Use of cistanche in preparing medicine for promoting osteogenesis of alveolar bone

Abstract

This invention relates to the field of pharmaceutical technology, specifically disclosing the application of Cynomorium songaricum in the preparation of drugs that promote alveolar bone osteogenic formation. The key technical points are: the Cynomorium songaricum extract is prepared by hot reflux extraction with 65% ethanol, concentration, and vacuum freeze-drying, containing active ingredients such as catechins, proanthocyanidins C1, and astragaloside A. In vitro experiments have confirmed that 1 μg / mL of this extract can promote the proliferation and mineralization of MC3T3-E1 cells and upregulate the expression of ALP, Runx2, and OCN. In vivo experiments have confirmed that 0.4% of this extract can inhibit inflammation, reduce osteoclasts, improve alveolar bone microstructure, and reduce the levels of inflammatory factors such as IL-1β and TNF-α in a rat periodontitis model, without significant toxicity to major organs. This invention provides a new, safe, and effective treatment approach for alveolar bone resorption caused by periodontitis.

Description

Technical Field

[0001] This invention relates to the field of pharmaceutical technology, specifically to a new pharmaceutical use of Cynomorium songaricum, and particularly to the application of Cynomorium songaricum extract in the preparation of drugs that promote alveolar bone formation. Background Technology

[0002] Periodontitis is a chronic infectious disease characterized by inflammatory infiltration of periodontal tissues and progressive alveolar bone resorption, and is the leading cause of tooth loosening and loss in adults. Conventional clinical treatments mainly involve mechanical plaque removal and local antibacterial measures, but these often face technical challenges such as high recurrence rates of inflammation and limited bone tissue repair and regeneration. The fundamental reason is that these methods fail to effectively address the two interconnected core pathogenic links: inflammation and bone metabolism imbalance. Therefore, developing novel drugs with both anti-inflammatory and bone-repair-promoting functions, along with high safety, is a crucial technical problem urgently needing to be solved in this field.

[0003] Traditional Chinese medicine (TCM) possesses unique advantages in treating inflammatory diseases due to its synergistic effects involving multiple components and targets. Existing technologies have reported the use of TCM in the treatment of periodontitis. For example, Chinese patent application CN105560893A discloses a TCM composition for treating periodontitis, composed of more than twenty herbs including Scutellaria barbata, Drynaria fortunei, and Cynomorium songaricum, claiming to have the effects of tonifying the liver and kidneys, clearing heat and purging fire, and reducing inflammation and relieving pain.

[0004] However, the aforementioned existing technical solutions have significant limitations. First, their formulations are extremely complex, containing dozens of medicinal herbs, which poses significant challenges to drug quality control, chemical component identification, and large-scale standardized production. Second, the interactions between the active ingredients of the various herbs in this composition are unclear, and the specific pharmacodynamic material basis and target of action are not fully understood, making it difficult to elucidate its mechanism of action from a modern pharmacological perspective, thus limiting further scientific evaluation and clinical application. More importantly, in this compound, Cynomorium songaricum is used only as one of many components, and the literature does not provide any guidance or insight into its specific effects and mechanisms in treating periodontitis, particularly in promoting alveolar bone osteogenic regeneration. The actual contribution of Cynomorium songaricum in the compound is severely obscured and diluted.

[0005] Therefore, it is necessary to provide a new formulation or new use of Cynomorium songaricum extract with relatively clear components, a clear mechanism of action, and the ability to effectively inhibit inflammation and promote osteogenic regeneration of alveolar bone, so as to overcome the above-mentioned defects in the existing technology. Summary of the Invention

[0006] The purpose of this invention is to solve the technical problems mentioned in the background art above and to provide the application of Cynomorium songaricum in the preparation of drugs that promote alveolar bone osteogenicity.

[0007] The above-mentioned objective of the present invention is achieved as follows:

[0008] One aspect of the present invention provides the use of Cynomorium songaricum in the preparation of drugs that promote alveolar bone osteogenicity.

[0009] Furthermore, the Cynomorium extract is prepared by the following method:

[0010] The Cynomorium oxyphylla powder was extracted with 65% ethanol at 80℃ for 120 minutes by hot reflux at a material-to-liquid ratio of 1:12 g / mL. The extract was then filtered, concentrated, pre-frozen, and freeze-dried under vacuum to obtain the freeze-dried powder of Cynomorium oxyphylla extract.

[0011] Furthermore, the Cynomorium extract contains at least one component selected from sucrose, 4-hydroxyisoleucine, catechin, proanthocyanidin C1, gentianin, and astragaloside A.

[0012] Furthermore, the active ingredients in the Cynomorium extract include flavonoids and terpenoids, wherein the flavonoids include catechins and / or proanthocyanidins C1, and the terpenoids include astragaloside A.

[0013] Furthermore, the effective concentration of the Cynomorium extract in promoting osteogenic differentiation of MC3T3-E1 cells in vitro is 1 μg / mL.

[0014] Furthermore, the drug is administered via local injection or by gavage.

[0015] Furthermore, the concentration of the Cynomorium extract administered via local injection is 0.04% to 4%.

[0016] Furthermore, the concentration of the Cynomorium songaricum extract administered via local injection is 0.4%, which promotes alveolar bone osteoogenesis by inhibiting inflammatory infiltration in periodontal tissues, reducing the number of osteoclasts, upregulating the expression of ALP, Runx2, and OCN in periodontal tissues, downregulating RANKL expression, improving alveolar bone microstructure, and reducing serum levels of IL-1β, TNF-α, IL-6, and MMP9.

[0017] The present invention also provides a pharmaceutical composition for promoting alveolar bone osteogenic formation, comprising Cynomorium extract as an active ingredient, and a pharmaceutically acceptable carrier thereof.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] 1. This invention is the first to use the extract of Cynomorium songaricum, a single herb, to treat periodontitis and promote alveolar bone formation. Through UPLC-Q-TOF-MS technology, its core pharmacodynamic material basis has been identified as catechins, proanthocyanidins C1, astragaloside A, etc. This overcomes the inherent defects of existing compound techniques, which are characterized by unclear chemical composition, difficulty in quality control, and ambiguous mechanism of action due to the "mixing of dozens of medicinal materials". This invention is more in line with the requirements of modern drug safety, effectiveness, and quality control.

[0020] 2. This invention breaks through the existing technology, which mainly focuses on improving superficial symptoms such as "clearing heat and purging fire, reducing inflammation and relieving pain". It reveals for the first time the dual pharmacological activities of Cynomorium extract in inhibiting periodontal inflammation and directly promoting alveolar bone regeneration and repair. This holistic approach directly targets the core pathological link of "inflammation-bone" imbalance in periodontitis, and its comprehensiveness and depth of efficacy far exceed those reported in the literature.

[0021] 3. Through rigorous in vitro and in vivo experiments, this invention has for the first time clearly defined the effective concentration and dosage range of Cynomorium songaricum extract, with an optimal in vitro concentration of 1 μg / mL and an optimal in vivo concentration of 0.4% for local administration, and confirmed the existence of a clear dose-response relationship. This provides precise and scientific experimental data support for clinical translation and dosage regimen design, which cannot be achieved by the general "5-20 parts" formulation ratio in the existing technology.

[0022] 4. Through systematic in vivo animal experiments, this invention has confirmed that at therapeutically effective doses, the Cynomorium extract does not produce any toxic or pathological damage to major organs such as the heart, liver, spleen, lungs, and kidneys, demonstrating extremely high biocompatibility. This characteristic makes the Cynomorium extract a promising drug for long-term safe use and long-term management of chronic periodontitis, with broad prospects for clinical development and application. Attached Figure Description

[0023] Figure 1 The following are BPC and TIC chromatograms of different batches of Cynomorium songaricum under positive and negative ion modes (A: BPC chromatogram in positive ion mode; B: BPC chromatogram in negative ion mode; C: TIC chromatogram in positive ion mode; D: TIC chromatogram in negative ion mode).

[0024] Figure 2 Total ion chromatogram of Cynomorium songaricum BPC (A: positive ion mode; B: negative ion mode);

[0025] Figure 3 This image shows the qualitative identification of the main metabolites of Cynomorium songaricum.

[0026] Figure 4 The diagram shows the metabolite composition and abundance distribution of Cynomorium songaricum extract (A: Major metabolite categories; B: Abundance distribution of all identified compounds; C: Composition of sugars and glycosides; D: Composition of flavonoid active ingredients).

[0027] Figure 5 Venn diagram of the common target of Cynomorium songaricum and periodontitis;

[0028] Figure 6 PPI network and core target diagram for Cynomorium songaricum in the treatment of periodontitis (A: PPI network diagram; B: core target diagram);

[0029] Figure 7 Enrichment analysis of potential targets for Cynomorium songaricum in the treatment of periodontitis (A: GO enrichment analysis; B: KEGG pathway enrichment analysis).

[0030] Figure 8 A network diagram of "drug-component-target-pathway" for Cynomorium songaricum;

[0031] Figure 9 Figure showing the effect of Cynomorium songaricum extract on the proliferation of MC3T3-E1 cells;

[0032] Figure 10 A diagram showing the effect of Cynomorium songaricum extract on ALP expression in MC3T3-E1 cells (A: ALP staining results; B: ALP activity measurement results).

[0033] Figure 11 The effect of Cynomorium songaricum extract on the mineralization capacity of MC3T3-E1 cells (A: Alizarin Red staining results; B: Quantitative staining detection results).

[0034] Figure 12 Figure 1: Immunofluorescence staining to observe the expression of OCN protein in MC3T3-E1 cells (A: Staining results; B: Average fluorescence density analysis results).

[0035] Figure 13 Figure 1 shows the effect of Cynomorium songaricum extract on the expression level of osteogenic gene mRNA in MC3T3-E1 cells (A: ALP; B: Runx2; C: OCN).

[0036] Figure 14 Map showing the expression levels of osteogenic marker proteins in MC3T3-E1 cells using Western blot analysis (A: Western blot; B: Statistical graph of relative expression levels of each protein).

[0037] Figure 15 This is a schematic diagram illustrating the construction of an experimental rat model of periodontitis.

[0038] Figure 16 The graph shows the daily weight and weight gain of rats during the experimental period (A: daily weight change; B: daily weight gain).

[0039] Figure 17The graph shows the effects of Cynomorium songaricum extract on gingival bleeding index and probing depth in rats with periodontitis (A: daily probing depth trend; B: daily gingival bleeding index trend; C: PPD difference analysis at the end of the experiment).

[0040] Figure 18 Micro-CT images of the right maxilla and analysis of alveolar bone parameters (A: 3D and cross-sectional images; B: CEJ-ABC; C: BV / TV; D: Tb.Th; E: Tb.N; F: Tb.Sp).

[0041] Figure 19 HE staining and inflammation scoring diagram (A: staining results; B: inflammation score);

[0042] Figure 20 Masson staining and collagen fiber area percentage diagram (A: staining result; B: area percentage);

[0043] Figure 21 Image showing the results of Trap staining and positive osteoclast count (A: staining results; B: cell count).

[0044] Figure 22 Immunohistochemical staining results and quantitative analysis of ALP, Runx2, OCN, and RANKL (A: staining image; B: quantitative analysis);

[0045] Figure 23 The image shows the results of ELISA detection of rat serum levels (A: IL-1β; B: IL-6; C: TNF-α; D: MMP-9).

[0046] Figure 24 HE staining results of heart, liver, spleen, lung, and kidney tissues from each group of rats. Detailed Implementation

[0047] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0048] The implementation of the present invention will be described in detail below with reference to specific embodiments.

[0049] Example 1: Preparation and Chemical Constituent Identification of Cynomorium Extract

[0050] 1.1 Preparation process

[0051] Take dried Cynomorium songaricum, pulverize it, and pass it through a No. 2 pharmacopoeia sieve. Take the Cynomorium songaricum powder and add 65% ethanol at a material-to-liquid ratio of 1:12 g / mL. Extract by hot reflux in an 80℃ constant temperature water bath for 120 minutes. Filter the extract while hot using qualitative filter paper. Concentrate the filtrate under reduced pressure at 40-50℃ until no alcohol odor remains. Aliquot the concentrate into lyophilization bottles, pre-freeze at -80℃ for 4-6 hours, and then dry in a vacuum freeze dryer for 24 hours. Pulverize the resulting lyophilized product in a dry environment and pass it through a 60-80 mesh sieve to obtain the Cynomorium songaricum extract lyophilized powder. Aliquot and store at -20℃ for later use.

[0052] The main instruments and equipment used in this preparation process are shown in Table 1, and the reagents used are shown in Table 2.

[0053] Table 1 Main Instruments

[0054] name Place of origin Ultrasonic cleaning machine Shenzhen Fuyang Technology Group Co., Ltd. Vortex oscillator Shanghai Hanno Instrument Co., Ltd. Tabletop high-speed refrigerated centrifuge Shanghai Luxiangyi Centrifuge Instrument Co., Ltd. High Performance Liquid Chromatography Waters chromatographic column Waters PDA detector Waters High-resolution liquid chromatography-mass spectrometry Thermo

[0055] Table 2 Reagents required for UPLC-Q-TOF-MS analysis

[0056] name Place of origin methanol Thermo Fisher Scientific Acetonitrile Thermo Fisher Scientific Formic acid Thermo Fisher Scientific water pure water

[0057] 1.2 UPLC-Q-TOF-MS component identification

[0058] 1.2.1 Analytical Methods

[0059] The Cynomorium songaricum extract prepared in section 1.1 was analyzed for its complete components using ultra-high performance liquid chromatography-quadrupole time-of-flight mass spectrometry (UPLC-Q-TOF-MS). Chromatographic conditions: An ACQUITY UPLC BEH C18 column (100 mm × 2.1 mm, 1.7 μm) was used at 40 °C; mobile phase A was water containing 0.1% formic acid, and mobile phase B was acetonitrile; flow rate was 0.3 mL / min; injection volume was 1 μL. Mass spectrometry conditions: Electrospray ionization (ESI) source was used, with positive and negative ion switching modes, mass range m / z 100-1600, and MSE-independent acquisition mode was employed. Capillary voltage was 3 kV for positive ions / 2.5 kV for negative ions, cone voltage was 40 V, ion source temperature was 120 °C, desolvation gas temperature was 450 °C, and flow rate was 900 L / h. High-energy channel collision energy was set in a gradient mode of 20-45 V. Real-time quality calibration was performed using a mixed standard solution of sodium formate and leucine enkephalin (50 pg / mL) injected continuously at a flow rate of 5 μL / min.

[0060] 1.2.2 Identification and Composition Results

[0061] Repeatability test results as follows Figure 1As shown, the peak shape, elution time, and abundance distribution of the base peak chromatogram (BPC) and total ion chromatogram (TIC) of the three parallel samples in positive and negative ion modes are highly consistent, indicating that the system is stable and the data is reliable.

[0062] By analyzing the total ion chromatogram ( Figure 2 Secondary mass spectrometry fragmentation analysis was performed on the chromatographic peaks in the sample, and the results were compared with the Metlin and HMDB databases, resulting in the precise identification of 10 key metabolites. Figure 3 Its retention time ranges from 0.87 to 7.57 min, and it contains sucrose, 4-hydroxyisoleucine, catechins, proanthocyanidins C1, gentianin, astragaloside A, etc., covering multiple categories such as sugars, amino acids, polyphenols, organic acids, and triterpenoid saponins.

[0063] The results of the analysis of metabolite composition and abundance distribution are as follows: Figure 4 As shown, in terms of activity category, terpenes account for 19.80%, flavonoids for 17.45%, and phenylpropanoids for 10.18%, forming the core material basis for their pharmacological effects. Figure 4 A). Abundance distribution showed that the extract exhibited the characteristics of "high abundance of basic components + low abundance of high-activity components," with sucrose having the highest content (12.75%). Among the active components, proanthocyanidin C1 had the highest content (9.66%), while astragaloside A content was 3.80%. Figure 4 B). Among carbohydrates and glycosides, sucrose accounts for 48.69%, and mesobiose accounts for 25.96%, together making up 74.65% of the total content of this category. Figure 4 C). Among the active flavonoid components, catechins account for 24.04% and proanthocyanidins C1 account for 22.26%, making them the most important flavonoid components, together accounting for nearly 50% of the total flavonoids. Figure 4 D).

[0064] Example 2: Network pharmacology predicts the mechanism by which Cynomorium songaricum promotes alveolar bone osteogenic formation.

[0065] To predict the molecular mechanism by which Cynomorium songaricum extract promotes alveolar bone osteoogenesis, network pharmacology was used for analysis.

[0066] 2.1 Target Screening and PPI Network Construction

[0067] Using the TCMSP database, effective components of Cynomorium songaricum were screened based on oral bioavailability (OB) ≥30% and drug-likeness (DL) ≥0.18. Periodontitis-related disease targets were then obtained by combining data from GeneCards, DisGeNET, and other databases. The intersection of Cynomorium songaricum component targets and periodontitis disease targets yielded 214 common targets, as shown in the Venn diagram. Figure 5The 214 potential targets were imported into the STRING database, with the species set as "Homo sapiens" and a confidence level > 0.4. Free nodes were hidden, and a protein-protein interaction (PPI) network was constructed. Figure 6 A). Topological analysis was performed using Cytoscape software to calculate parameters such as connectivity, betweenness centrality, and tight centrality, identifying the top 8 core targets based on connectivity, including AKT1, ALB, EGFR, MMP9, SRC, NFkB1, HIF1α, and PPARG. Figure 6 (B) These targets play a key regulatory role in the network.

[0068] 2.2 Functional and Pathway Enrichment Analysis

[0069] GO functional enrichment analysis and KEGG pathway enrichment analysis were performed on 214 intersecting targets using the DAVID platform, with a p-value <0.05 used for screening. GO analysis results ( Figure 7 A) showed that a total of 2074 biological processes, 113 cellular components, and 207 molecular functions were enriched. Regarding biological processes, targets were significantly enriched in items related to positive regulation of cell motility and cell migration; regarding cellular components, they were mainly distributed in regions such as cytoplasmic vesicles and secretory granule cavities; regarding molecular functions, they were enriched in protein kinase activity, protein serine / threonine kinase activity, and protein tyrosine kinase activity. KEGG pathway analysis results ( Figure 7 B) shows that the target is significantly enriched in signaling pathways such as PI3K-Akt, HIF-1, Rap1 and Focal adhesion, which are closely related to inflammatory responses, cell migration and bone metabolism regulation.

[0070] 2.3 Construction of the "Drug-Component-Target-Pathway" Network

[0071] Integrating the above information, a "drug-component-target-pathway" network diagram was constructed using Cytoscape 3.10.0 software. Figure 8 The paper visually demonstrates that multiple active ingredients in Cynomorium songaricum, such as catechins and astragaloside A, can exert the potential for synergistic treatment of periodontitis through "multi-component-multi-target-multi-pathway" by acting on multiple targets such as AKT1 and MMP9 and regulating multiple pathways such as PI3K-Akt.

[0072] Example 3: In vitro pharmacodynamic experiment of Cynomorium songaricum extract in promoting osteogenic differentiation

[0073] The main instruments and equipment used in this embodiment are shown in Table 3, and the cell culture-related reagents are shown in Table 4.

[0074] Table 3 Main Instruments

[0075] name Place of origin constant temperature incubator Huangshi Hengfeng Medical Equipment Co., Ltd., China optical microscope Olympus, Japan MILLI-Q Ultrapure Water Preparation System Millipore, USA Microplate reader (Multiskan GO) Thermo Fisher Scientific, USA High-speed low-temperature centrifuge Eppendorf, Germany low-speed refrigerated centrifuge Eppendorf, Germany ice maker Scotsman, USA Carbon dioxide cell incubator Thermo, USA Clean bench Thermo, USA Phase contrast inverted microscope Olympus, Japan Various range pipettes Eppendorf, Germany -80℃ refrigerator Thermo, USA -20℃ / 4℃ Dual-polar Refrigerator Haier, China Pressure steam sterilizer WG-C, Weigao Gel imaging system BIO-RAD, USA PowerPac Basic Electrophoresis System bio-rad, USA

[0076] Table 4 Reagents related to cell culture

[0077] name Place of origin fetal bovine serum EXCELL, Uruguay α-MEM complete culture medium Gibco, USA Osteogenic induction culture medium Pronosai, China Phosphate-buffered saline (PBS) buffer Servicebio, China Penicillin and streptomycin BI, Israel 0.25% trypsin solution Gibco, USA Serum-free cryopreservation solution Servicebio, China

[0078] 3.1 Cell proliferation activity assay (CCK-8 assay)

[0079] MC3T3-E1 cells in logarithmic growth phase were harvested, digested with trypsin, and counted; the concentration was adjusted to 4 × 10⁻⁶. 4 Cells were seeded at a rate of 100 μL (4000 cells) per well in a 96-well plate. After culturing for 12 hours to allow for full cell adhesion, the culture medium was discarded. The experimental groups were replaced with complete culture medium containing different concentrations of Cynomorium songaricum extract (62.5 ng / mL, 125 ng / mL, 250 ng / mL, 500 ng / mL, 1 μg / mL, 2 μg / mL, 4 μg / mL, 8 μg / mL), while the negative control group was replaced with drug-free complete culture medium. A blank control group (no cells, only complete culture medium) was also included. Each group had 6 replicates. 24 hours after drug intervention, the culture medium was discarded, and 10 μL of a mixture of CCK-8 and 90 μL of basal culture medium was added to each well. The plates were incubated in the dark for 2 hours, shaken for 1 minute, and the absorbance was measured at 450 nm.

[0080] The results are as follows Figure 9 As shown, compared with the control group, the Cynomorium songaricum extract at concentrations of 0.25–1 μg / mL significantly promoted cell proliferation. The 1 μg / mL group showed the highest proliferative effect, with a 1.52-fold increase in cell proliferation rate (P<0.001). When the concentration reached 2 μg / mL, cell viability decreased compared to the 1 μg / mL group (P<0.05). Therefore, 1 μg / mL was selected as the maximum dose for subsequent experiments, and 0.25 and 0.5 μg / mL were added as lower dose groups.

[0081] 3.2 Detection of Alkaline Phosphatase (ALP) Activity and Mineralization Capacity

[0082] 3.2.1 ALP staining and activity assay

[0083] MC3T3-E1 cells were planted at a density of 2 × 10⁶ cells per well. 4Ingredients were seeded at a density of [number] cells / wells in 12-well plates and cultured for 24 hours until fully adherent. Groups were set up as follows: blank control group (complete culture medium), negative control group (osteogenic induction medium), and experimental groups (osteogenic induction medium containing 0.25, 0.5, and 1 μg / mL *Cistanche deserticola* extract), with 3 replicates per group. The plates were incubated at 37℃ and 5% CO2 for 14 days, with medium changes every 2-3 days. After incubation, the plates were washed with PBS, fixed with 4% paraformaldehyde for 10-15 minutes, stained with BCIP / NBT, and observed and photographed under a microscope. ALP activity was quantified using the pNPP method, and protein concentration was determined using the BCA method. Standard preparation is shown in Table 5.

[0084] Table 5. Gradient dilution of BSA standards

[0085] Centrifuge tube number Standard (μL) PBS (μL) Protein concentration (mg / mL) 1 20 0 0.5 2 18 2 0.45 3 16 4 0.4 4 14 6 0.35 5 12 8 0.3 6 8 12 0.2 7 4 16 0.1 8 0 20 0

[0086] The results are as follows Figure 10 As shown in Figure A, ALP staining deepened with increasing concentration of Cynomorium songaricum extract. Quantitative results showed ( Figure 10 B), compared with the negative control group, the ALP activity in the 1 μg / mL group was significantly increased by 1.37 times (P<0.05), indicating that the extract of Cynomorium songaricum can promote the early osteogenic differentiation of MC3T3-E1 cells in a concentration-dependent manner.

[0087] 3.2.2 Alizarin Red (ARS) Staining and Quantitative Mineralization

[0088] Cell seeding and grouping administration were the same as in 3.2.1, and cells were cultured for 21 days to induce mineralization. After culture, alizarin red staining was performed, and the stained nodules were dissolved using hexadecylpyridine chloride for quantification.

[0089] like Figure 11 As shown in Figure A, no calcium nodules formed in the blank control group. With increasing concentration of Cynomorium extract, the deposition of red calcium nodules significantly increased and deepened. Quantitative analysis showed ( Figure 11 B), the calcium deposition in the 1 μg / mL group was significantly increased by 2.23 times compared with the negative control group (P<0.001), confirming that the extract of Cynomorium songaricum can promote late-stage osteoblast mineralization in a concentration-dependent manner.

[0090] 3.3 Detection of osteogenic-related gene and protein expression

[0091] Further validation was performed at multiple levels, including protein localization, gene transcription, and protein translation, using immunofluorescence, RT-qPCR, and Western blot techniques. Antibody information for Western blot is shown in Table 6, and primer sequences for RT-qPCR are shown in Table 7.

[0092] Table 6 Western Blot Antibodies

[0093] Reagent Name Item number company ALP 13365-1-AP Wuhan Sanying, China Runx2 20700-1-AP Wuhan Sanying, China OCN 59757 CST, United States GAPDH 10494-1-AP Wuhan Sanying, China Goat anti-rabbit IgG H&L (HRP) RS0002 Immunoway, China

[0094] Table 7 Primer Sequences

[0095] Gene Upstream primer (5'-3') Downstream primer (5'-3') ALP FTCATTCCCACGTTTTCACATTC RGTTGTTGTGAGCGTAATCTACC Runx2 FCCCAGCCACCTTTACCTACA RTATGGAGTGCTGCTGGTCTG OCN FAGCAGCTTGGCCAGACACTA RTAGCGCCGGAGTCTGTTCACTAC GAPDH FAACTTTGGCATTGTGGAAGG RGGATGCAGGGATGATGTTCT

[0096] 3.3.1 Immunofluorescence detection of OCN protein

[0097] Cells were seeded in confocal microplates and treated with different concentrations of Cynomorium songaricum extract (0.25, 0.5, and 1 μg / mL) for 7 days. A Blank group (α-MEM complete medium) and a Control group (osteogenic induction medium) were established. After washing with PBS, cells were fixed with 4% paraformaldehyde at room temperature for 15 minutes, permeabilized with 0.1% Triton X-100 at room temperature for 10 minutes, and blocked with 3% BSA at room temperature for 30 minutes. Cells were incubated overnight at 4°C with OCN primary antibody (1:200), washed with TBST, and incubated at room temperature for 1 hour in the dark with fluorescent secondary antibody (1:200). Nuclei were stained with DAPI for 5 minutes, mounted with anti-fluorescence quenching mounting medium, and observed and images were acquired under a fluorescence microscope.

[0098] The results are as follows Figure 12 As shown in Figure A, the green fluorescence intensity of OCN increases with increasing drug concentration. Quantitative analysis of the average fluorescence density shows ( Figure 12 B), the fluorescence intensity of the 1 μg / mL group was 1.16 times higher than that of the control group, and the difference was statistically significant (P<0.001).

[0099] 3.3.2 RT-qPCR detection of gene expression

[0100] After cell groups were treated with 1 μg / mL of Cynomorium songaricum extract, total RNA was extracted using a Takara RNA extraction kit. Purity was confirmed by an A260 / A280 ratio between 1.8 and 2.2. A two-step reverse transcription method was used: first, genomic DNA was removed by incubation at 42°C for 2 minutes with gDNA Eraser; second, PrimeScript RT Enzyme Mix and other reagents were added, and the mixture was incubated at 37°C for 15 minutes followed by 85°C for 5 seconds to complete the reverse transcription. qPCR was performed using TB Green Premix Ex Taq II with a two-step program: 95°C pre-denaturation for 30 seconds; 95°C for 5 seconds, 65°C for 30 seconds, for a total of 40 cycles. The relative expression levels of each target gene were calculated using the 2⁻△△Ct method.

[0101] The results are as follows Figure 13 As shown, the mRNA expression levels of ALP, Runx2, and OCN in the 1 μg / mL Cynomorium extract treatment group were upregulated by 2.92-fold, 1.7-fold, and 1.5-fold, respectively, compared with the control group.

[0102] 3.3.3 Western blot detection of protein expression

[0103] Take MC3T3-E1 cells in logarithmic growth phase, and divide them into groups of 5 × 10⁶ cells per well. 5 Samples were inoculated into six-well plates. Group setup: Blank group (α-MEM complete medium), Control group (osteogenic induction medium), and experimental group (osteogenic induction medium containing 0.25, 0.5, and 1 μg / mL *Cistanche deserticola* extract, respectively). After 24 hours of culture, total protein was extracted by lysis on ice using RIPA lysis buffer containing protease and phosphatase inhibitors. After quantification using the BCA method, the concentrations of each sample were adjusted to be consistent, and 5× loading buffer was added at a 1:4 ratio. Denaturation was performed at 100°C for 10 minutes. 10% SDS-PAGE gel electrophoresis was performed (80V stacking gel, 100V separating gel), and the membrane was transferred to a PVDF membrane at a constant current of 200mA for 90 minutes. After blocking with rapid blocking buffer for 30 minutes, the membrane was incubated overnight at 4°C with primary antibodies of ALP (1:20000), Runx2 (1:1000), OCN (1:1000), and GAPDH (1:5000), respectively, with shaking. After washing with TBST, the membrane was incubated with HRP-labeled secondary antibody (1:5000) at room temperature for 2 hours. Chemiluminescence imaging was performed using ECL, images were acquired using a gel imaging system, and the grayscale values ​​of the bands were analyzed using ImageJ software.

[0104] The results are as follows Figure 14 As shown in Figure A, the protein bands in the 1 μg / mL drug treatment group were significantly darker than those in the control group. (Grayscale analysis quantitative results) Figure 14 B) shows that the protein expression levels of ALP, Runx2, and OCN increased by 2.24-fold, 1.48-fold, and 1.62-fold, respectively, consistent with the results at the gene level.

[0105] Example 4: In vivo efficacy experiment of Cynomorium songaricum extract in treating periodontitis and promoting alveolar bone formation.

[0106] The main instruments required for this part of the experiment are shown in Table 8, and the ELISA kit information is shown in Table 9.

[0107] Table 8 Main Instruments

[0108] name Place of origin tissue dehydrator Seville, China Paraffin embedding machine Seville, China Pathology slide machine Seville, China Microplate reader (Multiskan GO) Thermo Fisher Scientific, USA High-speed low-temperature centrifuge Eppendorf, Germany optical microscope Olympus, Japan Cryo slicer Apudi, China Organizing the paver Seville, China vortex mixer Seville, China Pressure steam sterilizer WG-C, Weigao

[0109] Table 9 ELISA Detection Kits

[0110] detection indicators brand Rat IL-6 ELISA Kit Wuhan Sanying, China Rat MMP-9 ELISA Kit Elabscience, China Rat TNF-α ELISA Kit Elabscience, China Rat IL-1β ELISA Kit Elabscience, China

[0111] 4.1 Animal model establishment, grouping, and drug administration

[0112] Forty-eight male SD rats aged 6-8 weeks, weighing 180-200g, were used and acclimatized for one week. They were randomly divided into 8 groups of 6 rats each using a random number table. The specific grouping and intervention methods are shown in Table 10.

[0113] Table 10 Grouping of experimental animals and intervention methods

[0114] Group code Intervention methods negative control group NG No tubal ligation or medication used. Periodontitis model group EP Periodontal ligation only, without medication Glycerol solvent control group GG Glycerin applied topically after periodontal ligation minocycline hydrochloride group MC After ligation, apply 2% minocycline hydrochloride locally. Low concentration Cynomorium extract group CSEL After periodontal ligation, apply 0.04% Cynomorium extract topically. medium concentration of Cynomorium songaricum extract group CSEM After periodontal ligation, apply 0.4% Cynomorium extract topically. High concentration of Cynomorium songaricum extract group CSEH Topical application of 4% Cynomorium extract after periodontal ligation Cynomorium extract gavage group IG 0.4% Cynomorium extract administered by gavage after periodontal ligation

[0115] Except for the NG group, experimental periodontitis models were established in the other seven groups of rats using the silk ligation method. Modeling method: Silk sutures soaked in *Porphyromonas gingivalis* (Pg) bacterial solution were used to ligate the neck of the right maxillary first molar (M1), as shown in the image. Figure 15 As shown. To prevent the ligatures from coming loose or coming off, the condition of the ligatures is checked before each daily intervention, and they are re-ligated if necessary.

[0116] From the first day after ligation, intervention was carried out according to the grouping protocol: Each local drug administration group (GG, MC, CSEL, CSEM, CSEH) injected the corresponding drug into the M1 gingival sulcus daily using a dedicated periodontal syringe at a dose of 50 μL / tooth, maintaining the injection for 3 minutes to ensure adequate drug adhesion; the IG group received 0.4% Cynomorium extract solution by gavage at 10 mL / kg body weight. All drug interventions were performed once daily for 2 weeks. In the EP group, only the integrity of the ligation suture was checked.

[0117] 4.2 Clinical Indicator Observation

[0118] During the experiment, changes in rat body weight, activity level, and food intake were recorded daily. Figure 16 As shown, the body weight of rats in the NG and EP groups showed a steady increasing trend throughout the experiment. The GG group and all drug intervention groups experienced a slight decrease in body weight. This was attributed to the lubricating and laxative effect of the glycerol carrier, which led some rats to ingest glycerol during administration, but this had no significant impact on their overall health.

[0119] The gingival bleeding index (GBI, 0-5 scoring standard) and periodontal probing depth (PPD) were measured daily using a modified periodontal probe (tip radius 0.2 mm). The measurement sites were the mesial buccal, distal buccal, and central buccal sides of the right maxillary first molar.

[0120] The GBI scoring criteria are as follows: 0 points: The gingival margin and gingival papillae appear healthy, with no bleeding upon gentle probing; 1 point: Mild inflammation of the gingival margin and gingival papillae, with no bleeding upon gentle probing; 2 points: Mild inflammation of the gingival margin and gingival papillae, with color changes visible upon gentle probing, but no edema or pinpoint bleeding; 3 points: Moderate inflammation of the gingival margin and gingival papillae, with color changes and mild edema, bleeding upon gentle probing but without overflowing the gingival sulcus; 4 points: Severe inflammation of the gingival margin and gingival papillae, with color changes and significant edema, bleeding upon gentle probing and overflowing the gingival sulcus; 5 points: Severe inflammation of the gingival margin and gingival papillae, with color changes and severe edema, bleeding or spontaneous bleeding upon gentle probing, ulceration, and blood flowing from the gingival sulcus.

[0121] The results are as follows Figure 17 As shown in A and 17B, the GBI and PPD scores of both the EP and GG groups remained high throughout the experimental period, with no significant difference between the two groups, indicating that glycerol solvent had no significant effect on the development of periodontitis. Clinical symptoms in all treatment groups containing Cynomorium songaricum extract and the positive control group (MC) improved significantly over time. At the end of the experiment ( Figure 17 (C) The PPD value of the CSEM group was the lowest among all treatment groups, and its effect was better than or equivalent to that of the MC group.

[0122] 4.3 Micro-CT assessment of alveolar bone microstructure

[0123] On day 14 of the experiment, rats underwent Micro-CT scans of the jaw region after anesthesia. Scanning parameters: tube voltage 55 kVp, tube current 200 μA, filter 0.5 mm Al, CT value correction based on 1200 mg HA / cm³, image matrix 3072 × 3072, field of view 20 mm, resolution 6.6 μm, exposure time 250 ms. Three-dimensional reconstruction was performed using NRecon software after scanning. Figure 18 A). The distance from the cementoenamel junction to the alveolar ridge crest (CEJ-ABC) was measured, with three sites selected for each sample and the average value taken. Within the defined region of interest (ROI): using the first molar CEJ coronally 0.5 mm as the reference line, extending 1 mm vertically towards the apex, 3 mm mesiodistally, and 2.5 mm buccally and palatally, bone microstructure parameters were extracted: bone volume fraction (BV / TV), trabecular thickness (Tb.Th), number of trabecular bones (Tb.N), and trabecular separation (Tb.Sp).

[0124] CEJ-ABC measurement results ( Figure 18 B) showed that the distance from the alveolar ridge crest to the cementoenamel junction was significantly increased in the EP group, while it was significantly shortened in the CSEM group (P<0.05). Bone microstructure parameter analysis ( Figure 18The CF study showed that, compared with the EP group, CSEM treatment significantly increased BV / TV, Tb.Th, and Tb.N, and significantly decreased Tb.Sp, with all indicators approaching the levels of the negative control group (NG) and the positive control group (MC). This indicates that 0.4% Cynomorium extract can effectively inhibit alveolar bone resorption and promote bone remodeling.

[0125] 4.4 Histopathological Analysis

[0126] After the experiment, rats were euthanized, and whole blood was collected from the abdominal aorta. Serum was separated for subsequent testing. The heart, liver, spleen, lungs, kidneys, and right maxilla were dissected and separated. The maxilla was fixed in 4% paraformaldehyde for 24 hours, rinsed with running water, decalcified with 5% EDTA decalcification solution (the decalcification solution was changed weekly until complete decalcification), fixed and rinsed again, and then embedded in paraffin. 5μm thick sections were continuously cut from the sagittal plane using a microtome, and after dewaxing and hydration, they were stained with HE, Masson, and TRAP, respectively.

[0127] 4.4.1 HE staining

[0128] Stain the sections with hematoxylin for 15 minutes, differentiate with 1% hydrochloric acid and ethanol for 1-3 seconds, return to blue with PBS, stain with eosin for 4 minutes, dehydrate with graded ethanol, clear with xylene, and mount with neutral resin.

[0129] like Figure 19 As shown in Figure A, the EP group exhibited typical pathological features of periodontitis: receding gingival papillae below the cementoenamel junction, decreased alveolar ridge height, periapical migration of junctional epithelium forming periodontal pockets, disordered and partially broken gingival collagen fibers, accompanied by extensive infiltration of inflammatory cells, primarily neutrophils and lymphocytes, and obvious bone resorption lacunae visible at the alveolar ridge crest. In contrast, the CSEM group showed significantly reduced inflammatory infiltration, with only mild to moderate inflammatory cell infiltration, and relatively intact alveolar bone structure. Inflammation scores were assigned to each group (…). Figure 19 B), the scores of the CSEM group were significantly lower than those of the EP and GG groups (P<0.05).

[0130] 4.4.2 Masson staining

[0131] Sections were stained with Weigert iron hematoxylin for 5-10 minutes, Ponceau S and acid fuchsin for 5-10 minutes, treated with 1% phosphomolybdic acid for 3-5 minutes, counterstained with aniline blue for 3-5 minutes, treated with 1% glacial acetic acid for 1 minute, dehydrated, cleared, and mounted. Under a light microscope, collagen fibers appeared blue, muscle fibers / cytoplasm appeared red, and cell nuclei appeared blue-black.

[0132] The results are as follows Figure 20As shown, in the NG group, the collagen fibers in the periodontal tissue were uniformly stained, regularly arranged, and structurally intact. In the EP group, the collagen fiber staining was significantly weakened, the arrangement was disordered, the continuity was disrupted, and the periodontal ligament structure was loose. Compared with the EP group, the collagen fiber staining intensity in the CSEM group was enhanced, and the arrangement tended to be more regular, indicating that it can improve the connective tissue destruction caused by periodontitis to a certain extent.

[0133] 4.4.3 TRAP staining

[0134] Sections were incubated with TRAP staining solution (containing Quick Red TR saline solution, sodium nitrite solution, AS-BI substrate solution, acetate buffer, and tartaric acid solution) at 37°C in the dark for 1 hour, followed by hematoxylin counterstaining for 2 minutes. Under a light microscope, TRAP-positive cells showed purplish-red cytoplasm and blue nuclei. Mature osteoclasts containing ≥3 nuclei were selected from the bone surface. Three high-power fields were randomly selected from the alveolar ridge crest region for single-blind counting, and the mean value was used.

[0135] The results are as follows Figure 21 As shown, the EP group had the highest number of osteoclasts on the alveolar bone surface. Compared with the EP group, the CSEM group had a significantly reduced number of TRAP-positive cells (P<0.05), indicating that Cynomorium extract can effectively inhibit the generation and activity of osteoclasts in vivo.

[0136] 4.5 Immunohistochemical detection of bone metabolism-related protein expression

[0137] Immunohistochemical staining was performed on periodontal tissue sections to detect the protein expression of osteogenic markers (ALP, Runx2, OCN) and osteoclast markers (RANKL). After dewaxing and hydration, the sections were incubated with 3% H2O2 at room temperature for 15 minutes to inactivate endogenous peroxidase, followed by antigen retrieval at 95-100℃ for 10 minutes with citrate buffer, and then blocked with 5% BSA at 37℃ for 30 minutes. The sections were then incubated with the corresponding primary antibody overnight (no more than 16 hours) in a humidified chamber at 4℃ in the dark, followed by incubation with HRP-labeled secondary antibody at 37℃ for 30 minutes, DAB staining for 1-2 minutes, counterstaining with hematoxylin, and then dehydrated, cleared, and mounted. Images were acquired under a light microscope, with localization at ×100x and three randomly selected fields of view at ×200x. The average optical density was calculated using ImageJ.

[0138] The results are as follows Figure 22 As shown in Figure A, ALP, Runx2, and OCN positive staining (brownish-yellow) was mainly distributed on the alveolar bone surface and in osteoblasts and bone matrix surrounding trabeculae, while RANKL positive signal was mainly located in osteoblasts and inflammation-related areas. The EP group showed lower expression of ALP, Runx2, and OCN, while RANKL expression was higher. Compared with the EP group, the CSEM group showed significantly deeper and wider distribution of ALP, Runx2, and OCN positive staining, while RANKL positive staining was significantly weakened. Quantitative analysis of mean optical density (...) Figure 22B) The above trend was confirmed to be statistically significant (P<0.05), indicating that Cynomorium extract can upregulate osteogenic factors and downregulate osteoclast-related signals at the protein level, thus regulating bone metabolism balance through a dual pathway.

[0139] 4.6 Detection of serum inflammatory factor levels

[0140] The levels of IL-1β, TNF-α, IL-6, and MMP-9 in the serum of rats in each group were detected by ELISA. The experiments were strictly performed according to the instructions of each kit: standard curves were prepared by serial dilution of standards (final concentrations of 250, 125, 62.5, 31.25, 15.63, 7.81, and 0 ng / mL), and 100 μL of each was added and incubated at 37°C for 90 minutes; 100 μL of biotinylated antibody working solution was added and incubated at 37°C for 1 hour; the plate was washed 3 times; 100 μL of HRP enzyme conjugate working solution was added and incubated at 37°C for 30 minutes; the plate was washed 5 times; 90 μL of TMB substrate was added and incubated at 37°C in the dark for 15 minutes; 50 μL of stop solution was added to terminate the reaction; the OD value was measured at 450 nm, and the serum concentrations of each factor were calculated.

[0141] The results are as follows Figure 23 As shown, compared with the NG group, the serum levels of IL-1β, TNF-α, IL-6, and MMP-9 in the EP and GG groups were significantly increased (P<0.05). In contrast, the levels of these four pro-inflammatory and matrix degradation factors were significantly decreased in the CSEM group (P<0.05), indicating that Cynomorium songaricum extract can not only improve local periodontal inflammation but also effectively reduce systemic inflammation levels, providing a more favorable microenvironment for periodontal tissue repair.

[0142] 4.7 Biosafety Assessment

[0143] Paraffin sections and HE staining were performed on the heart, liver, spleen, lung, and kidney tissues of rats in each group for observation.

[0144] The results are as follows Figure 24 As shown, compared with the negative control group (NG), the organ tissues of all Cynomorium songaricum extract treatment groups (CSEL, CSEM, CSEH, IG) showed intact and clear tissue structures and normal cell morphology. No obvious fatty degeneration or hepatocyte necrosis was observed in the liver tissue; the glomeruli and renal tubules were intact; the alveolar structure was clear; the myocardial fibers were regularly arranged; and the white and red pulp structures of the spleen were clearly demarcated. No obvious inflammatory cell infiltration, tissue necrosis, fibrosis, or structural destruction was observed in any organ. This indicates that within the dosage and treatment period used in this experiment, Cynomorium songaricum extract had no toxic effects on the major organs of rats and possessed good biosafety.

[0145] In summary, Example 1, through a specific 65% ethanol hot reflux extraction process combined with UPLC-Q-TOF-MS technology, for the first time accurately elucidated the material basis of the osteogenic activity of Cynomorium songaricum, clarifying that its core pharmacodynamic components are flavonoids represented by catechins and proanthocyanidins C1, and terpenoids represented by astragaloside A. This fundamentally overcomes the long-standing technical blind spot in existing compound techniques of "knowing only that Cynomorium songaricum was used, but not knowing what else is effective," making quality control and efficacy evaluation possible. Secondly, the network pharmacology study in Example 2, for the first time, predicted and revealed at the molecular network level the unique mechanism by which these core components exert "anti-inflammatory-osteogenic" dual activities by acting on key targets such as AKT1 and MMP9 and synergistically regulating the PI3K-Akt signaling pathway, providing a precise mechanistic hypothesis for pharmacological experiments. Building upon this foundation, the in vitro cell experiments in Example 3 and the in vivo animal experiments in Example 4, respectively, at the cellular, tissue, organ, and whole animal levels, provided conclusive quantitative data (e.g., 1 μg / mL increased cell mineralization by 2.23 times, and a 0.4% concentration restored alveolar bone BV / TV to near-normal levels). These results confirmed that the extract possesses dual efficacy in inhibiting inflammation, suppressing bone resorption, and directly promoting bone regeneration, and exhibits no toxicity or damage to major organs such as the heart, liver, spleen, lungs, and kidneys. This represents a significant breakthrough in modern drug development rooted in traditional Chinese medicine, enabling the use of a single-herb extract of Cynomorium songaricum with clearly defined components, a well-defined mechanism, and safe and effective efficacy to precisely promote alveolar bone osteogenic regeneration.

[0146] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. Application of Cynomorium songaricum in the preparation of drugs that promote alveolar bone osteogenicity.

2. The application according to claim 1, characterized in that, The Cynomorium extract was prepared by the following method: The Cynomorium oxyphylla powder was extracted with 65% ethanol at 80℃ for 120 minutes by hot reflux at a material-to-liquid ratio of 1:12 g / mL. The extract was then filtered, concentrated, pre-frozen, and freeze-dried under vacuum to obtain the freeze-dried powder of Cynomorium oxyphylla extract.

3. The application according to claim 1, characterized in that, The Cynomorium extract contains at least one component selected from sucrose, 4-hydroxyisoleucine, catechin, proanthocyanidin C1, gentianin, and astragaloside A.

4. The application according to claim 3, characterized in that, The active ingredients in the Cynomorium extract include flavonoids and terpenoids, wherein the flavonoids include catechins and / or proanthocyanidins C1, and the terpenoids include astragaloside A.

5. The application according to claim 1, characterized in that, The effective concentration of the Cynomorium extract in promoting osteogenic differentiation of MC3T3-E1 cells in vitro was 1 μg / mL.

6. The application according to claim 1, characterized in that, The drug is administered via local injection or by gavage.

7. The application according to claim 6, characterized in that, The concentration of the Cynomorium extract administered via local injection is 0.04% to 4%.

8. The application according to claim 7, characterized in that, The concentration of Cynomorium songaricum extract administered via local injection is 0.4%. It promotes alveolar bone osteoogenesis by inhibiting inflammatory infiltration in periodontal tissues, reducing the number of osteoclasts, upregulating the expression of ALP, Runx2, and OCN in periodontal tissues, downregulating RANKL expression, improving alveolar bone microstructure, and reducing serum levels of IL-1β, TNF-α, IL-6, and MMP9.

9. A pharmaceutical composition for promoting alveolar bone ossification, characterized in that, It contains Cynomorium extract as the active ingredient, and its pharmaceutically acceptable carrier.

Images