Application and breeding method of sultr1;2 gene in selenium and cadmium coexisting soil for enhancing selenium enrichment and reducing cadmium in crops
By increasing the expression level of the Sultr1;2 gene and using N-ε-acetyl-L-lysine or Streptomyces, the absorption of selenium and cadmium by plant roots was regulated, solving the problem of selenium enrichment and cadmium reduction in crops in selenium-enriched soils with associated cadmium, and realizing the breeding of new crop varieties with high selenium and low cadmium and safe production.
Patent Information
- Application Number
- CN202610200524.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-11
- Publication Date
- 2026-06-16
AI Technical Summary
Existing technologies cannot simultaneously achieve selenium enrichment and cadmium reduction in crops in selenium-rich soils with associated cadmium. Traditional methods are costly or have unstable effects, and genetic engineering to improve crops often only considers a single objective and cannot achieve both simultaneously.
By increasing the expression of the Sultr1;2 gene in target crops and combining it with N-ε-acetyl-L-lysine or Streptomyces, the differential absorption of selenium and cadmium by plant roots is regulated. The in-situ mineralization of microorganisms is used to change the chemical forms of selenium and cadmium in the soil, thereby promoting the activation of selenium and the passivation of cadmium.
Significantly increasing the selenium content of crops and reducing cadmium accumulation, cultivating new crop varieties with high selenium and low cadmium, and realizing safe utilization and safe production of agricultural products in selenium-rich soils with cadmium coexistence.
Smart Images

Figure CN122214360A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular biology breeding technology, and in particular to the application and breeding method of the Sultr1;2 gene in selenium-enriched and cadmium-reduced crops in selenium-cadmium-associated soil. Background Technology
[0002] Selenium is one of the essential trace elements for the human body, playing an irreplaceable physiological role in antioxidation, immune regulation, maintaining thyroid function, and ensuring reproductive health. Plant-based selenium is the primary source of selenium for the human body; therefore, fortifying crops with selenium to enhance selenium absorption and accumulation is the preferred strategy for addressing insufficient selenium intake and improving selenium deficiency.
[0003] The selenium content in plants mainly depends on the available selenium content in the soil. However, naturally selenium-rich farmland soils often contain high concentrations of the heavy metal cadmium. Studies show a strong positive correlation between soil selenium and cadmium content, with over 76% of farmland soils exceeding cadmium standards. This results in crops that, while rich in selenium, often contain excessive cadmium, failing to meet food safety standards. Therefore, how to achieve selenium enrichment in crops while reducing cadmium accumulation in selenium-rich soils with accompanying cadmium is a pressing common challenge that needs to be addressed.
[0004] Existing selenium-enriched cadmium-reducing technologies generally have limitations. While traditional physicochemical remediation methods can reduce cadmium activity through passivating agents, they often simultaneously reduce selenium availability and are costly, making large-scale implementation difficult. Applying functional microbial agents to activate selenium or passivate cadmium in the soil, such as rhizobia, pseudomonas, and Bacillus, is also a commonly used biofortification measure. However, in actual agricultural production, direct application of exogenous agents faces the problem of "difficult colonization." Due to the lack of specific recruitment and nutritional support from host plants, exogenous functional bacteria struggle to form a dominant community in the rhizosphere soil, leading to unstable field results.
[0005] With the development of molecular biology, biofortification technologies based on genetic engineering have broad prospects. Genetic engineering utilizes methods from molecular biology and genetics to edit and regulate plant genes, such as knocking out or replacing key genes affecting selenium and cadmium absorption and transport, or inserting genes related to selenium and cadmium metabolism. This enhances the absorption, utilization, and transformation of selenium or reduces the absorption, utilization, and transformation of cadmium, thereby strengthening the plant's ability to enrich selenium and reduce cadmium. Compared with traditional methods, genetically engineered selenium-enriched crops can increase plant selenium content without additional chemical selenium sources or chemical passivators, offering lower cost-effectiveness, greater environmental friendliness, and avoiding the colonization challenges of microbial agents. However, current genetically engineered crops often only consider one goal—selenium enrichment or cadmium reduction—failing to achieve both simultaneously. Therefore, developing novel functional genes and elucidating their regulatory mechanisms, as well as establishing transgenic genetic breeding technologies, are of great significance for the safe utilization of farmland in cadmium-co-existing selenium-enriched soils, reducing the risk of cadmium accumulation in crops, and improving selenium bioavailability. Summary of the Invention
[0006] To address the aforementioned technical problems in the prior art, this invention has discovered the gene Sultr1;2, which is related to selenium and cadmium conversion in tomatoes. This gene has a positive regulatory effect on improving the selenium-enriched and cadmium-reducing performance of tomatoes, providing excellent gene resources and new effective approaches for improving the selenium-enriched and cadmium-reducing ability of crops and cultivating new crop varieties with high selenium and low cadmium content.
[0007] This invention is specifically achieved through the following technical solutions:
[0008] The first aspect of this invention provides a method for breeding selenium-enriched and cadmium-reducing crops in selenium-cadmium-associated soils, comprising the following steps:
[0009] The expression level of the Sultr1;2 gene was increased in the target crop, and crop plants with increased expression levels of the Sultr1;2 gene were cultured; wherein the coding region sequence of the Sultr1;2 gene is shown in SEQ ID NO.1;
[0010] Alternatively, N-ε-acetyl-L-lysine can be applied to the root soil of the target crop;
[0011] Alternatively, apply a mixture of N-ε-acetyl-L-lysine and Streptomyces to the root soil of the target crop.
[0012] Furthermore, the reagent used to increase the expression level of the Sultr1;2 gene is selected from one of the following (A)-(C):
[0013] (A) A nucleic acid molecule containing the coding region of the Sultr1;2 gene;
[0014] (B) A recombinant overexpression vector containing the nucleic acid molecules described in (A);
[0015] (C) Recombinant microorganisms containing the recombinant overexpression vector described in (B).
[0016] Furthermore, the expression vector is pMDC43, and the microorganism is Agrobacterium.
[0017] Furthermore, the method for increasing the expression level of the Sultr1;2 gene includes: constructing a Sultr1;2 gene overexpression vector, the Sultr1;2 gene overexpression vector containing the coding region of the Sultr1;2 gene; transforming the Sultr1;2 gene overexpression vector into wild-type crops, and culturing to obtain crop plants with increased Sultr1;2 gene expression levels.
[0018] Furthermore, the method for constructing the Sultr1;2 gene overexpression vector includes: using tomato genomic cDNA as a template, performing PCR amplification using primer pairs shown in SEQ ID NO.2-3 to obtain the coding region of the Sultr1;2 gene; and ligating the coding region of the Sultr1;2 gene into the expression vector pMDC43 using gateway gene cloning technology to construct the Sultr1;2 gene overexpression vector.
[0019] Furthermore, the process of ligating the full-length coding region to the expression vector pMDC83-GFP using gateway gene cloning technology includes the following steps: ligating the coding region of the amplified Sultr1;2 gene to the pDONR207 vector via a BP recombination reaction, and then ligating the Sultr1;2 gene on the pDONR207 vector to the expression vector pMDC43 via an LR recombination reaction to construct the Sultr1;2 gene overexpression vector.
[0020] Furthermore, the application concentration of N-ε-acetyl-L-lysine is 60-70 mg / kg soil, and the application concentration of Streptomyces is 0.1-10 × 10⁻⁶ mg / kg soil. 7 CFU / kg soil. Furthermore, the application concentration of N-ε-acetyl-L-lysine was 62.67 mg / kg soil, and the application concentration of Streptomyces was 1 × 10⁻⁶. 7 CFU / kg soil.
[0021] Furthermore, the crop mentioned is tomato.
[0022] Furthermore, the selenium content in the selenium-cadmium associated soil is 2-6 mg / kg, and the cadmium content is 1-5 mg / kg. Even further, the selenium content in the selenium-cadmium associated soil is 4.12 mg / kg, and the cadmium content is 2.51 mg / kg.
[0023] The second aspect of this invention provides the application of the Sullr1;2 gene in enhancing selenium enrichment and reducing cadmium in crops in selenium-cadmium-associated soils, wherein the coding region sequence of the Sullr1;2 gene is shown in SEQ ID NO.1.
[0024] The third aspect of this invention provides the application of N-ε-acetyl-L-lysine in enhancing selenium enrichment and reducing cadmium in crops in selenium-cadmium-associated soils.
[0025] The fourth aspect of this invention provides the application of N-ε-acetyl-L-lysine-binding Streptomyces in selenium- and cadmium-enriched crops in soils with selenium and cadmium coexistence.
[0026] The advantages and positive effects of this invention are as follows:
[0027] 1. This invention provides excellent genetic resources and a new and effective approach for improving the ability of crops to reduce selenium and cadmium content and for cultivating new crop varieties with high selenium and low cadmium content. By enhancing the expression level of the Sultr1;2 gene through transgenic genetic breeding, it is beneficial to specifically promote the secretion of N-ε-acetyl-L-lysine, and to directionally recruit rhizosphere functional microorganisms. By utilizing the in-situ mineralization of microorganisms, the chemical forms of selenium and cadmium in the soil are changed, thereby regulating the differential absorption of selenium and cadmium by plant roots, significantly reducing cadmium accumulation in crops and increasing selenium accumulation. It has broad application prospects and good social benefits in the safe utilization of farmland in selenium-enriched soils with cadmium coexistence and the cultivation of selenium-enriched and cadmium-reducing crops.
[0028] 2. This invention, by adding the molecular signal N-ε-acetyl-L-lysine or combining N-ε-acetyl-L-lysine with the functional microorganism Streptomyces, can significantly increase the selenium content of non-GMO crops and reduce cadmium accumulation while increasing crop yield. This has important practical significance in the safe production of selenium-enriched agricultural products in selenium-cadmium-coated farmland. Attached Figure Description
[0029] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the description of the embodiments are briefly introduced below.
[0030] Figure 1 Figure A shows the verification results of the expression level of the Sultr1;2 gene in transgenic tomatoes overexpressing the Sultr1;2 gene in the embodiments of the present invention. Figure A shows the relative transcriptional abundance of the Sultr1;2 gene in the roots of overexpressing lines and wild-type tomatoes. Figures B and C are subcellular localization microscopic images of the Sultr1;2-GFP fusion protein in the root tips of overexpressing lines and wild-type tomatoes, respectively.
[0031] Figure 2Figures show the selenium and cadmium content in various tissues of transgenic tomatoes and wild-type tomatoes overexpressing the Sultr1;2 gene, as well as in the soil, in embodiments of the present invention. Figures AD show the selenium content in roots, stems, leaves, and fruits, respectively; Figures EH show the cadmium content in roots, stems, leaves, and fruits, respectively; Figure IJ shows the available selenium and available cadmium content in the rhizosphere soil, respectively; and Figure K shows the content of different forms of selenium and cadmium in the rhizosphere soil.
[0032] Figure 3 Figure A is a functional diagram of the rhizosphere microbiome remodeled by the Sultr1;2 gene in an embodiment of the present invention. Figure B is a hierarchical clustering analysis diagram based on Bray-Curtis difference, Figure C is a Shannon diversity index diagram, and Figure D is a relative abundance diagram of the top 10 bacteria.
[0033] Figure 4 Figure A shows the metabolomics analysis results of root exudates from hydroponically grown transgenic tomatoes and wild-type tomatoes that overexpress the Sultr1;2 gene, collected in this embodiment of the invention. Figure A is the principal component analysis diagram, Figure B is the KEGG pathway enrichment analysis diagram of differential metabolites, and Figure C is the volcano diagram of differential metabolites.
[0034] Figure 5 The following figures illustrate the effects of root exudates from transgenic tomatoes and wild-type tomatoes overexpressing the Sultr1;2 gene on soil microbial communities in this embodiment of the invention. Figure A shows the Shannon diversity index, Figure B shows the principal coordinate analysis based on Bray-Curtis distance, Figure C shows the effect size results of linear discriminant analysis, and Figure D shows the multi-factor co-occurrence network.
[0035] Figure 6 Figure A shows the chemotactic results of Streptomyces S1 and S2 on N-ε-acetyl-L-lysine in the embodiments of the present invention. Figure B shows the migration diagram on a semi-solid agar plate, Figure C shows the capillary migration diagram and a representative colony plate diagram, and Figure D shows the quantitative colony count of Streptomyces S1 and S2 on different concentrations of N-ε-acetyl-L-lysine, respectively.
[0036] Figure 7 Figure A shows the effect of N-ε-acetyl-L-lysine on the formation of biofilms of Streptomyces S1 and S2 in the embodiments of the present invention. Figure A is a crystal violet staining image of the biofilm in the microplate, and Figures B and C are statistical results of the biofilm formation of Streptomyces S1 and S2, respectively.
[0037] Figure 8The following are images showing the effect of rhizosphere functional microorganisms on selenium enrichment and cadmium reduction in culture systems containing sodium selenite or sodium selenite and cadmium chloride in the embodiments of the present invention. In these images, Figures A and B show the selenium reduction rate and cadmium adsorption rate in culture systems containing sodium selenite or sodium selenite and cadmium chloride, respectively. Figures C and F show the Cd, Se, Cd+Se and superimposed 3d spectra on the surface of bacterial cell S2, respectively.
[0038] Figure 9 The figures shown are phenotypic diagrams of selenium biofortification and cadmium remediation in tomatoes mediated by N-ε-acetyl-L-lysine in this invention. Figure A shows the dry biomass of wild-type tomatoes grown in selenium- and cadmium-contaminated soil under different treatments. Figures B and C show the results of bioavailability determination of selenium and cadmium in rhizosphere soil at harvest. Figures D and G show the accumulation of selenium and cadmium in plant stems and roots, respectively. Detailed Implementation
[0039] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. The embodiments described herein are for illustrative purposes only and are not intended to limit the invention.
[0040] Based on the information contained herein, various changes to the precise description of the invention can be readily made by those skilled in the art without departing from the spirit and scope of the appended claims. It should be understood that the scope of the invention is not limited to the defined processes, properties, or components, as these embodiments and other descriptions are merely illustrative of specific aspects of the invention. In fact, various modifications to embodiments of the invention that will be apparent to those skilled in the art or related fields are covered within the scope of the appended claims.
[0041] To better understand the invention and not to limit its scope, all figures and other numerical values used in this invention to indicate amounts, percentages, or other quantities should, in all cases, be understood to be modified by the word "approximately." Therefore, unless specifically stated otherwise, the numerical parameters listed in the specification and appended claims are approximate values and may vary depending on the desired properties being sought. Each numerical parameter should at least be considered as obtained based on reported significant figures and through conventional rounding methods.
[0042] Additionally, it should be noted that, unless otherwise defined, the scientific and technical terms used in the context of this invention should have the meanings commonly understood by those skilled in the art.
[0043] The terms “including,” “contains,” “includes,” “has,” and similar words are non-restrictive and can include other steps and other components that do not affect the result.
[0044] The term “and / or” should be considered as a specific disclosure of each of the two specified features or components, with or without the other. For example, “A and / or B” is considered to include (i) A, (ii) B, and (iii) A and B.
[0045] To make the objectives and features of this invention more apparent and understandable, the technical principles and specific implementation methods of this invention will be described in detail below.
[0046] In this invention, the sulfate transporter gene Sultr1;2 was cloned from tomato, an overexpression vector was constructed, and the vector was transformed into Micro-Tom wild-type tomato. Transgenic lines and wild-type tomato seedlings were planted in selenium-cadmium contaminated soil (total selenium 4.12 mg / kg, total cadmium 2.51 mg / kg). Their growth and development phenotypes were evaluated. It was found that in selenium-cadmium contaminated soil, compared to wild-type plants, transgenic tomatoes overexpressing the Sultr1;2 gene showed significantly increased selenium content in roots, leaves, and fruits by 40.35%, 20.04%, and 39.72%, respectively; the selenium content in the fruits met the standard for selenium-enriched agricultural products (0.51 mg / kg); and the cadmium accumulation in roots, stems, leaves, and fruits decreased by 59.81%, 14.28%, 32.76%, and 53.14%, respectively, with the cadmium content in the fruits below the food safety threshold. Meanwhile, analysis of the selenium and cadmium speciation in rhizosphere soil revealed that high expression of the Sultr1;2 gene in tomato was beneficial in altering the bioavailability of selenium and cadmium in the rhizosphere. The content of bioavailable selenium (water-soluble and exchangeable forms) increased by 47.55% compared to the wild type, while the content of bioavailable cadmium decreased by 19.28%. These results indicate that the Sultr1;2 gene plays an important role in regulating soil selenium and cadmium speciation and promoting selenium enrichment and cadmium reduction in tomatoes.
[0047] Furthermore, this invention, by exploring the plant-microbe-soil interaction mechanism, revealed that the Sultr1;2 gene has the function of reshaping the rhizosphere microbiome, and screened a specific differential representative—N-ε-acetyl-L-lysine—from the rhizosphere soil of transgenic tomatoes and wild-type tomatoes overexpressing the Sultr1;2 gene. This differential metabolite was significantly enriched in the rhizosphere soil of transgenic tomatoes and is a key chemical signaling molecule for Sultr1;2 gene-driven rhizosphere microbiome reorganization. It can guide Streptomyces to move towards the roots, serving not only as a "navigation signal" for Streptomyces' chemotaxis but also as a "stabilizer" promoting its colonization and film formation on the root surface. Streptomyces is a typical type of microorganism with selenium-reducing capabilities. The selenium-enriched cadmium-reducing function of isolated rhizosphere molds was verified, confirming that Streptomyces can use the reduced selenium produced by metabolism to mineralize toxic cadmium ions in situ into insoluble and stable cadmium selenide nanoparticles, thereby achieving cadmium passivation. Subsequently, when N-ε-acetyl-L-lysine was applied alone or in combination with Streptomyces to the rhizosphere soil of wild-type tomatoes, the selenium content in the roots and aboveground parts of the plants increased significantly and the cadmium content decreased significantly, thus reproducing the phenotype of the Sultr1;2 transgenic plants. This study demonstrates that the sulfate transporter gene Sultr1;2 can specifically increase the secretion of the signaling molecule N-ε-acetyl-L-lysine by altering root metabolic flux, thereby specifically and directionally recruiting rhizosphere functional microorganisms with selenium reduction and cadmium fixation functions. In the rhizosphere microenvironment, it reduces tetravalent selenium to zero-valent selenium or organic selenium, promoting the activation of selenium in the soil (increasing available selenium) and converting divalent cadmium into the chemically stable cadmium selenide (CdSe) mineral form, promoting cadmium passivation. This regulates the differentiated absorption of selenium and cadmium by plant roots, thus endowing crops with the superior phenotype of "selenium enrichment and cadmium reduction." The implementation of this invention has significant practical implications for revealing the mechanism of selenium enrichment and cadmium reduction in tomatoes and for cultivating new tomato varieties with this function.
[0048] Based on this, one embodiment of the present invention provides the application of the Sullr1;2 gene in enhancing selenium enrichment and reducing cadmium in crops in selenium-cadmium-associated soils, wherein the coding region sequence of the Sullr1;2 gene is shown in SEQ ID NO.1. Specifically, by increasing the expression level of the Sullr1;2 gene in crops, the cadmium content in crops is reduced and the selenium content is increased, with both reduction and increase being relative to wild crops.
[0049] This invention provides excellent genetic resources and a new and effective approach for improving the ability of crops to reduce cadmium and enrich selenium, and for cultivating new crop varieties with high selenium and low cadmium content. By enhancing the expression level of the Sultr1;2 gene through transgenic genetic breeding, it is beneficial to regulate the differential absorption of selenium and cadmium by plant roots, significantly reduce cadmium accumulation in crops and increase selenium accumulation. It has broad application prospects and good social benefits in the safe utilization of farmland in selenium-enriched soils with cadmium coexistence and in the cultivation of selenium-enriched and cadmium-reducing crops.
[0050] Optionally, the reagent used to increase the expression level of the Sultr1;2 gene is selected from one of the following (A)-(C):
[0051] (A) A nucleic acid molecule containing the coding region of the Sultr1;2 gene;
[0052] (B) A recombinant overexpression vector containing the nucleic acid molecules described in (A);
[0053] (C) Recombinant microorganisms containing the recombinant overexpression vector described in (B).
[0054] The expression vector mentioned above can be the commonly used plant expression vector pMDC43, and the microorganism can be Agrobacterium or other microorganisms that can mediate transformation or transfection, such as lentiviruses, adenoviruses, etc.
[0055] Optionally, a method for increasing the expression level of the Sullr1;2 gene includes: constructing a Sullr1;2 gene overexpression vector, the Sullr1;2 gene overexpression vector containing the coding region of the Sullr1;2 gene; transforming the Sullr1;2 gene overexpression vector into wild-type crops, and culturing to obtain crop plants with increased Sullr1;2 gene expression levels.
[0056] Optionally, the construction of the Sultr1;2 gene overexpression vector includes: using tomato genomic cDNA as a template, performing PCR amplification with primer pairs as shown in SEQ ID NO.2-3 to obtain the coding region of the Sultr1;2 gene; and ligating the coding region of the Sultr1;2 gene into the expression vector pMDC43 using gateway gene cloning technology to construct the Sultr1;2 gene overexpression vector.
[0057] Specifically, linking the full-length coding region to the expression vector pMDC43 using gateway gene cloning technology includes the following steps: linking the coding region of the amplified Sultr1;2 gene to the pDONR207 vector via BP recombination reaction, and then linking the Sultr1;2 gene on the pDONR207 vector to the expression vector pMDC43 via LR recombination reaction to construct the Sultr1;2 gene overexpression vector.
[0058] The overexpression vectors described above can be used to transform wild-type crop cells or tissues using conventional techniques known to those skilled in the art, such as calcium phosphate coprecipitation, Ti plasmid method, Ri plasmid method, viral vector method, gene gun method, microinjection method, electroporation method, or Agrobacterium-mediated transformation.
[0059] The crop mentioned above is tomato, specifically the Micro-Tom variety.
[0060] This invention also provides the application of N-ε-acetyl-L-lysine or N-ε-acetyl-L-lysine-binding Streptomyces in selenium- and cadmium-enriched soils to enhance crop selenium enrichment and cadmium reduction.
[0061] Based on the same inventive concept described above, another embodiment of the present invention provides a method for breeding selenium-enriched and cadmium-reducing crops in selenium-cadmium-associated soils, comprising the following steps:
[0062] The expression level of the Sultr1;2 gene was increased in the target crop, and crop plants with increased expression levels of the Sultr1;2 gene were cultured; wherein the coding region sequence of the Sultr1;2 gene is shown in SEQ ID NO.1;
[0063] Alternatively, N-ε-acetyl-L-lysine can be applied to the root soil of the target crop;
[0064] Alternatively, apply a mixture of N-ε-acetyl-L-lysine and Streptomyces to the root soil of the target crop.
[0065] This invention specifically increases the secretion of the signaling molecule N-epsilon-acetyl-L-lysine by overexpressing the Sultr1;2 gene in crops, thereby directionally recruiting rhizosphere functional microorganisms with selenium reduction and cadmium fixation functions. This rhizosphere process promotes the activation of selenium in the soil (increasing available selenium) and the passivation of cadmium (inducing the formation of insoluble cadmium selenide nanominerals). By adding exogenous molecular signals and differentially expressed strains, it is possible to significantly increase the selenium content of non-GMO crops and reduce cadmium accumulation while improving crop yield. This has important practical significance in the safe production of selenium-enriched agricultural products in farmland with selenium and cadmium coexistence.
[0066] The structural formula of N-ε-acetyl-L-lysine (CAS No.: 692-04-6) is shown below:
[0067] .
[0068] The method for increasing the expression level of the Sultr1;2 gene in tomato plants described above is the same as in the above embodiments, and will not be repeated in this embodiment.
[0069] Optionally, the application concentration of N-ε-acetyl-L-lysine is 60-70 mg / kg soil, and the application concentration of Streptomyces is 0.1-10 × 10⁻⁶ mg / kg soil. 7 CFU / kg soil; In a specific embodiment, the application concentration of N-ε-acetyl-L-lysine is 62.67 mg / kg soil, and the application concentration of Streptomyces is 10... 7 CFU / kg soil.
[0070] The aforementioned selenium-cadmium associated soil refers to contaminated soil containing selenium and cadmium, wherein the selenium content is 2-6 mg / kg and the cadmium content is 1-5 mg / kg; in the specific embodiment, the selenium content is 4.12 mg / kg and the cadmium content is 2.51 mg / kg.
[0071] The present invention will be further illustrated below with reference to specific embodiments. Experimental methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions, such as those described in *Molecular Cloning: A Laboratory Manual (Fourth Edition)* published by Cold Spring Harbor Laboratory, or as recommended by the manufacturer. Furthermore, all materials and reagents used in the following embodiments are commercially available unless otherwise specified.
[0072] Example
[0073] 1. Construction of transgenic crops overexpressing the tomato Sultr1;2 gene
[0074] Micro-Tom tomato (Solanum lycopersicum) was selected as the host plant. An overexpression vector carrying the sulfate transporter gene Sultr1;2 (transcription number Solyc12g056930.1.1 in the Solanaceae Genomics Network (SGN) database, access link: https: / / solgenomics.net / feature / 18007698 / details) was transferred into tomatoes using Agrobacterium-mediated transformation. Transgenic tomato lines highly expressing the Sultr1;2 gene were screened to verify their selenium-enrichment and cadmium-reducing effects in selenium- and cadmium-contaminated soils.
[0075] (1) Construction of Sultr1;2 gene overexpression vector
[0076] Using Micro-Tom tomato genomic cDNA as a template, the coding sequence (CDS) of the Sultr1;2 gene was amplified by PCR. The PCR amplification system consisted of: 2 μL cDNA, 2 μL each of forward and reverse primers (10 μM), 25 μL DNA mix enzyme (2×T5 SuperPCR Mix, purchased from Qingke Biotechnology, catalog number TSE005), and ddH2O to a final volume of 50 μL. The PCR amplification program included: 98℃ pre-denaturation for 3 min; 98℃ denaturation for 15 s, 58℃ annealing for 30 s, 68℃ extension for 2 min, for a total of 35 cycles; final extension at 68℃ for 10 min; and storage at 4℃.
[0077] The coding region sequence (DNA, 5'-3') of the Sultr1;2 gene is shown below:
[0078]
[0079] The sequences (DNA, 5'-3') of the forward / reverse primers (F / R) are shown below:
[0080] Sultr1;2-F1:ggagtgagtacggtgtgcATGGCTAATTCTAATGCTGACGC (see SEQ ID NO. 2);
[0081] Sultr1;2-R1:gagttggatgctggatggTTAAACTTCTTCAGGCAATTTTAAT (see SEQ ID NO.3).
[0082] The amplified products were detected by 1.0% agarose gel electrophoresis, and the target fragment was recovered and purified. The target fragment was cloned using Gateway site-specific recombination technology based on the λ phage integrase system and ligated into the plant expression vector pMDC43 (N-terminal GFP) (purchased from Newp Biotechnology, plasmid number V014606) to obtain the recombinant overexpression vector pMDC43-SlSULTR1;2-GFP. This vector is an Agrobacterium binary expression vector containing a CaMV 35S strong promoter to drive Sultr1;2 gene expression. Green fluorescent protein (GFP) serves as a reporter gene, located at the N-terminus of the Sultr1;2 protein, indicating the expression level of the target gene. The 35S::SlSULTR1;2:GFP expression cassette is located within the T-DNA region, and the 35S::SlSULTR1;2:GFP expression cassette is integrated into the tomato genome via Agrobacterium-mediated integration.
[0083] The construction of pMDC43-SlSULTR1;2-GFP specifically involves: mixing the purified PCR product with the entry vector pDONR207 (purchased from Newp Biotech, plasmid number V011826), and using BP Clonase... TM II. A BP recombination reaction was performed using Enzyme Mix (Thermo Fisher Scientific, product number 11789100). After incubation at 25°C for 16 hours, the mixture was transformed into *E. coli* DH5α competent cells (Beyotime Biotechnology Co., product number D1031S). The correct entry vector, pDONR-Sultr1;2, was obtained after kanamycin screening and sequencing verification. The entry vector pDONR-Sultr1;2 was then mixed with the target expression vector pMDC83-GFP and expressed using LR Clonase. TMII. Enzyme Mix (purchased from Thermo Fisher Scientific, product number 11791100) was used for LR recombination reaction. After reacting at 25°C for 16 hours, it was transformed into E. coli DH5α. After screening with kanamycin and verification by PCR, the recombinant overexpression vector pMDC43-SlSULTR1;2-GFP was obtained.
[0084] (2) Genetic transformation of Sultr1;2 gene overexpression vector
[0085] The constructed recombinant overexpression vector pMDC43-SlSULTR1;2-GFP was introduced into Agrobacterium competent strain GV3101 (strain number C3620, purchased from Beijing Solarbio Science & Technology Co., Ltd.) via the freeze-thaw method.
[0086] Micro-Tom tomato cotyledons were selected as explants. After co-culture, callus induction, shoot differentiation and rooting screening (selection medium containing hygromycin), the Sultr1;2 overexpression lines with homozygous genomic expression were finally screened and named OE-5 and OE-6.
[0087] (3) Verification of gene expression levels in transgenic tomato lines Sultr1;2
[0088] Transcriptional level detection: The expression level of the Sultr1;2 gene was detected using quantitative real-time PCR (qRT-PCR). Specifically, total RNA was extracted from the roots of 4-week-old transgenic tomato seedlings and reverse transcribed into cDNA. A CFX96 quantitative real-time PCR detection system (Bio-Rad, Hercules, CA, USA) was used, and the SYBR Green Premix kit (purchased from Tiangen Biotech Co., Ltd., catalog number FP205-02) was employed for qRT-PCR detection. The reaction mixture (20 μL) contained: 2 μL cDNA template, 10 μL 2×Premix, 0.4 μL each of forward and reverse primers (Sultr1;2-F2 / R2), and 7.2 μL nuclease-free water. The amplification program was set as follows: 95°C pre-denaturation for 30 s; each cycle included 95°C denaturation for 5 s, 60°C annealing / extension for 30 s, for 40 cycles. Using the tomato Slactin2 gene as an internal control (detection primer Slactin2-F / R), 2 -ΔΔCt The relative expression level was calculated using the following method. Primer sequences (DNA, 5'-3') are shown below:
[0089] Sultr1;2-F2: TTCAAGGATCAACCGAGGTC (see SEQ ID NO.4);
[0090] Sultr1;2-R2: GCCCATGAAGGCGTAAAACTA (see SEQ ID NO. 5).
[0091] Slactin2-F: CATTGTGCTCAGTGGTGGTTC (see SEQ ID NO. 6);
[0092] Slactin2-R: TGGGTGTGCCTTTCTGAATG (see SEQ ID NO.7).
[0093] Protein expression localization: The root system of 10-day-old transgenic seedlings expressing the Sultr1;2-GFP fusion protein was observed using confocal laser scanning microscopy.
[0094] The validation results of the expression level of the transgenic tomato line Sultr1;2 gene are shown in the figure. Figure 1 Figure A shows the relative transcriptional abundance of the Sultr1;2 gene in the roots of two independent overexpression lines (OE-5 and OE-6) and wild-type (WT) tomato, determined by qRT-PCR. The horizontal axis represents plant type, and the vertical axis represents the relative expression level of the Sultr1;2 gene. Figures B and C are subcellular localization microscopic images of the Sultr1;2-GFP fusion protein in the root tips of OE and WT lines, respectively. The left side is a brightfield image used to show the morphology and structure of root tip cells, and the right side is a GFP fluorescence channel image used to show the expression and localization signal of the Sultr1;2-GFP fusion protein. The scale bar is 100 μm. The qRT-PCR results showed that the transcriptional level of Sultr1;2 in the roots of the overexpression (OE) lines was significantly upregulated compared with that of the wild-type (WT) lines. Compared with the wild-type (WT) lines, the transcriptional level of Sultr1;2 in the roots of OE-5 and OE-6 lines was upregulated by more than 3-fold on average. Subcellular localization observation results showed that the GFP fluorescence signal was mainly concentrated in the root epidermis and cortex, indicating that the target protein Sultr1;2 is stably expressed in root cells and is membrane localized.
[0095] 2. Phenotypic analysis of transgenic tomatoes with selenium-enriched and cadmium-reduced growth after Sultr1;2 gene overexpression (pot experiment)
[0096] WT, OE-5, and OE-6 seedlings were transplanted into natural high-selenium and cadmium-containing soil (total selenium 4.12 mg / kg, total cadmium 2.51 mg / kg) collected from Enshi, Hubei Province, for a pot experiment covering the entire growth period (90 days). Temperature control: A diurnal temperature variation mode was set, maintaining a daytime temperature of 25℃ and a nighttime temperature of 18℃. Photoperiod: A 14-hour light / 10-hour dark photoperiod was used for supplemental lighting. Water management: Water management was carried out using a weighing method, with deionized water added daily to maintain soil moisture content at 70% of field capacity. Soil filling: Each plastic pot (25 cm in diameter, 20 cm in height) was filled with 3 kg of well-mixed natural selenium and cadmium-containing soil. Planting period: The tomato seedlings grew from transplanting until the end of their full growth period (90 days), until the fruit matured and was harvested.
[0097] After harvest, the elemental content of each part (root, stem, leaf, and fruit) was determined. The selenium (Se) and cadmium (Cd) content of the plant samples was determined by wet digestion combined with instrumental analysis. The specific steps are as follows: (i) Sample pretreatment: The dried plant tissues (root, stem, leaf, and fruit) were ground into fine powder; (ii) Microwave digestion: Approximately 0.2 g of sample powder was accurately weighed and placed in a digestion vessel. A mixture of concentrated nitric acid (HNO3) and perchloric acid (HClO4) with a volume ratio (v / v) of 5:1 was added, and the mixture was digested using a microwave digester (Mars 6, CEM). The digestion was performed by Corporation, and the program was set as follows: the temperature was raised to 180°C within 20 minutes and held for 30 minutes until the digestion solution was clear; (iii) reduction treatment (for selenium): after the digestion solution was deacidified, 6 mol / L hydrochloric acid (HCl) was added to reduce hexavalent selenium [Se(VI)] to tetravalent selenium [Se(IV)] for atomic fluorescence detection; the selenium content was determined by liquid chromatography-atomic fluorescence spectrometry (LC-AFS), and the cadmium content was determined by inductively coupled plasma mass spectrometry (ICP-MS); quality control: the standard reference material (GBW10020a citrus leaves) was used for quality control during the experiment, and the recovery rate was controlled between 95% and 105%.
[0098] In addition, samples were taken to determine the chemical element speciation of rhizosphere soil.
[0099] For rhizosphere selenium speciation extraction, 1.0000 g of air-dried soil sample (passed through a 100-mesh sieve) was accurately weighed and placed in a 50 mL polypropylene centrifuge tube. Extraction was performed stepwise in the following order (a)-(e). After each extraction step, the sample was centrifuged at 4000 r / min for 15 min, and the supernatant was filtered through a 0.45 μm filter into a collection bottle for analysis. (a) Soluble selenium: 0.01 mol CaCl2 was added to the centrifuge tube, and the mixture was continuously shaken at 25 ℃ for 2 h, followed by centrifugation. (b) Exchangeable selenium: 20 mL of 0.1 mol / L K2HPO4 solution (pH 7.0) was added to the residue from the previous step, and the mixture was continuously shaken at 25 ℃ for 2 h. The adsorbed selenium was displaced by the competitive adsorption of phosphate ions, followed by centrifugation. (c) Iron-manganese oxide bound selenium: Add 20 mL of 0.25 mol / L NH2OH·HCl (hydroxylamine hydrochloride) solution to the residue from the previous step, shake continuously at 50℃ for 2 h, centrifuge to reduce and dissolve the iron-manganese oxides, and centrifuge again. (d) Organically bound selenium: Add 5 mL of 30% H2O2 and 3 mL of 0.02 mol HNO3 to the residue from the previous step, heat intermittently with shaking in an 85℃ water bath for 2 h until the liquid is dry. After cooling, add 5 mL of 1.0 mol / L NH4OAc (ammonium acetate, pH 2.0), shake for 30 min to extract the released selenium, and centrifuge. (e) Residual selenium: Transfer all remaining residue to a polytetrafluoroethylene digestion vessel, digest using an HNO3-HClO4 digestion system, and determine the selenium content after adjusting the volume. The selenium content of all extracts was determined using liquid chromatography-atomic fluorescence spectrometry.
[0100] For rhizosphere cadmium speciation extraction, 1.0000 g of air-dried soil sample (passed through a 100-mesh sieve) was accurately weighed and placed in a 50 mL polypropylene centrifuge tube. Extraction was performed stepwise in the following order (a)-(d). After each extraction step, the sample was centrifuged at 4000 r / min for 15 min, and the supernatant was filtered through a 0.45 μm filter into a collection bottle for analysis. (a) Exchangeable cadmium: 20 mL of 0.11 mol acetic acid solution was added, and the mixture was continuously shaken at 25℃ for 16 h. After centrifugation, the supernatant was collected. This fraction contained water-soluble cadmium and cadmium bound to soil colloids via electrostatic adsorption. (b) Reducible cadmium: 20 mL of 0.25 mol / L NH₂OH·HCl (hydroxylamine hydrochloride) solution was added to the residue from the previous step. The pH was adjusted to 1.5 with HNO₃, and the mixture was continuously shaken at 25℃ for 16 h. After centrifugation, the supernatant was collected. This speciation mainly corresponds to cadmium bound to iron and manganese oxides. (c) Oxidizable cadmium: 10 mL of 30% H2O2 was added to the residue from the previous step, and the mixture was heated in an 85°C water bath until nearly dry. Another 10 mL of 30% H2O2 was added, and the mixture was heated again until nearly dry. After cooling, 25 mL of 1.0 mol / L NH4OAc was added, the mixture was shaken for 16 h, and then centrifuged. This form mainly corresponds to cadmium bound to organic matter and sulfides. (d) Residual cadmium: The final residue was digested using an HNO3-HClO4 system, and after adjusting the volume, it was determined using inductively coupled plasma mass spectrometry (ICP-MS).
[0101] Figure 2The figures show the selenium and cadmium (Cd) content in various tissues of OE and WT tomato plants and in the soil. Figures AD represent the selenium (Se) content in the root, shoot, leaf, and fruit, respectively; Figures EH represent the Cd (Cd) content in the root, shoot, leaf, and fruit, respectively; Figures IJ represent the available selenium (Se) and available Cd (Cd) content in the rhizosphere soil, respectively; and Figure K represents the content of different forms of selenium and Cd in the rhizosphere soil. Here, Available Se represents available selenium, FMO-Se represents iron-manganese bound selenium, OM-Se represents organically bound selenium, and RES-Se represents residual selenium. Cd represents available cadmium, OXI-Cd represents oxidizable cadmium, RED-Cd represents reducible cadmium, and RES-Cd represents residual cadmium. The horizontal axis in the figure represents plant type, and the vertical axis represents selenium and cadmium content. *P<0.05, **P<0.01, and ***P<0.001 indicate significant differences compared to WT according to Tukey's HSD test, while ns indicates no significant difference. Results showed that after 60 days of growth in selenium-cadmium co-contaminated soil, the selenium content in the fruit of OE plants significantly increased (reaching the selenium enrichment standard) while the cadmium content significantly decreased (below the safety threshold). Specifically, compared to WT, the selenium content in the roots, leaves, and fruits of the OE strain significantly increased by 40.35%, 20.04%, and 39.72%, respectively. In particular, the selenium concentration in fresh fruit reached 0.51 mg / kg, meeting the standard for selenium-enriched agricultural products (reference standard: GH / T 1135-2017 Selenium-Enriched Agricultural Products). Furthermore, the OE strain exhibited significant cadmium reduction characteristics, with an average 59.81% decrease in root cadmium concentration, and reductions of cadmium accumulation in stems, leaves, and fruits by 14.28%, 32.76%, and 53.14%, respectively. The cadmium content in the fruits was below the threshold of the national food safety standard GB2762-2022, "Limits of Contaminants in Food." Analysis of the rhizosphere soil revealed that the content of bioavailable selenium (water-soluble and exchangeable forms) in the rhizosphere of the OE strain increased by 47.55% compared to the WT strain; while bioavailable cadmium significantly decreased by 19.28%, and bioavailable cadmium was converted to an insoluble form. These results confirm that overexpression of the tomato Sultr1;2 gene can significantly alter the bioavailability of selenium and cadmium in the rhizosphere, thus endowing the crop with the excellent phenotype of "selenium enrichment and cadmium reduction."
[0102] 3. Sultr1;2 gene-mediated recruitment of selenium-enriched cadmium-lowering microorganisms and functional reprogramming of the rhizosphere microbiome
[0103] Rhizosphere soil samples were collected from OE and WT tomato plants for metagenomic sequencing analysis. The sequencing work was commissioned to Shanghai Meiji Biotechnology Co., Ltd. To investigate spatial differences in community composition, stratified clustering and principal coordinate analysis (PCoA) were performed on the rhizosphere soil microbial communities of each group of three sampling points based on species abundance data and Bray-Curtis dissimilarity. The Shannon index of species abundance and distribution was calculated based on the Wilcoxon test.
[0104] Figure 3 The results illustrate the recruitment of selenium-enriched cadmium-reducing microorganisms and the functional reprogramming of the rhizosphere microbiome mediated by the Sultr1;2 gene. Figure A shows the hierarchical clustering analysis based on Bray-Curtis differences, revealing the differentiation of rhizosphere bacterial communities between the WT and OE strains. Figure B is a principal coordinate analysis, revealing a clear separation of the microbial community structure (R=1, P=0.004). Figure C is a Shannon diversity index of the rhizosphere microbial community, showing that the Shannon index of the rhizosphere soil of the OE strain is higher than that of the WT strain, but the difference is not significant. Figure D is a relative abundance plot of the top 10 bacteria, showing that Actinobacteria and Streptomyces are significantly enriched in the OE group. These results confirm that the Sultr1;2 gene has the function of remodeling the rhizosphere microbiome and can directionally recruit functional microbial communities with selenium-cadmium conversion potential.
[0105] 4. Screening and identification of the rhizosphere characteristic metabolite N-ε-acetyl-L-lysine
[0106] In this embodiment, metabolomics analysis was performed using liquid chromatography-high resolution mass spectrometry (LC-MS) to screen specific root exudate signaling molecules, in order to reveal the material basis of the changes in rhizosphere microecology caused by Sultr1;2 gene overexpression.
[0107] (1) Collection of root exudates: WT and OE tomato plants were grown hydroponically for 6 weeks, and root exudates were collected under sterile conditions. The specific steps were as follows: Wild-type (WT) and Sultr1;2 gene overexpression (OE) tomato seeds were surface-sterilized and germinated, then transplanted into hydroponic containers containing 1 / 2 concentration of Hoagland nutrient solution and cultured in a greenhouse for 6 weeks until the plant roots were well-developed. Plants with uniform growth were removed from the nutrient solution and the roots were rinsed 3 times with sterile water to remove residual nutrients. The plants were then transferred to sterile beakers containing 200 mL of Milli-Q ultrapure water. To capture the diurnal rhythm of plant exudation activity, the collection time was set from 9:00 am to 3:00 pm, and the collection was carried out for 6 hours. After the collection was completed, the plants were removed, and the collected liquid was immediately filtered through a 0.22 μm microporous membrane to remove detached root debris and microorganisms. The filtrate was immediately pre-frozen in an ultra-low temperature freezer at -80°C, and then freeze-dried into powder using a vacuum freeze dryer. The freeze-dried powder was reconstituted in an 80% methanol aqueous solution, dissolved by vortexing, and the supernatant was collected by centrifugation as the sample to be tested.
[0108] (2) LC-MS detection: Full-spectrum analysis of reconstituted root exudate samples was performed using liquid chromatography-high-resolution mass spectrometry (LC-MS). Data acquisition was performed using an ultra-high performance liquid chromatography system connected to a Q-Exactive HF-X quadrupole Orbitrap mass spectrometer (ThermoFisher Scientific). Full scans and data-dependent secondary mass spectrometry scans were performed in positive and negative ion modes, respectively, to obtain the richest possible metabolite fingerprint information. Raw mass spectrometry data were imported into Compound Discoverer 3.1 software for peak extraction, peak alignment, and normalization. Metabolites were qualitatively annotated using standard databases such as mzCloud, mzVault, and MassBank, based on the precise mass-charge ratio (m / z) of the primary mass spectrometry and fragmentation maps of the secondary mass spectrometry.
[0109] (3) Identification of differentially expressed metabolites: The data matrix was imported into SIMCA-P 14.1 software for principal component analysis (PCA) and orthogonal partial least squares discriminant analysis (OPLS-DA) to assess the overall differences in metabolomics profiles between the WT and OE groups. Differentially accumulated metabolites (DAMs) were screened by combining multidimensional and unidimensional statistical results. The screening threshold was set as follows: the projected importance (VIP) value of the variable in the OPLS-DA model > 1, and the significance p-value of the T-test < 0.05. Metabolites that met the above conditions were defined as significantly differentially expressed metabolites.
[0110] Figure 4The metabolomics analysis results of root exudates from hydroponically grown tomato plants overexpressing Sultr1;2 and WT are shown. Figure A is the principal component analysis plot, showing that the metabolomic profiles of root exudates from OE and WT plants are significantly different. Figure B is the KEGG pathway enrichment analysis of differentially expressed metabolites, highlighting significant changes in the "amino acid metabolism" and "membrane transport" pathways in OE exudates. Figure C is the volcano plot of differentially expressed metabolites, with red and blue dots representing significantly upregulated and downregulated metabolites, respectively (P<0.05, VIP>1). N-ε-acetyl-L-lysine was the most significantly upregulated biomarker in the OE line. Quantitative analysis showed that the content of this metabolite in the root exudates of the OE line was 1.26 times that of the WT line.
[0111] (4) Microcosmic Verification of Metabolite Function: To verify the regulatory effect of this metabolite on the soil microbiome, a soil microcosmic culture experiment was conducted. WT root exudates, OE root exudates, or sterile water were added to sterilized selenium-cadmium contaminated soil, respectively. The specific method is as follows: The root exudate collection liquids of wild-type (WT) and overexpression line (OE) collected in the aforementioned step (sterile hydroponics for 6 hours) were sterilized by a 0.22 μm filter membrane and then freeze-dried using a vacuum freeze dryer. The freeze-dried powder was reconstituted with sterile water at a volume of 10% of the original collection volume (i.e., 10-fold concentration) to obtain a concentrated root exudate solution. 200g of natural selenium-cadmium associated soil was accurately weighed and placed in a sterile culture bottle. Treatment was carried out by adding the solution in stages to simulate the continuous exudation process of plant roots. On the 1st and 7th day of culture, the above-mentioned 10-fold concentrated root exudate was added evenly to the soil. The control group received an equal volume of sterile water at the same time point. After adding the secretions, the soil moisture content was adjusted to 70% of the field capacity. The bottle opening was sealed with a breathable sealing film to ensure ventilation. The bottle was then placed in a 25°C constant temperature incubator and cultured in the dark for 14 days. Subsequently, soil samples were collected for microbial sequencing analysis.
[0112] Figure 5The effects of exogenous addition of root exudates from tomato plants overexpressing Sultr1;2 and WT on soil microbial communities are shown. Figure A is the Shannon diversity index, with different letters indicating significant differences (P<0.05, Tukey's HSD test). Figure B is the principal coordinate analysis based on Bray-Curtis distance (R²=0.66, P=0.005). Figure C shows the linear discriminant analysis (LDA) effect size (LEfSe), identifying bacterial groups significantly enriched in OE-treated soil compared to the control. Figure D is a multifactorial co-occurrence network diagram; the color of nodes in the left network diagram represents modules, while the color of nodes in the right network diagram represents node type, node size represents degree, and the color of the connecting lines between nodes represents connection type. Results show that the addition of OE root exudates to the soil specifically shifted the soil microbial community structure, with the selenium-enriched and cadmium-lowering microorganism *Streptomyces* becoming a biomarker with significantly increased abundance (LDA score>2). This confirms that N-ε-acetyl-L-lysine is a key chemical factor driving the enrichment of selenium-enriched and cadmium-reducing microorganisms in the rhizosphere. Exogenous addition of N-ε-acetyl-L-lysine can reproduce microbial community shifts and Streptomyces enrichment phenomena similar to those observed in transgenic plants.
[0113] 5. Validation of chemotactic recruitment and film-forming characteristics of rhizosphere functional microorganisms
[0114] This embodiment aims to verify the specific recruitment mechanism of N-ε-acetyl-L-lysine on selenium-enriched cadmium-reducing microorganisms.
[0115] (1) Isolation and identification of strains
[0116] Two dominant selenium-enriched cadmium-reducing microorganisms, S1 and S2, were isolated and purified from the rhizosphere soil of tomato plants overexpressing the Sultr1;2 gene by streak separation and pure culture. S1 was identified as Streptomyces kebangsaanensis and S2 as Streptomyces panaciradicis by 16S rRNA gene sequencing. Both S1 and S2 are Streptomyces.
[0117] (2) Chemotaxis Assay
[0118] Qualitative plate method: 10 mM N-ε-acetyl-L-lysine was added to a semi-solid agar plate, and the size of the chemotactic loops formed by strains S1 and S2 was observed. Quantitative capillary method: Chemotaxis experiments were performed using capillaries containing different concentrations (0.1, 1.0, 10 mM) of N-ε-acetyl-L-lysine.
[0119] Figure 6The chemotaxis of Streptomyces S1 and S2 to N-ε-acetyl-L-lysine is shown in Figure A, where Figure A is a migration map on a semi-solid agar plate, Figure B is a capillary migration map and a representative colony plate, and Figures C and D are quantitative colony counts of Streptomyces S1 and S2 in response to different concentrations of N-ε-acetyl-L-lysine (0.1, 1.0, and 10 mM), respectively. Qualitative results show that Streptomyces strains S1 and S2 migrate to N-ε-acetyl-L-lysine on semi-solid agar plates (yellow arrows indicate the chemotactic loop). Quantitative data show that strains S1 and S2 exhibit significant concentration-dependent chemotactic movement towards N-ε-acetyl-L-lysine. At a concentration of 10 mM, the number of recruited selenium-enriched cadmium-lowering microorganisms S1 and S2 is 3.50 times and 2.76 times that of the low-concentration control (0.1 mM), respectively.
[0120] (3) Biofilm formation experiment
[0121] Biofilm formation was determined using crystal violet staining. Spores of Streptomyces S1 and S2 were obtained by culturing on ISP-2 solid medium at 28°C. The spores were then suspended in sterile physiological saline and the concentration was adjusted to 1×10⁻⁶. 6 spores / mL. 200 μL of ISP-2 liquid medium was added to 96-well polystyrene microplates, and N-ε-acetyl-L-lysine was added to final concentrations of 0, 0.1, 1.0, and 10 mM. After inoculation with spore suspension, the plates were incubated statically at 28 °C for 48 h. After incubation, the supernatant was discarded, and the plates were washed three times with PBS. Staining with 0.1% (w / v) crystal violet was performed for 20 min. After washing away excess dye, 200 μL of 33% glacial acetic acid was added to dissolve and bind the dye. The absorbance was measured at 590 nm to characterize the amount of biofilm formed.
[0122] See results Figure 7 Figure A shows the crystal violet staining pattern, while Figures B and C show the biofilm formation rate (OD) respectively. 590 Statistical results (different letters indicate significant differences, P<0.05, Tukey's HSD test). The results showed that exogenous addition of N-ε-acetyl-L-lysine significantly promoted biofilm formation in the selenium-enriched cadmium-reducing microorganism *Streptomyces*. At a concentration of 10 mM, the biofilm biomass (OD) of selenium-enriched cadmium-reducing strains S1 and S2 was significantly higher. 590 The levels of N-ε-acetyl-L-lysine metabolite increased by 1.38 times and 1.49 times compared to the control group, respectively. This indicates that N-ε-acetyl-L-lysine metabolite, as a bifunctional molecule, serves both as a "navigation signal" guiding Streptomyces to move towards the roots and as a "stabilizer" promoting the colonization and film formation of selenium-enriched cadmium-reducing microorganisms on the root surface.
[0123] 6. Mechanism of in-situ mineralization of selenium and cadmium by rhizosphere functional microorganisms
[0124] In vitro conversion capacity determination: Selenium-enriched cadmium-reducing microorganisms S1 and S2 were cultured in liquid LB medium containing 0.1 mM sodium selenite [Se(IV)] and / or 0.1 mM cadmium chloride [Cd(II)] at 28°C and 180 rpm. After 7 days of culture, samples were taken, centrifuged, and the supernatant was collected for sequencing of Se and Cd contents. In addition, S2 cells were collected, and X-ray photoelectron spectroscopy (XPS) analysis was performed on the S2 cells after the reaction to analyze the changes in elemental valence states.
[0125] Figure 8 The following figures illustrate the effects of rhizosphere functional microorganisms on selenium enrichment and cadmium reduction in culture systems containing sodium selenite (Na2SeO3) or sodium selenite and cadmium chloride (CdCl2). Figure A shows the selenium reduction rate after 7 days of culture in the sodium selenite (Se cultivation system) or sodium selenite and cadmium chloride (Se-Cd cultivation system) culture systems. Figure B shows the cadmium adsorption rate after 7 days of culture in the sodium selenite (Se cultivation system) or sodium selenite and cadmium chloride (Se-Cd cultivation system) culture systems (*P<0.05, **P<0.01, ***P<0.001). Figure C shows the Cd 3d spectrum characterized by X-ray photoelectron spectroscopy (XPS). Figure D shows the Se 3d spectrum of bacterial cell S2 under Se treatment alone. Figure E shows the Se 3d spectrum under Se+Cd treatment. Figure F shows the superimposed Se 3d spectrum. The results showed that in the Se+Cd coexistence system, strain S2 achieved a selenium reduction rate of up to 94.65% and a cadmium adsorption and removal rate of 66.72%. The presence of selenium promoted cadmium removal, and vice versa, demonstrating a significant synergistic effect. XPS characterization analysis revealed that in the Se+Cd treatment group, the binding energy of Cd 3d5 / 2 shifted negatively from 405.00 eV (cadmium treatment only) to 404.68 eV. This decrease in binding energy indicates that cadmium and selenium formed a covalent bond, rather than simple ion adsorption. Furthermore, a new characteristic peak at 54.00 eV appeared in the Se+Cd treatment group. This binding energy corresponds to divalent selenium (Se). 2- Specifically, these results indicate the formation of cadmium selenide (CdSe). These findings suggest that in cadmium selenide-selenide coexisting systems, selenium-enriched cadmium-reducing microorganisms recruited by the specific signaling molecule N-ε-acetyl-L-lysine utilize metabolically produced reduced selenium (Se) 2- As a mineralizing agent, it precipitates free cadmium ions in situ into cadmium selenide (CdSe) nanoparticles, thereby achieving cadmium passivation; at the same time, some selenium is converted into an organic form for plant absorption.
[0126] 7. N-ε-acetyl-L-lysine and selenium-enriched cadmium-reducing microorganisms enhance in-situ mineralization of selenium and cadmium in crops.
[0127] This embodiment verifies the application potential of the proposed technical solution in non-GMO crops through a "replenishment experiment" on wild-type tomato crops. Experimental design: Micro-Tom wild-type (WT) tomatoes were planted in naturally selenium-cadmium contaminated soil (selenium content 4.12 mg / kg, cadmium content 2.51 mg / kg), with 3 kg of soil per pot. The pot experiment was conducted under greenhouse conditions, with a daytime temperature of 25℃ and a nighttime temperature of 18℃, and a photoperiod of 14 h light / 10 h dark. Plastic pots with a diameter of 25 cm and a height of 20 cm were used in the experiment. The following four treatment groups were set up: (1) CK: control group, watered with sterile water; (2) Syn: inoculated with synthetic microbial community (a 1:1 mixture of S1 and S2 strains, inoculated at a rate of 10 g / kg). 7 (3) M: Apply specific signaling substance (N-ε-acetyl-L-lysine, final concentration 10 mM, application rate 188 mg per pot); (4) MSyn: Combine application of selenium-enriched cadmium-lowering synthetic bacteria and specific signaling substance metabolites (Syn + M). One week after transplanting and when the plants are growing stably, each treatment group was applied by single root irrigation.
[0128] After the tomatoes matured, samples were taken to determine the plant dry weight, selenium and cadmium content in various tissues, and available selenium and cadmium content in the soil. Results are shown below. Figure 9 Figure A shows the dry biomass of wild-type tomatoes grown in selenium- and cadmium-contaminated soil under different treatments. Figures B and C show the bioavailability of selenium and cadmium in the rhizosphere soil at harvest. Figures D and E show the selenium accumulation in the stems and roots of the plants, and Figures F and G show the cadmium accumulation in the stems and roots of the plants. Different letters indicate significant differences (P < 0.05, Tukey's HSD test). It is evident that the application of the metabolite (Group M) showed a good selenium-enrichment and cadmium-reducing effect (superior to CK), increasing available selenium in the soil by 13.20% and reducing available cadmium by 32.40%. This indicates that this specific signaling substance can activate indigenous Streptomyces, simulating a similar microecological regulatory effect to transgenic lines. The combination of bacteria and metabolites showed better results. The MSyn treatment group had the highest plant dry weight, increasing by 33.76% compared to the control (CK), and significantly increased the available selenium content in the rhizosphere soil while significantly reducing the available cadmium content. Compared to the control, the selenium content in the aboveground parts and roots of the plants increased by 27.57% and 31.74%, respectively; while the cadmium content decreased significantly by 54.07% and 29.54%, respectively, replicating the phenotype of the Sultr1;2 transgenic plants. This demonstrates that by utilizing N-ε-acetyl-L-lysine and / or combining it with selenium-enriched and cadmium-reducing functional bacteria, the same selenium-enriched and cadmium-reducing effects can be achieved in non-transgenic crops, demonstrating practical application value.
[0129] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A breeding method for selenium-enriched and cadmium-reducing crops in selenium-cadmium-associated soils, characterized in that, Includes the following steps: The expression level of the Sultr1;2 gene was increased in the target crop, and crop plants with increased expression levels of the Sultr1;2 gene were cultured; wherein the coding region sequence of the Sultr1;2 gene is shown in SEQ ID NO.1; Alternatively, N-ε-acetyl-L-lysine can be applied to the root soil of the target crop; Alternatively, apply a mixture of N-ε-acetyl-L-lysine and Streptomyces to the root soil of the target crop.
2. The breeding method for selenium-enriched and cadmium-reducing crops in selenium-cadmium-associated soils according to claim 1, characterized in that, The reagent used to increase the expression level of the Sultr1;2 gene is selected from one of the following (A)-(C): (A) A nucleic acid molecule containing the coding region of the Sultr1;2 gene; (B) A recombinant overexpression vector containing the nucleic acid molecules described in (A); (C) Recombinant microorganisms containing the recombinant overexpression vector described in (B).
3. The breeding method for selenium-enriched and cadmium-reducing crops in selenium-cadmium-associated soils according to claim 2, characterized in that, The expression vector is pMDC43, and the microorganism is Agrobacterium.
4. The breeding method for selenium-enriched and cadmium-reducing crops in selenium-cadmium-associated soils according to claim 1, characterized in that, Methods for increasing the expression level of the Sultr1;2 gene include: Construct a Sultr1;2 gene overexpression vector, wherein the Sultr1;2 gene overexpression vector contains the coding region of the Sultr1;2 gene; The Sultr1;2 gene overexpression vector was transformed into wild-type crops to obtain crop plants with increased Sultr1;2 gene expression levels.
5. The breeding method for selenium-enriched and cadmium-reducing crops in selenium-cadmium-associated soils according to claim 3, characterized in that, The method for constructing the Sullr1;2 gene overexpression vector includes: Using tomato genomic cDNA as a template, PCR amplification was performed using primer pairs shown in SEQ ID NO.2-3 to obtain the coding region of the Sultr1;2 gene; The coding region of the Sultr1;2 gene was ligated into the expression vector pMDC43 using gateway gene cloning technology to construct the Sultr1;2 gene overexpression vector.
6. The breeding method for selenium-enriched and cadmium-reducing crops in selenium-cadmium-associated soils according to claim 5, characterized in that, The process of ligating the full-length coding region into the expression vector pMDC43 using gateway gene cloning technology includes the following steps: The coding region of the amplified Sultr1;2 gene was ligated to the pDONR207 vector via a BP recombination reaction, and then the Sultr1;2 gene on the pDONR207 vector was ligated to the expression vector pMDC43 via an LR recombination reaction to construct the Sultr1;2 gene overexpression vector.
7. The breeding method for selenium-enriched and cadmium-reducing crops in selenium-cadmium-associated soils according to claim 1, characterized in that, The application concentration of N-ε-acetyl-L-lysine is 60-70 mg / kg soil, and the application concentration of Streptomyces is 0.1-10 × 10⁻⁶ mg / kg soil. 7 CFU / kg soil.
8. The breeding method for selenium-enriched and cadmium-reducing crops in selenium-cadmium-associated soils according to claim 1, characterized in that, The crop in question is tomato; The selenium content in the soil containing selenium and cadmium is 2-6 mg / kg, and the cadmium content is 1-5 mg / kg.
9. Application of the Sultr1;2 gene in enhancing selenium enrichment and reducing cadmium in crops in selenium-cadmium-associated soils, characterized by, The coding region sequence of the Sultr1;2 gene is shown in SEQ ID NO.
1.
10. Application of N-ε-acetyl-L-lysine or N-ε-acetyl-L-lysine-binding Streptomyces in enhancing selenium enrichment and cadmium reduction in crops in soils with selenium and cadmium coexistence.