual red crucian carp individuals with both phenotype and genotype female were screened from an all-female red crucian carp population, and then crossbred with male improved tetraploid crucian carp to prepare Xiangyun Crucian Carp No. 2.