Primer for identifying hybrid between brassica rapa and erucaceae based on InDel technology and application thereof
By designing specific primer pairs to amplify the InDel molecular marker sequence, and combining PCR and gel electrophoresis, the problem of the complexity of identifying hybrids between Chinese cabbage and blue mustard was solved, achieving a simple and accurate hybrid identification effect.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SHANDONG AGRICULTURAL UNIVERSITY
- Filing Date
- 2026-04-10
- Publication Date
- 2026-06-16
AI Technical Summary
Existing technologies make it difficult to accurately and easily identify the authenticity of hybrids between Chinese cabbage and blue mustard. Morphological and cytological identification is complex, and molecular marker design is difficult and requires multiple primer pairs.
Design specific primer pairs (forward primer 5'-3': TCTTGCACAGTGTTGTGAACC, reverse primer 5'-3': TGCAAAAGTGGTCTCAGGCA) to amplify the InDel molecular marker sequence, and combine PCR and gel electrophoresis to observe the bands to determine the authenticity of the hybrid.
It enables a simple and accurate identification of the authenticity of hybrids between Chinese cabbage and blue mustard, reducing operational complexity and improving identification efficiency.
Smart Images
Figure CN122214528A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular breeding, specifically relating to a primer for identifying intergeneric hybrids of Chinese cabbage and blue mustard based on InDel technology and its application. Background Technology
[0002] Chinese cabbage, a crucial vegetable crop belonging to the Brassicaceae family and the Brassica genus, holds a significant position in my country's vegetable industry. Blue mustard, a herbaceous plant belonging to the Brassicaceae family and the Brassica genus, possesses strong adaptability, disease resistance, and stress tolerance, and is widely used in roadsides, slopes, and natural sites. Through distant hybridization, the superior stress-resistance traits of blue mustard can be transferred to Chinese cabbage and other cruciferous vegetables. However, accurately verifying the authenticity of hybrid offspring has become a critical issue that urgently needs to be addressed. Currently, morphological and cytological identification is commonly used to determine the authenticity of hybrid offspring. Although molecular markers are also used for identification, their design is difficult and sometimes requires two or more pairs of primers, making the process relatively complex.
[0003] InDels are molecular markers developed based on the insertion or deletion of short nucleic acid sequences in the genome. By designing specific primers to amplify these differentially expressed sites, and then detecting the length differences of the amplified products using techniques such as electrophoresis and sequencing, different genotypes can be distinguished. Currently, in the field of distant hybridization breeding, InDel molecular markers can conveniently and accurately identify the authenticity of distant hybrid offspring and are widely used. Summary of the Invention
[0004] To provide a molecular identification method for identifying intergeneric hybrids of Chinese cabbage and blue mustard, the present invention provides the following technology:
[0005] In a first aspect, the present invention provides an InDel molecular marker sequence for identifying intergeneric hybrids of Chinese cabbage and blue mustard, characterized in that the InDel molecular marker sequence is the Chinese cabbage sequence shown in SEQ ID NO:2 and the blue mustard sequence shown in SEQ ID NO:3.
[0006] Secondly, the present invention provides a primer pair for specifically amplifying the molecular marker sequence described in the first aspect, characterized in that,
[0007] Forward primer 5'-3': TCTTGCACAGTGTTGTGAACC (SEQ ID NO:4),
[0008] Reverse primer 5'-3': TGCAAAAGTGGTCTCAGGCA (SEQ ID NO:5).
[0009] Thirdly, the present invention provides a kit for identifying interspecific hybrids of Chinese cabbage and blue mustard, characterized in that the kit contains the InDel molecular marker sequence described in the first aspect and / or the primer pair described in the second aspect.
[0010] Furthermore, the kit also includes other reagents required for PCR amplification, including but not limited to DNA polymerase, dNTPs, and buffer.
[0011] Fourthly, the present invention provides the application of the molecular marker sequence described in the first aspect in the identification of intergenous hybrids of Chinese cabbage and blue mustard.
[0012] Fifthly, the present invention provides the application of the primer pairs described in the second aspect or the kit described in the third aspect in the identification of interspecific hybrids of Chinese cabbage and blue mustard.
[0013] Sixthly, the present invention provides a method for identifying intergeneric hybrids of Chinese cabbage and blue mustard, characterized in that the method comprises:
[0014] 1) Extract DNA from the sample. This sample was obtained by intergeneric hybridization of Chinese cabbage as the female parent and blue mustard as the male parent, and the material was rescued by embryo rescue.
[0015] 2) Amplification was performed using the following InDel1 primer pairs:
[0016] Forward primers 5'-3': TCTTGCACAGTGTTGTGAACC,
[0017] Reverse primer 5'-3': TGCAAAAGTGGTCTCAGGCA;
[0018] 3) Perform gel electrophoresis on the amplified product and observe the electrophoretic bands to determine the authenticity of the hybrid; wherein, the observation step includes the fact that when the sample shows both maternal and paternal bands, it confirms that a hybrid has been obtained.
[0019] Furthermore, the method also includes amplifying the maternal and paternal parents using the InDel primer pair.
[0020] Furthermore, the amplification conditions are as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, for 30-35 cycles.
[0021] Furthermore, the target of the InDel primer pair is located on the gene shown in SEQ ID NO:1.
[0022] Furthermore, the sample acquisition steps include: using Chinese cabbage '24D4' as the female parent and blue mustard as the male parent, after hybridization and pollination, taking the pods 7 days after pollination for embryo rescue. Attached Figure Description
[0023] Figure 1 Phenotypes of parents and distant hybrids at the seedling and rosette stages.
[0024] Figure 2 Determination of DNA content.
[0025] Figure 3 The results of identification of the maternal parent 24D4, the paternal parent blue mustard, and five hybrid offspring using Indel primers.
[0026] Figure 4 To verify the use of Indel primers for different Chinese cabbage female parents, blue mustard male parents, and hybrids. Detailed Implementation
[0027] To make the objectives, technical solutions, and advantages of this application clearer, the application will be further described in detail below with reference to the accompanying drawings. The described embodiments should not be regarded as limitations on this application. All other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this application.
[0028] Material
[0029] The female parent is Chinese cabbage, the male parent is blue mustard, and the hybrid is obtained through distant hybridization of Chinese cabbage and blue mustard.
[0030] These materials were provided by the Chinese cabbage breeding research group of the College of Horticulture Science and Engineering, Shandong Agricultural University, and were planted and managed in the horticultural experimental station of Shandong Agricultural University.
[0031] Equipment and reagents
[0032] The main experimental instruments include: a clean bench, a ploidy analyzer, an autoclave, a polymerase chain reaction apparatus, and a vertical plate electrophoresis apparatus.
[0033] Main experimental tools: light-proof spray bottle, tweezers, petri dishes, pipettes, absorbent paper, scalpels, centrifuge tubes, etc.
[0034] Main experimental reagents: distilled water, MS medium, etc.
[0035] Example 1: Distant hybridization
[0036] A hybrid cross was prepared using Chinese cabbage '24D4' as the female parent and blue mustard as the male parent. Two to three days before hybridization, the opened flowers on the male parent inflorescence were removed, and the plant was isolated by bagging. Healthy female parent plants were selected, their buds were removed, and the male and female flowers were demasked. The plants were then pollinated with blue mustard pollen, and the plants were isolated by bagging after pollination.
[0037] Example 2 Embryo rescue
[0038] Seven days after pollination, the pods were harvested and embryo rescued under aseptic conditions. Complete, plump, and undamaged pods were placed in appropriate beakers, clearly labeled with the material name or corresponding code. In a laminar flow hood, the pods were first surface-sterilized with 75% alcohol for 30 seconds, then sterilized with sodium hypochlorite for 8 minutes, followed by rinsing three times with sterilized distilled water within 10 minutes. The waste liquid was poured into a prepared waste liquid container. After rinsing, the pods were placed in petri dishes lined with filter paper using tweezers. The ovary was carefully cut along its midline with a scalpel, and the ovules inside were removed and placed evenly on the embryo rescue medium. The dishes were then sealed and placed in an incubator for dark, room-temperature culture. After approximately 20 days of culture, the emergence of new embryos could be observed. Petri dishes with emerging embryos were placed on a light-protected culture rack for further cultivation. Once the embryos had recovered and turned green, they were transferred to a subculture medium for subculture propagation to form tissue culture seedlings. The plants were then planted in pots and managed according to standard procedures, such as... Figure 1 As shown.
[0039] Example 3: Detection of plant DNA content
[0040] Take 0.2 g of fresh leaves from the parent plants and hybrid offspring as test samples, place them in a petri dish, and add 500 μL of nuclear lysis buffer from the CyStain UV Precise P kit around the sample. Chop the leaf with a sharp blade and extract for 60 seconds to ensure complete nuclei extraction. Filter the liquid from the petri dish through a 50 μm celltrics filter into a centrifuge tube. Add 2000 μL of DAPI fluorescent staining solution from the CyStain UV Precise P kit to the sample tube, stain in the dark for 2 minutes, and then test using a microcomputer. Results are as follows: Figure 2 As shown, the results indicate that the ploidy peak value of Chinese cabbage is 3.9, the ploidy peak value of blue mustard is 27, and the ploidy peak value of the hybrid is 7. Therefore, the tested hybrid is a true hybrid.
[0041] Example 4: Development and Identification of InDel Molecular Markers
[0042] Leaves from parents and F1 generation plants were collected, DNA was extracted, and libraries were constructed. High-throughput sequencing of the parents and their hybrid offspring was performed using the Illumina platform. After obtaining clean reads from high-throughput sequencing, the data was filtered to obtain clean data, which was then aligned with the Chinese cabbage reference gene (http: / / www.brassicadb.cn / # / Download / Bara_Chiifu_V3.5 / ) to obtain mapped data. Based on the positional information of the aligned genome reads, StringTie was used to assemble the reads into transcripts. The assembled transcripts were then compared with the genome annotation information using GffCompare. After detecting InDel using GATK, ANNOVAR was used to annotate the variant sites, obtaining the InDel analysis results and annotation information. The obtained InDel samples were first classified and analyzed. Subsequent analysis was conducted on sites where the maternal parent was the same as the reference genome Ref, the paternal parent had a base variation, and the same site showed heterozygosity in the hybrid. Primers were designed based on the sites, and one pair of primers was initially selected for subsequent experiments.
[0043] Table 1. Specific gene, location, and differentially expressed nucleic acid sequence information for InDel.
[0044] Chr Start End Gene A02 24850037 24851039 BraA02g037030.3.5C
[0045] Specifically, the InDel molecular marker is located in the fragment at the gene locus BraA02g037030.3.5C on chromosome A02. The reference genomic sequence of BraA02g037030.3.5C is shown in SEQ ID NO:1 below.
[0046] ACATTGTCTGTTTGATTCTGCTCCTCCGGTGCTACCAACACTTGTGGCATTGGGGGTAGTACCGAAAATGGAGGTCTTACTTGCTGATTCACACTTGAATGAACCTTTATATGTGATCTATCCCCATAGCTAGTGATCTCTTTAAGGTCTGGAATGTGACTTCTCCTGAAATATAGAGCATAGTCAATCCACAATTCAAAGCTTGCTTTCTTCTATGAATCCAAAAGAGAAAACCCAAAACAAGTTTCTCACCTTGGTTTCTTAGCAATAGGAGATTCACTTTCGACTTTGCAGGGTGCAGTAACACCATCTGGGAACAGGACTCTCTTGTTGTTTGAGTTCACAGAACAAGCAATACTATTCTCTTTAGCCATGGCTTCATACTTAGCTCTCT TCTTGCACAGTGTTGTGAACC TGTTCTTCACTGCATTATCAGTTCTACACAACAAACAAGAGAAGAACATTTTACCATCTATACTTTCATTTTCATAACTTGATTCATAAAAAGCTTTTCTTTATGTTCTCTAATAGATATATACC TGCCTGAGACCACTTTTGCA ATCTCAGTCCATCTGTTCCCAAACAGTCTCTGTGCCTAAAAAACCAAAACACAGAAAGATCAGACACAAACTCTTATGGGATTAAAAGAAAGATGTCTTGTCTAACCTCACACAAAAGAGTATCTTCTTCAGGAGTCCAACCACCTCTCTTGAAATCAGAGTTTAAGTATGTATACCATCTGCAAAACCAAAACCCCATGATCCGATTTAAAAAAAAAAAAAAACACCAGAAACAATCATCTTGATCAGTTTTAAACCAGACCTTCTTCTACACTGCCTTGTGCTCTTATCAGTAAACTTAGATGCAATGATCGCCCAACTGAGAAACCAATCAACACAACAACAACATCAGAATCAATAAAACAGAAAACTTTGTCCGAGAAACTGTAAGAAAGAAAAGAGACTAACTTTTGAGTTCCATTTAAAGTGATTTGCTGTCTG
[0047] Table 2
[0048]
[0049] PCR amplification was performed using genomic DNA from the parents and hybrids. The PCR program was: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, and 72℃ extension for 30 s, for 30-35 cycles. The 15 µL reaction mixture included: 0.5 µL DNA template, 0.5 µL each of forward and reverse primers, 7.5 µL PCR Mix, and 6 µL ddH2O.
[0050] The PCR product of Chinese cabbage was subjected to first-generation sequencing, and the sequence in Chinese cabbage is shown in SEQ ID NO:2.
[0051] ATCAGGGCTCAGTGTCAGAGATCCTTTCCTTCTACCTCGAGAAAGGACGTAAGTATAAAAGTTTCATGGATGAAAGTTCGTTTATCTTAGTTGATGAACTGATGATTCATTGTTTTATTTTAGTTAGCTTTATCAGCCAAGTTGAGATTCTCAGCGAAAGACTACAGTGACCATATGGCAA
[0052] The blue mustard PCR product was subjected to first-generation sequencing, and the sequence in blue mustard is shown in SEQ ID NO:3.
[0053] ATCAGGGCTCCGGGTCCGAGATCCTTTCCTTTTTCCTCCAGGCAAAAAGGAAGTAAGTAGAAGAATTCAAGGATAAATCTTTTGGGGTTTTTGGTAGAAGGATATAGTTAGAATTCTGGGGTTTAATCTCGCAAACTGAGAGAATATTTGGTTTTTTTCCTTCGTTTTCTTTTAGTTAGTTTTATCAGCCAAGTTGAAATTCTCGGAAAAAAACTACGGGGACCATATGGAAA
[0054] Polyacrylamide gel electrophoresis was performed at 110 V for 1 hour, followed by fixation, gel washing, silver staining, gel washing, development, and band observation. Results are as follows: Figure 3 As shown, the F1 generation of the hybrid exhibits specific bands from both the male and female parents, and the primers confirmed the authenticity of the hybrid. We verified the hybrid in different varieties of Chinese cabbage, blue mustard, and hybrids, and observed the banding results as follows. Figure 4As shown.
Claims
1. An InDel molecular marker sequence for identifying interspecific hybrids of Chinese cabbage and blue mustard, characterized in that, The InDel molecular marker sequences are the Chinese cabbage sequence shown in SEQ ID NO:2 and the blue mustard sequence shown in SEQ ID NO:
3.
2. A primer pair for specifically amplifying the molecular marker sequence of claim 1, characterized in that, Forward primer 5'-3': TCTTGCACAGTGTTGTGAACC (SEQ ID NO:4), Reverse primer 5'-3': TGCAAAAGTGGTCTCAGGCA (SEQ ID NO:5).
3. A kit for identifying intergeneric hybrids of Chinese cabbage and blue mustard, characterized in that, The kit contains the InDel molecular marker sequence of claim 1 and / or the primer pair of claim 2.
4. The application of the molecular marker sequence described in claim 1 in the identification of intergeneric hybrids of Chinese cabbage and blue mustard.
5. The application of the primer pair of claim 2 or the kit of claim 3 in the identification of intergeneric hybrids of Chinese cabbage and blue mustard.
6. A method for identifying intergenous hybrids of Chinese cabbage and blue mustard, characterized in that, The method includes: 1) Extract DNA from the sample. This sample was obtained by intergeneric hybridization of Chinese cabbage as the female parent and blue mustard as the male parent, and the hybrid material was obtained after embryo rescue. 2) Amplification was performed using the following InDel primer pairs: Forward primers 5'-3': TCTTGCACAGTGTTGTGAACC, Reverse primer 5'-3': TGCAAAAGTGGTCTCAGGCA; 3) Perform gel electrophoresis on the amplified product and observe the electrophoretic bands to determine the authenticity of the hybrid; wherein, the observation step includes confirming that a true hybrid has been obtained when both the maternal and paternal bands are present in the sample.
7. The method of claim 6, wherein, The method also includes amplification of the maternal and paternal parents using the InDel primer pair.
8. The method of claim 6, wherein, The amplification conditions are as follows: pre-denaturation at 94~96℃ for 2~5 min; denaturation at 94~96℃ for 25~40 s; annealing at 53~57℃ for 25~40 s; extension at 71~73℃ for 0.5~2 min; 30~35 cycles.
9. The method according to claim 6, characterized in that, Among them, Chinese cabbage '24D4' was used as the female parent and blue mustard as the male parent to prepare an intergeneric hybrid combination.