Recombinant bacteria, methods for their construction and use in the production of lipophilic compounds

Abstract

This application relates to recombinant bacteria, their construction methods, and their application in the preparation of lipid-soluble compounds. The recombinant bacteria are obtained by modifying chassis cells, which are microorganisms that produce lipid-soluble compounds. The modification includes inserting genes related to transport and secretion pathways into the chassis cells. The lipid-soluble compounds include one of squalene and brassinosteroids, and the transport and secretion pathway includes one of the liquid lipid droplet exosome pathway and the apical membrane transport and secretion pathway. This application expresses transport and secretion pathways in microbial chassis cells and provides the construction and application of artificial liquid lipid droplet exosome and apical membrane transport and secretion pathways, which can improve the production of lipid-soluble compounds such as squalene and brassinosteroids, and can be used in the production of lipid-soluble compounds such as squalene and brassinosteroids.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to recombinant bacteria, their construction methods, and their applications in the preparation of lipid-soluble compounds. Background Technology

[0002] Microbial cell factories, as an important platform for natural product production, have been widely used in the synthesis of lipid-soluble compounds such as squalene and brassinosteroids. Current strategies for increasing yield mainly include metabolic pathway optimization, enhanced expression of key enzymes, and cofactor engineering; these methods largely focus on reconstructing intracellular metabolic flux.

[0003] Some studies have upregulated the HMG-COA reductase and squalene synthase ERG9 genes in *Saccharomyces cerevisiae*, while downregulating the GAL80 and squalene monooxygenase ERG1 genes, thereby enhancing the squalene synthesis capacity of *Saccharomyces cerevisiae*. Other studies have knocked out genes related to phospholipid synthesis located in the endoplasmic reticulum (ER), regulating ER expression and simultaneously expressing the acetyl-CoA to squalene synthesis pathway, thus increasing squalene yield. In a recently published cutting-edge article, researchers engineered multiple organelles to enhance the enzyme capacity in the squalene synthesis pathway, expand storage space, and improve cellular resistance to lysis, thereby increasing squalene production in *Saccharomyces cerevisiae*. However, these technologies offer limited increases in product yield and are insufficient to meet demand. Summary of the Invention

[0004] Based on this, this application provides a recombinant strain, its construction method, and its application in the preparation of lipid-soluble compounds. Fermentation using this recombinant strain yields a high amount of lipid-soluble compounds.

[0005] In a first aspect, this application provides a recombinant bacterium obtained by modifying a chassis cell, wherein the chassis cell is a microorganism that produces lipid-soluble compounds, and the modification includes inserting a transport and secretion pathway-related gene into the chassis cell, wherein the lipid-soluble compound includes one of squalene and brassinosteroid, and the transport and secretion pathway includes one of the liquid lipid droplet exosome pathway and the apical membrane transport and secretion pathway.

[0006] This application finds that existing technologies are mainly limited to intracellular metabolic regulation and do not address product efflux mechanisms, leading to product accumulation within the cell, inhibiting cell growth, and limiting further yield breakthroughs. In this application, by inserting genes related to transport and secretion pathways into microorganisms that produce lipid-soluble compounds, including either the liquid lipid droplet exosome pathway or the apical membrane transport and secretion pathway, the intracellular products of the microorganisms are transported and secreted extracellularly through these pathways, promoting product secretion and increasing the yield of lipid-soluble compounds such as squalene and brassinosteroids. Experimental verification shows that compared to strains not transformed with the artificial liquid lipid droplet exosome pathway, the addition of the artificial liquid lipid droplet exosome pathway increases the intracellular content of squalene-producing *Saccharomyces cerevisiae* cells by approximately 100%; the addition of the apical membrane transport and secretion pathway increases both the extracellular and intracellular content of brassinosteroids-producing *Saccharomyces cerevisiae* cells in different combinations.

[0007] In some embodiments, the lipid-soluble compound is squalene, the transport and secretion pathway is the liquid lipid droplet exosome pathway, and the genes related to the liquid lipid droplet exosome pathway include liquid lipid droplet subcellular organelle localization peptide sequences and endosome protein sorting and transport complex gene sequences. Furthermore, the liquid lipid droplet subcellular organelle localization peptide sequence and the endosome protein sorting and transport complex gene sequence are fused together in the recombinant bacteria via a first fusion adapter.

[0008] In some embodiments, the source of the liquid lipid droplet subcellular organelle localizing peptide includes Norwegian rats, and the source of the endosome protein sorting and transport complex includes Saccharomyces cerevisiae; Further, the nucleotide sequence of the liquid lipid droplet subcellular organelle localization peptide sequence with the first fusion adapter is shown in SEQ ID NO.1; the endosome protein sorting and transport complex gene sequence includes the VPS32 gene sequence, and the nucleotide sequence of the endosome protein sorting and transport complex gene sequence with the first fusion adapter is shown in SEQ ID NO.2.

[0009] In some embodiments, the liquid lipid droplet exosome pathway-related gene further includes a promoter sequence and a terminator sequence, wherein both the promoter sequence and the terminator are connected to the recombinant bacteria via the first fusion adapter; Furthermore, the nucleotide sequence of the promoter with the first fusion linker is shown in SEQ ID NO.3, and the nucleotide sequence of the promoter with the first fusion linker is shown in SEQ ID NO.4.

[0010] In some embodiments, the lipid-soluble compound is brassinosteroid, the transport and secretion pathway is the apical membrane transport and secretion pathway, and the genes related to the apical membrane transport and secretion pathway include key protein combination genes, the key proteins including lipid droplet coating protein, lactolipin subfamily 1 member A1, and xanthine oxidoreductase.

[0011] In some embodiments, the lipid droplet coating protein is derived from Norwegian rats, the lactolipin subfamily 1 member A1 is derived from Norwegian rats, and the xanthine oxidoreductase is derived from Botrytis cinerea budding yeast. Furthermore, the nucleotide sequence of the lipid droplet-coated protein is shown in SEQ ID NO.7, the nucleotide sequence of the lactolipin subfamily 1 member A1 is shown in SEQ ID NO.8, and the nucleotide sequence of the xanthine oxidoreductase is shown in SEQ ID NO.9.

[0012] In some embodiments, the genes related to the apical membrane transport and secretion pathway further include a key protein promoter sequence and a key protein terminator sequence, wherein both the key protein promoter sequence and the key protein terminator are connected to the recombinant bacteria via a second fusion adapter; Furthermore, the key protein promoters include the GAL1 / GAL10 bidirectional promoter and the GAL1 promoter, and the key protein terminators include the TDH2 terminator, the ADH1 terminator, and the CYC1 terminator. Furthermore, the nucleotide sequence of the GAL1 / GAL10 bidirectional promoter with the second fusion linker is shown in SEQ ID NO.12; the nucleotide sequence of the GAL1 promoter with the second fusion linker is shown in SEQ ID NO.13; the nucleotide sequence of the TDH2 terminator with the second fusion linker is shown in SEQ ID NO.14; the nucleotide sequence of the ADH1 terminator with the second fusion linker is shown in SEQ ID NO.15; and the nucleotide sequence of the CYC1 terminator with the second fusion linker is shown in SEQ ID NO.16.

[0013] In some embodiments, the genes related to the apical membrane transport and secretion pathway further include genes related to phosphorylation activation pathways, wherein the phosphorylation activation pathways include SRC kinases and lockout proteins.

[0014] In some embodiments, the SRC kinase is derived from Norwegian rats, and the occlusion protein is derived from Norwegian rats; Furthermore, the nucleotide sequence of the SRC kinase is shown in SEQ ID NO.10, and the nucleotide sequence of the lockout protein is shown in SEQ ID NO.11.

[0015] In some embodiments, the gene related to the apical membrane transport and secretion pathway further includes an activation pathway promoter sequence and an activation pathway terminator sequence, wherein both the activation pathway promoter sequence and the activation pathway terminator are connected to the recombinant bacteria via a third fusion adapter; Furthermore, the activation pathway promoters include the CIT1 promoter and the CYC1 promoter, and the activation pathway terminators include the TDH2 terminator and the ADH1 terminator; Furthermore, the nucleotide sequence of the CIT1 promoter with the third fusion linker is shown in SEQ ID NO.19; the nucleotide sequence of the CYC1 promoter with the third fusion linker is shown in SEQ ID NO.20; the nucleotide sequence of the TDH2 terminator with the third fusion linker is shown in SEQ ID NO.21; and the nucleotide sequence of the ADH1 terminator with the third fusion linker is shown in SEQ ID NO.22.

[0016] A second aspect of this application provides a method for constructing the aforementioned recombinant bacteria, comprising the following steps: The recombinant bacteria were obtained by inserting the genes related to the transport and secretion pathway into the chassis cells.

[0017] In some embodiments, the lipid-soluble compound is squalene, the transport and secretion pathway is the liquid lipid droplet exosome pathway, and the genes related to the liquid lipid droplet exosome pathway include liquid lipid droplet subcellular organelle localization peptide sequences and endosome protein sorting and transport complex gene sequences; the step of inserting transport and secretion pathway-related genes into chakra cells includes: (1) The liquid lipid droplet subcellular organelle localization peptide sequence with the first fusion adapter and the endosome protein sorting and transport complex gene sequence with the first fusion adapter were obtained by genetic engineering technology. (2) The promoter sequence with the first fusion adapter, the CYC1 terminator sequence with the first fusion adapter, the upstream homologous sequence of the cloning integration site in the chassis cell with the first fusion adapter, and the downstream homologous sequence of the cloning integration site in the chassis cell with the first fusion adapter were obtained by genetic engineering technology. (3) Perform fusion PCR on the sequences obtained in steps (1) and (2), and integrate the fused sequence fragments into the chassis cells using gene editing technology to obtain the recombinant bacteria.

[0018] In some embodiments, the upstream homologous sequence of the clonal integration site in the chassis cell with the first fusion connector is shown in SEQ ID NO.5, and the downstream homologous sequence of the clonal integration site in the chassis cell with the first fusion connector is shown in SEQ ID NO.6. Furthermore, the primers used in steps (1) to (2) include primers with nucleotide sequences as shown in SEQ ID NO.25 to SEQ ID NO.36.

[0019] In some embodiments, the lipid-soluble compound is brassinosteroid, the transport and secretion pathway is the apical membrane transport and secretion pathway, and the genes related to the apical membrane transport and secretion pathway include a combination of key protein genes, wherein the key proteins include lipid droplet-coated proteins, A1, a member of the lactolipin subfamily 1, and xanthine oxidoreductase; the step of inserting genes related to the transport and secretion pathway into the chakra cells includes: (1) The sequences of cloned lipid droplet-coated proteins, A1 protein of lactolipin subfamily 1, and xanthine oxidoreductase were obtained by genetic engineering techniques. (2) The following sequences were obtained by genetic engineering: a GAL1 / GAL10 bidirectional promoter sequence with the second fusion adapter, a GAL1 promoter sequence with the second fusion adapter, a TDH2 terminator sequence with the second fusion adapter, an ADH1 terminator sequence with the second fusion adapter, a CYC1 terminator sequence with the second fusion adapter, an upstream homologous sequence of the cloning integration site in the chassis cells, and a downstream homologous sequence of the cloning integration site in the chassis cells. (3) Perform fusion PCR on the sequences obtained in steps (1) and (2), and integrate the fused sequence fragment into the chassis cells using gene editing technology to obtain the recombinant bacteria.

[0020] In some embodiments, the genes related to the apical membrane transport and secretion pathway further include genes related to phosphorylation activation pathways, wherein the phosphorylation activation pathway includes SRC kinase and lockout protein; step (3) includes: (a) The sequences obtained in steps (1) and (2) are subjected to fusion PCR, and the fused sequence fragments are integrated into the chassis cells using gene editing technology to obtain recombinant cells; (b) The SRC kinase sequence and the lockout protein sequence were obtained by genetic engineering techniques; (c) Using genetic engineering techniques, obtain the CIT1 promoter sequence with the third fusion adapter, the CYC1 promoter sequence with the third fusion adapter, the TDH2 terminator sequence with the third fusion adapter, the ADH1 terminator sequence with the third fusion adapter, the upstream homologous sequence of the clonal integration site in the recombinant cell, and the downstream homologous sequence of the clonal integration site in the recombinant cell. (d) The sequences obtained in steps (b) and (c) are subjected to fusion PCR, and the fused sequence fragments are integrated into the recombinant cells using gene editing technology to obtain the recombinant bacteria.

[0021] In some embodiments, the upstream homologous sequence of the clonal integration site in the chassis cell is shown in SEQ ID NO. 17, and the downstream homologous sequence of the clonal integration site in the chassis cell is shown in SEQ ID NO. 18. And / or, the upstream homologous sequence of the clonal integration site in the recombinant cell is shown in SEQ ID NO.23, and the downstream homologous sequence of the clonal integration site in the recombinant cell is shown in SEQ ID NO.24; And / or, the primers used in steps (1) to (3) include primers with nucleotide sequences as shown in SEQ ID NO.37 to SEQ ID NO.72.

[0022] In a third aspect, this application provides the use of the recombinant bacteria described above in the preparation of fat-soluble compounds. Attached Figure Description

[0023] Figure 1 A schematic diagram illustrating the principle of the artificial liquid lipid droplet exosome pathway; Figure 2 This is a schematic diagram illustrating the principle of the apical membrane transport and secretion pathway. Figure 3 This is a comparison chart of squalene production in Example 1; Figure 4 This is a comparison chart of brassinosteroid yield in Example 2. Detailed Implementation

[0024] The recombinant bacteria, their construction method, and their application in the preparation of lipid-soluble compounds are further described in detail below with reference to specific embodiments. This application can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a more thorough and complete understanding of the disclosure of this application.

[0025] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the application.

[0026] As used herein, the terms “and / or,” “or / and,” and “and / or” may include any one of two or more of the related listed items, as well as any and all combinations of the related listed items, including any two related listed items, any more related listed items, or a combination of all the related listed items.

[0027] In this article, "one or more" refers to any one, two or more of the listed items.

[0028] In this application, terms such as "first aspect," "second aspect," "third aspect," and "fourth aspect" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or quantity, nor should they be construed as implicitly indicating the importance or quantity of the indicated technical features. Moreover, terms such as "first," "second," "third," and "fourth" serve only as a non-exhaustive enumeration and should be understood not to constitute a closed limitation on quantity.

[0029] In this application, the technical features described in an open-ended manner include both closed technical solutions consisting of the listed features and open technical solutions that include the listed features.

[0030] In this application, numerical ranges are referred to as continuous unless otherwise specified, and include the minimum and maximum values ​​of the range, as well as every value between the minimum and maximum values. Furthermore, when the range refers to integers, it includes every integer between the minimum and maximum values ​​of the range. Additionally, when multiple ranges are provided to describe a feature or characteristic, the ranges may be merged. In other words, unless otherwise specified, all ranges disclosed herein should be understood to include any and all subranges to which they are incorporated.

[0031] Unless otherwise specified, the percentage content mentioned in this application refers to mass percentage for solid-liquid mixtures and solid-phase-solid mixtures, and volume percentage for liquid-phase-liquid mixtures.

[0032] Unless otherwise specified, all percentage concentrations mentioned in this application refer to the final concentration. The final concentration refers to the proportion of the added component in the system after the addition of that component.

[0033] Unless otherwise specified, the temperature parameters in this application may be either constant temperature processing or processing within a certain temperature range. The constant temperature processing allows for temperature fluctuations within the precision range controlled by the instrument.

[0034] In this application, room temperature generally refers to 4℃~30℃, and preferably 20±5℃.

[0035] Microbial chassis cells have been widely used to express and produce various natural products and applied in actual industrial production. However, in the process of putting them into practical production, effective strategies for increasing the yield of target products are relatively scarce. Existing technologies typically employ metabolic flux rearrangement schemes for chassis cells. However, rearranging only the intracellular metabolism often encounters yield bottlenecks, making it difficult to achieve further higher yields.

[0036] To address the aforementioned issues, this application introduces a transport-secretion pathway to transport and secrete the target compound from the intracellular space to the extracellular space, thereby rapidly overcoming the bottleneck in the yield of the target compound.

[0037] The technical solution of this application is described in detail below: In a first aspect, this application provides a recombinant bacterium obtained by modifying a chassis cell, wherein the chassis cell is a microorganism that produces lipid-soluble compounds, and the modification includes inserting a transport and secretion pathway-related gene into the chassis cell, wherein the lipid-soluble compound includes one of squalene and brassinosteroid, and the transport and secretion pathway includes one of the liquid lipid droplet exosome pathway and the apical membrane transport and secretion pathway.

[0038] This application finds that existing technologies are mainly limited to intracellular metabolic regulation and do not address product efflux mechanisms, leading to product accumulation within the cell, inhibiting cell growth, and limiting further yield breakthroughs. In this application, by inserting genes related to transport and secretion pathways into microorganisms that produce lipid-soluble compounds, including either the liquid lipid droplet exosome pathway or the apical membrane transport and secretion pathway, the intracellular products of the microorganisms are transported and secreted extracellularly through these pathways, promoting product secretion and increasing the yield of lipid-soluble compounds such as squalene and brassinosteroids. Experimental verification shows that compared to strains without the artificial liquid lipid droplet exosome pathway, the addition of the artificial liquid lipid droplet exosome pathway increases the intracellular content of squalene-producing *Saccharomyces cerevisiae* cells by approximately 100%; the addition of the apical membrane transport and secretion pathway increases both the extracellular and intracellular content of brassinosteroids-producing *Saccharomyces cerevisiae* cells in different combinations. The recombinant bacteria of this application can be used to prepare lipid-soluble compounds.

[0039] like Figure 1 As shown, the artificial liquid lipid droplet exosome pathway is mainly obtained by fusing the VPS32 protein of the endosome protein sorting and transport complex with the liquid lipid droplet subcellular organelle localizing peptide using the GSG protein fusion linker, and is a transport and secretion pathway mediated by the fusion protein. Figure 1 a) Schematic diagram of the function of artificial liquid lipid exosome pathway: Liquid lipid droplets carrying the target compound are introduced into the exosome pathway through a fusion protein carrying a liquid lipid droplet localization peptide and secreted out of the cell. Figure 1b) Composition of the fusion protein: PLIN1-192 is a liquid lipid droplet localization peptide, VPS32 is one of the key proteins in the exosome sorting protein complex, and the blue curve represents the GSG protein linker.

[0040] like Figure 2 As shown, the apical membrane transport-secretion pathway mainly involves the interaction of three key structural proteins—PLIN2, BTN1a1, and XOR—near the plasma membrane, transporting intracellular lipid droplets out of the cell. Upstream, there is also a phosphorylation activation pathway that promotes secretion. PLIN2: lipid droplet coating protein; BTN1a1: member A1 of the lactolipoprotein subfamily 1; XOR: xanthine oxidoreductase; SRC: SRC kinase; OCLN: lockout protein. For a detailed description of the apical membrane transport-secretion pathway, please refer to the reference: Lu Y, Zhou T, Xu C, et al., Occludin is a target of Src kinase and promotes lipid secretion by binding to BTN1a1 and XOR [J]. PLoS Biology , 2022.20(1): e3001518. In some embodiments, the chassis cells include, but are not limited to, brewer's yeast that produces fat-soluble compounds.

[0041] In some embodiments, the lipid-soluble compound is squalene, the transport and secretion pathway is the liquid lipid droplet exosome pathway, and the genes related to the liquid lipid droplet exosome pathway include liquid lipid droplet subcellular organelle localization peptide sequences and endosome protein sorting and transport complex gene sequences.

[0042] Furthermore, the liquid lipid droplet subcellular organelle localization peptide sequence and the endosome protein sorting and transport complex gene sequence are fused together in the recombinant bacteria via a first fusion adapter.

[0043] In some embodiments, the source of the liquid lipid droplet subcellular organelle localizing peptide includes Norwegian rats, and the source of the endosome protein sorting and transport complex includes Saccharomyces cerevisiae.

[0044] Further, the nucleotide sequence of the liquid lipid droplet subcellular organelle localization peptide sequence with the first fusion adapter is shown in SEQ ID NO.1; the endosome protein sorting and transport complex gene sequence includes the VPS32 gene sequence, and the nucleotide sequence of the endosome protein sorting and transport complex gene sequence with the first fusion adapter is shown in SEQ ID NO.2.

[0045] Among them, the sequence shown in SEQ ID NO.1 is: CTATCAACTATTAACTATATCGTAATACACAATGGCAGTCAACAAAGGCCTCACCTTGCTGGATGGAGACCTCCCTGAGCAGGAGAATGTGCTGCAGCGGGTCCTGCAGCTGCCGGTGGTGAGTGGCACCTGCGAATGCTTCCAGAAGACCTACACCAGCACTAAGGAAGCCCACCCCCTGGTGGCCTCTGTGTGCAATGCCTATGAGAAGGGCGTGCAGAGCGCCAGTAGCTTGGCTGCCTGGAGCATGGAGCCGGTGGTCCGCAGGCTGTCCACCCAGTTCACAGCTGCCAATGAGCTGGCCTGCCGAGGCTTGGACCACCTGGAGGAAAAGATCCCCGCCCTCCAGTACCCCCCTGAAAAGATTGCTTCTGAGCTGAAGGACACCATCTCCACCCGCCTCCGCAGTGCCAGAAACAGCATCAGCGTTCCCATCGCGAGCACTTCAGACAAGGTCCTGGGGGCCGCTTTGGCCGGGTGCGAGCTTGCCTGGGGGGTGGCCAGAGACACTGCGGAATTTGCTGCCAACACTCGAGCTGGCCGACTGGCTTCTGGAGGGGCCGACTTGGCCTTGGGCAGCATTGAGAAGGTGGTGGAGTACCTCCTC。

[0046] The sequence shown in SEQ ID NO.2 is: .

[0047] It should be noted that the source of the liquid lipid droplet subcellular organelle localizing peptide is not limited to Norwegian rats, but may also be from other sources. Similarly, the source of the endosome protein sorting and transport complex is not limited to Saccharomyces cerevisiae, but may also be from other sources.

[0048] In some embodiments, the liquid lipid droplet exosome pathway-related gene further includes a promoter sequence and a terminator sequence, both of which are connected to the recombinant bacteria via the first fusion adapter.

[0049] Furthermore, the nucleotide sequence of the promoter with the first fusion linker is shown in SEQ ID NO.3, and the nucleotide sequence of the promoter with the first fusion linker is shown in SEQ ID NO.4.

[0050] Among them, the sequence shown in SEQ ID NO.3 is an ADH2 promoter sequence containing an upstream homologous sequence of the integration site 511b. The specific sequence is as follows: .

[0051] The sequence shown in SEQ ID NO.4 is a CYC1 terminator sequence containing a downstream homologous sequence of the integration site 511b. The specific sequence is as follows: ACAGGCCCCTTTTCCTTTGTCGATATCATGTAATTAGTTATGTCACGCTTACATTCACGCCCTCCTCCCACATCCGCTCTAACCGAAAAGGAAGGAGTTAGACAACCTGAAGTCTAGGTCCCTATTTATTTTTTTTAA TAGTTATGTTAGTATTAAGAACGTTATTTATATTTCAAATTTTTCTTTTTTTTGTACAAACGCGTGTACGCATGTAACATTATACTGAAAACCTTGCTTGAGAAGGTTTTTTGCTTCTATTTTCTTCGTTTTGAA.

[0052] In the above embodiments, the yield of squalene produced by the chassis cells was significantly increased by introducing artificial liquid lipid droplet exosomes into the chassis cells.

[0053] In other embodiments, the lipid-soluble compound is brassinosteroid, the transport and secretion pathway is the apical membrane transport and secretion pathway, and the genes related to the apical membrane transport and secretion pathway include key protein combination genes, the key proteins including lipid droplet coating protein, lactolipin subfamily 1 member A1, and xanthine oxidoreductase.

[0054] In some embodiments, the lipid droplet coating protein is derived from Norwegian rats, the lactolipin subfamily 1 member A1 is derived from Norwegian rats, and the xanthine oxidoreductase is derived from *Botrytis cinerea*.

[0055] Furthermore, the nucleotide sequence of the lipid droplet-coated protein is shown in SEQ ID NO.7, the nucleotide sequence of the lactolipin subfamily 1 member A1 is shown in SEQ ID NO.8, and the nucleotide sequence of the xanthine oxidoreductase is shown in SEQ ID NO.9.

[0056] The sequence shown in SEQ ID NO.7 is as follows:

[0057] The sequence shown in SEQ ID NO.8 is as follows:

[0058] The sequence shown in SEQ ID NO.9:

[0059] It should be noted that the source of the lipid droplet-coated protein is not limited to Norwegian rats, but may also include other sources. The source of the lactolipin subfamily 1 member A1 is not limited to Norwegian rats, but may also include other sources. The source of the xanthine oxidoreductase is not limited to *Botrytis cinerea*, but may also include other sources.

[0060] In some embodiments, the genes related to the apical membrane transport and secretion pathway further include a key protein promoter sequence and a key protein terminator sequence, both of which are connected to the recombinant bacteria via a second fusion adapter.

[0061] Furthermore, the key protein promoters include the GAL1 / GAL10 bidirectional promoter and the GAL1 promoter, and the key protein terminators include the TDH2 terminator, the ADH1 terminator, and the CYC1 terminator.

[0062] Furthermore, the nucleotide sequence of the GAL1 / GAL10 bidirectional promoter with the second fusion linker is shown in SEQ ID NO.12; the nucleotide sequence of the GAL1 promoter with the second fusion linker is shown in SEQ ID NO.13; the nucleotide sequence of the TDH2 terminator with the second fusion linker is shown in SEQ ID NO.14; the nucleotide sequence of the ADH1 terminator with the second fusion linker is shown in SEQ ID NO.15; and the nucleotide sequence of the CYC1 terminator with the second fusion linker is shown in SEQ ID NO.16.

[0063] Among them, the sequence shown in SEQ ID NO.12 is: GACAAGAGTTGGTGGGAACTGCCATTTATATTGAATTTTCAAAAATTCTTACTTTTTTTTTGGATGGACGCAAAGAAGTTTAATAATCATATTACATGGCATTACCACCATATACATATCCATATCTAATCTTACTTATATGTTGTGGAAATGTAAAGAGCCCCATTATCTTAGCCTAAAAAAACCTTCTCTTTGGAACTTTCAGTAATACGCTTAACTGCTCATTGCTATATTGAAGTACGGATTAGAAGCCGCCGAGCGGGCGACAGCCCTCCGACGGAAGACTCTCCTCCGTGCGTCCTCGTCTTCACCGGTCGCGTTCCTGAAACGCAGATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAATACTAGCTTTTATGGTTATGAAGAGGAAAAATTGGCAGTAACCTGGCCCCACAAACCTTCAAATTAACGAATCAAATTAACAACCATAGGATGATAATGCGATTAGTTTTTTAGCCTTATTTCTGGGGTAATTAATCAGCGAAGCGATGATTTTTGATCTATTAACAGATATATAAATGGAAAAGCTGCATAACCACTTTAACTAATACTTTCAACATTTTCAGTTTGTATTACTTCTTATTCAAATGTCATAAAAGTATCAACAAAAAATTGTTAATATACCTCTATACTTTAACGTCAAGGAGAAAAAACTATAAAAAAACTATAATGACTGCGGATGAGTTGGTCTTC The sequence shown in SEQ ID NO.13 is as follows: GACCACACCTCTACCGGCGGATTAGAAGCCGCCGAGCGGGCGACAGCCCTCCGACGGAAGACTCTCCTCCGTGCGTCCTCGTCTTCACCGGTCGCGTTCCTGAAACGCAGATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAATACTAGCTTTTATGGTTATGAAGAGGAAAAATTGGCAGTAACCTGGCCCCACAAACCTTCAAATTAACGAATCAAATTAACAACCATAGGATGATAATGCGATTAGTTTTTTAGCCTTATTTCTGGGGTAATTAATCAGCGAAGCGATGATTTTTGATCTATTAACAGATATATAAATGGAAAAGCTGCATAACCACTTTAACTAATACTTTCAACATTTTCAGTTTGTATTACTTCTTATTCAAATGTCATAAAAGTATCAACAAAAAATTGTTAATATACCTCTATACTTTAACGTCAAGGAGAAAAAACTATAATGGCATCAGTAGCAGTGGATCCAC The sequence shown in SEQ ID NO.14 is as follows: GTTTATTTGTATAATTGAGTTTACAgcgaaaagccaattagtgtgatactaagtgctttatcgaaaatccgtgatgccggtccttcaggcatcaaatttcagtggcctaattattcacagagttctcatgtgacaagtattgatgatagtagtgtcagttatgcttcaggttatgttactataggataatgatcacggctaaaacggtcgaatgtaagcatatatctttcgattgtataattgttcccaaatactacagcatctcaaggaaaaaaaaacaaaaacttccaaaaaaatcgaatccctgaggaatctttaatacattttcaatctatttaagttttataaacgtgtatatgagatgtcatgagcatgaattattaataataaaaactaaatcattaaagtaacttaaggagttaaatTTAAGGTGCTGCTTGGCTAGGTGAG The sequence shown in SEQ ID NO.15 is as follows: GTAAATCCTGGTCTGTGAGGATCTGACGAATTTCTTATGATTTATGATTTTTATTATTAAATAAGTTATAAAAAAAATAAGTGTATACAAATTTTAAAGTGACTCTTAGGTTTTTAAAACGAAAATTCTTATTCTTGAGTAACTCTTTCCTGTAGGTCAGGTTGCTTTCTCAGGTATAGCATGAGGTCGCTCTTATTGACCACACCTCTACCGG The sequence shown in SEQ ID NO.16 is as follows: GATATTATTCCTTTGGAAGAAGACTGAACAGGCCCCTTTTCCTTTGTCGATATCATGTAATTAGTTATGTCACGCTTACATTCACGCCCTCCTCCCACATCCGCTCTAACCGAAAAGGAAGGAGTTAGACAACCTGAAGTCTAGGTCCCT ATTTATTTTTTTTAATAGTTATGTTAGTATTAAGAACGTTATTTATATTTCAAATTTTTCTTTTTTTTCTGTACAAACGCGTGTACGCATGTAACATTATACTGAAAACCTTGCTTGAGAAGGTTTTCAAGAGAGTGACAAAAAGCAAAC.

[0064] In some embodiments, the genes related to the apical membrane transport and secretion pathway further include genes related to phosphorylation activation pathways, wherein the phosphorylation activation pathways include SRC kinases and lockout proteins.

[0065] The SRC kinase and the occlusion protein are both derived from Norwegian rats.

[0066] Furthermore, the nucleotide sequence of the SRC kinase is shown in SEQ ID NO.10, and the nucleotide sequence of the lockout protein is shown in SEQ ID NO.11.

[0067] Among them, the sequence shown in SEQ ID NO.10 is:

[0068] The sequence shown in SEQ ID NO.11 is as follows:

[0069] It should be noted that the SRC kinase is derived from Norwegian rats, and the occlusion protein is derived from Norwegian rats.

[0070] In some embodiments, the gene related to the apical membrane transport and secretion pathway further includes an activation pathway promoter sequence and an activation pathway terminator sequence, both of which are connected to the recombinant bacteria via a third fusion adapter.

[0071] Furthermore, the activation pathway promoters include the CIT1 promoter and the CYC1 promoter, and the activation pathway terminators include the TDH2 terminator and the ADH1 terminator.

[0072] Furthermore, the nucleotide sequence of the CIT1 promoter with the third fusion linker is shown in SEQ ID NO.19; the nucleotide sequence of the CYC1 promoter with the third fusion linker is shown in SEQ ID NO.20; the nucleotide sequence of the TDH2 terminator with the third fusion linker is shown in SEQ ID NO.21; and the nucleotide sequence of the ADH1 terminator with the third fusion linker is shown in SEQ ID NO.22.

[0073] Among them, the sequence shown in SEQ ID NO.19 is: GACTCTCAAAAGGCCTCACAGACATCTTCGTAAATAGTATTATATTGCTATATGTTTTGCCTTATTTTCTTTTTAATGGTTGTAATTGTAATTACTTAAATGCAAATAAAAGCCAAAACAAACCTGGTTTGTATTTTAGTAAACAGCAAATTTCCCCCTTAAGACTAGCAATCCATAACAGGGGAAGGGTAAAGAATAGTTGCTGCAAGTTTTGAGCATTTATATAATGGATGGATATCAATTGACATTTTCAAACAACAAGAGGTCGGATAAGTCGATAGTATCGGAAAAGCTCCAAAGGGATTGCGATCCTCCAATAACACAAAAGTATTTTTGGTCTAGCGGGGGTCATACTTTTCATTTCCGGGCGGCTGCGGCGGAAAAAAACGTGACGCCTTTTAGCACAAAAATGCAAGGTAAATACATAAAAAAAAAGGCAATGTGAACGTAAAAACGCTCATATTTACAAAGATTAATTGAGCCGTTCAATGAAATGCGAACTTCGGAGATTTCTTTAATTAGTTTAGGTATACTTTCCTGCGAAGGTCTTGTTGGAATATGTAGTAATCTCTACCCGCGTTTTTAGTTAATGCTGAATGGTTTTTGATGGCTCCTTTTTTCTTAG。

[0074] The sequence shown in SEQ ID NO.20 is as follows: GTTTTTGATGGCTCCTTTTTTCTTAGAGAAAGATGTCAACTGAAAAAAAAAAAGGTGAACACAGGAAAAAAAATAAAAAAAAAAAAAAAAAAAGGAGGACGAAACAAAAAAGTGAAAAAAAATGAAAATTTTTTTGGAAAACCAAGAAATGAATTATATTTCCGTGTGAGACGACATCGTCGAATATGATTCAGGGTAACAGTATTGATGTAATCAATTTCCTACCTGAATCTAAAATTCCCGGGAGCAAGATCAAGATGTTTTCACCGATCTTTCCGGTCTCTTTGGCCGGGGTTTACGGACGATGGCAGAAGACCAAAGCGCCAGTTCATTTGGCGAGCGTTGGTTGGTGGATCAAGCCCACGCGTAGGCAATCCTCGAGCAGATCCGCCAGGCGTGTATATATAGCGTGGATGGCCAGGCAACTTTAGTGCTGACACATACAGGCATATATATATGTGTGCGACGACACATGATCATATGGCATGCATGTGCTCTGTATGTATATAAAACTCTTGTTTTCTTCTTTTCTCTAAATATTCTTTCCTTATACATTAGGACCTTTGCAGCATAAATTACTATACTTCTATAGACACACAAACACAAATACACACACTAAATTAATAATGGGCAGCAACAAGAGCAAGCCCAAG。

[0075] The sequence shown in SEQ ID NO.21 is as follows: CATTAACTTCGAATTTTTTTCTTTTTATCTAAgcgaaaagccaattagtgtgatactaagtgctttatcgaaaatccgtgatgccggtccttcaggcatcaaatttcagtggcc taattattcacagagttctcatgtgacaagtattgatgatagtagtgtcagttatgcttcaggttatgttaactataggataatgatcacggctaaaacggtcgaatgtaagcat atatctttcgattgtataattgttcccaaatactacagcatctcaaggaaaaaaaaacaaaaacttccaaaaaaatcgaatccctgaggaatctttaatacattttcaatctat ttaagttttataaacgtgtatatgagatgtcatgagcatgaattattaataataaaaactaaatcattaaagtaacttaaggagttaaatCTAGGTTTTCCGTCTGTCATAGTC.

[0076] The sequence shown in SEQ ID NO.22 is as follows: GTACCAGCCCGGGGAGAACCTATAGCGAATTTCTTATGATTTATGATTTTTATTATTAAATAAGTTATAAAAAAAATAAGTGTATACAAATTTTAAAGTGACTCTTAGGTTTTTAAAACGAAAATTCTTATTCTTGAGTAACTCTTTCCTGTAGGTCAGGTTTGCTTTCTCAGGTATAGCATGAGGTCGCTCTTATTGACCACACCTCTACCGGTCTTTTGCTACATATTGCTACCACTTC.

[0077] In the above embodiments, the production of brassinosteroids by the basal cells was significantly increased after the introduction of the apical membrane transport and secretion pathway into the basal cells.

[0078] It should be noted that the transport and secretion pathways mentioned are not limited to either the liquid lipid droplet exosome pathway or the apical membrane transport and secretion pathway, but may also include other transport and secretion pathways, such as the ABC transporter (ATP-binding cassette transporter).

[0079] A second aspect of this application provides a method for constructing the recombinant bacteria described in the first aspect. The specific description of the recombinant bacteria is detailed above and will not be repeated here. The construction method includes the following steps: The recombinant bacteria were obtained by inserting the genes related to the transport and secretion pathway into the chassis cells.

[0080] In some embodiments, the lipid-soluble compound is squalene, the transport and secretion pathway is the liquid lipid droplet exosome pathway, and the genes related to the liquid lipid droplet exosome pathway include liquid lipid droplet subcellular organelle localization peptide sequences and endosome protein sorting and transport complex gene sequences; the step of inserting transport and secretion pathway-related genes into the chassis cells includes: (1) The liquid lipid droplet subcellular organelle localization peptide sequence with the first fusion adapter and the endosome protein sorting and transport complex gene sequence with the first fusion adapter were obtained by genetic engineering technology. (2) The promoter sequence with the first fusion adapter, the CYC1 terminator sequence with the first fusion adapter, the upstream homologous sequence of the cloning integration site in the chassis cell with the first fusion adapter, and the downstream homologous sequence of the cloning integration site in the chassis cell with the first fusion adapter were obtained by genetic engineering technology. (3) Perform fusion PCR on the sequences obtained in steps (1) and (2), and integrate the fused sequence fragments into the chassis cells using gene editing technology to obtain the recombinant bacteria.

[0081] It should be noted that the order of steps (1) and (2) is not limited. Step (1) can be performed first and then step (2), or step (2) can be performed first and then step (1), or steps (1) and (2) can be performed simultaneously.

[0082] In some embodiments, the upstream homologous sequence of the clonal integration site in the chassis cell with the first fusion connector is shown in SEQ ID NO.5, and the downstream homologous sequence of the clonal integration site in the chassis cell with the first fusion connector is shown in SEQ ID NO.6.

[0083] Among them, the sequence shown in SEQ ID NO.5 is: 。

[0084] The sequence shown in SEQ ID NO.6 is as follows: 。

[0085] In some embodiments, the primers used in steps (1) to (2) include primers with nucleotide sequences as shown in SEQ ID NO. 25 to SEQ ID NO. 36.

[0086] In other embodiments, the lipid-soluble compound is brassinosteroid, the transport and secretion pathway is the apical membrane transport and secretion pathway, and the genes related to the apical membrane transport and secretion pathway include a key protein combination gene, wherein the key proteins include lipid droplet coating protein, lactolipin subfamily 1 member A1, and xanthine oxidoreductase; the step of inserting transport and secretion pathway-related genes into the chakra cells includes: (1) The sequences of cloned lipid droplet-coated proteins, A1 protein of lactolipin subfamily 1, and xanthine oxidoreductase were obtained by genetic engineering techniques. (2) The following sequences were obtained by genetic engineering: a GAL1 / GAL10 bidirectional promoter sequence with the second fusion adapter, a GAL1 promoter sequence with the second fusion adapter, a TDH2 terminator sequence with the second fusion adapter, an ADH1 terminator sequence with the second fusion adapter, a CYC1 terminator sequence with the second fusion adapter, and upstream and downstream homologous sequences of the cloning integration site in the chassis cells. (3) Perform fusion PCR on the sequences obtained in steps (1) and (2), and integrate the fused sequence fragment into the chassis cells using gene editing technology to obtain the recombinant bacteria.

[0087] It should be noted that the order of steps (1) and (2) is not limited. Step (1) can be performed first and then step (2), or step (2) can be performed first and then step (1), or steps (1) and (2) can be performed simultaneously.

[0088] Furthermore, the genes related to the apical membrane transport and secretion pathway also include genes related to the phosphorylation activation pathway, which includes SRC kinase and lockout protein; step (3) includes: (a) The sequences obtained in steps (1) and (2) are subjected to fusion PCR, and the fused sequence fragments are integrated into the chassis cells using gene editing technology to obtain recombinant cells; (b) The SRC kinase sequence and the lockout protein sequence were obtained by genetic engineering techniques; (c) Using genetic engineering techniques, obtain the CIT1 promoter sequence with the third fusion adapter, the CYC1 promoter sequence with the third fusion adapter, the TDH2 terminator sequence with the third fusion adapter, the ADH1 terminator sequence with the third fusion adapter, and the upstream and downstream homologous sequences of the cloning integration site in the recombinant cells. (d) The sequences obtained in steps (b) and (c) are subjected to fusion PCR, and the fused sequence fragments are integrated into the recombinant cells using gene editing technology to obtain the recombinant bacteria.

[0089] It should be noted that the order of steps (b) and (c) is not limited. Step (b) can be performed before step (c), or step (c) can be performed before step (b), or steps (b) and (c) can be performed simultaneously.

[0090] In some embodiments, the upstream homologous sequence of the cloning integration site in the chassis cell is shown in SEQ ID NO.17, and the downstream homologous sequence of the cloning integration site in the chassis cell is shown in SEQ ID NO.18.

[0091] Among them, the sequence shown in SEQ ID NO.17 is: 。

[0092] The sequence shown in SEQ ID NO.18 is as follows: 。

[0093] In some embodiments, the upstream homologous sequence of the clonal integration site in the recombinant cell is shown in SEQ ID NO.23, and the downstream homologous sequence of the clonal integration site in the recombinant cell is shown in SEQ ID NO.24.

[0094] Among them, the sequence shown in SEQ ID NO.23 is: 。

[0095] The sequence shown in SEQ ID NO.24 is as follows: 。

[0096] In some embodiments, the primers used in steps (1) to (3) include primers with nucleotide sequences as shown in SEQ ID NO. 37 to SEQ ID NO. 72.

[0097] It should be noted that genetic engineering technology includes, but is not limited to, molecular cloning technology.

[0098] The technical concept of this application includes: expressing transport and secretion pathways in microbial chassis cells, thereby increasing the total yield of the target product by transporting and secreting compounds accumulated intracellularly to the extracellular space. Specifically, it includes: a strategy for increasing the yield of lipid-soluble compounds by expressing transport and secretion pathways in microbial chassis cells; providing the construction and application of artificial liquid lipid droplet exosome pathways and apical membrane transport and secretion pathways; and enabling their use in the production of lipid-soluble compounds such as squalene and brassinosteroids.

[0099] This application has at least the following beneficial effects: 1. Overcoming production bottlenecks: By implementing an active outflow mechanism, product accumulation and inhibition are avoided, thereby increasing total output; 2. Reduce cytotoxicity: decrease the accumulation of intracellular products, and improve cell survival rate and fermentation stability; 3. Highly versatile pathway: Applicable to a variety of fat-soluble compounds and different microbial hosts; 4. Easy to scale up industrially: Extracellular products are easier to separate and purify, reducing downstream processing costs.

[0100] The following is a specific embodiment.

[0101] For experimental parameters not specified in the following specific embodiments, please refer to the guidelines given in this application document first, or refer to experimental manuals or other experimental methods known in the art, or refer to the experimental conditions recommended by the manufacturer.

[0102] The raw materials and reagents involved in the following specific embodiments can be obtained commercially or prepared by those skilled in the art using known methods.

[0103] Unless otherwise specified, in the following examples, the primers used in each example are shown in Table 1, the fragment PCR amplification reaction system is shown in Table 2, and the fragment PCR amplification reaction procedure is shown in Table 3 (using high-fidelity DNA polymerase P515 from Novizuma). The fusion PCR amplification reaction system is shown in Table 4, and the fusion PCR amplification reaction procedure is shown in Table 5 (using KOD FX High Success-rate DNA polymerase from TOYOBO). For cloning verification, sesame-seed-sized clones were picked and lysed in 25 μL of 20 mM sodium hydroxide solution, and the cells were lysed as shown in Table 6 for the samples to be verified. The cloning verification PCR amplification reaction system is shown in Table 7, and the cloning verification PCR amplification reaction procedure is shown in Table 8 (using rapid PCR mixture P222 from Novizuma).

[0104] Unless otherwise specified, the Norwegian rats used in the following examples are commercially available *Rattus norvegicus* (Rat). Liver cDNA was extracted from Norwegian rats using a commercially available cDNA extraction kit, following the manufacturer's instructions.

[0105] Unless otherwise specified, in the following examples, the YPD liquid medium consists of 10 g / L yeast extract, 20 g / L peptone, and 2 g / L glucose. The YPG liquid medium containing 2% (w / v) galactose consists of 10 g / L yeast extract, 20 g / L peptone, and 2 g / L galactose.

[0106] Table 1 Primers involved in each embodiment

[0107] Table 2 Fragment PCR Amplification Reaction System

[0108] Table 3. Fragment PCR amplification reaction procedure

[0109] Table 4 Fusion PCR Amplification Reaction System

[0110] Table 5. Fusion PCR Amplification Reaction Procedure

[0111] Table 6. Sample preparation reaction procedures for cloning validation

[0112] Table 7 PCR amplification reaction system for cloning validation

[0113] Table 8. PCR amplification reaction procedure for clone validation

[0114] Example 1 This embodiment uses the artificial liquid lipid droplet exosome approach to further increase squalene production. The specific operation steps are as follows: (1) Using primer 1 / primer 2, a localization peptide sequence with a fusion adapter was cloned by PCR from cDNA derived from Norwegian rat (the sequence is shown in SEQ ID NO.1, hereinafter referred to as SEQ1 sequence); using primer 3 / primer 4, a VPS32 gene sequence derived from Saccharomyces cerevisiae (CEN.PK2-1C; this bacterium is a common engineered bacterium in the field, which can be commercially available or obtained from a strain bank or constructed according to conventional methods in the field; the same bacterium is described here and will not be repeated). The above two sequence fragments are the fusion protein to be expressed.

[0115] (2) The promoter sequence with fusion adapter was cloned from the genome of Saccharomyces cerevisiae (CEN.PK2-1C) by PCR using primer 5 / primer 6 (the sequence is shown in SEQ ID NO.3, abbreviated as SEQ3 sequence); the CYC1 terminator sequence with fusion adapter was cloned from the genome of Saccharomyces cerevisiae (CEN.PK2-1C) by PCR using primer 7 / primer 8 (the sequence is shown in SEQ ID NO.4, abbreviated as SEQ4 sequence); and the upstream homologous sequence of the integration site (the sequence is shown in SEQ ID NO.5, abbreviated as SEQ sequence) and the downstream homologous sequence of the primer (the sequence is shown in SEQ ID NO.6, abbreviated as SEQ6 sequence) were cloned from the genome of Saccharomyces cerevisiae (CEN.PK2-1C) by PCR using primer 9 / primer 10 and primer 11 / primer 12, respectively. The above fragment describes the heterologous biosynthesis pathway of squalene, which was used to integrate into the genome of a laboratory-modified strain of *Saccharomyces cerevisiae* (CEN.PK2-1C as the starting strain). For a detailed description of this heterologous biosynthesis pathway, please refer to the reference: Chai L., Che J., Qi Q., ​​et al., Metabolic Engineering for Squalene Production: Advances and Perspectives [J]. J Agric Food Chem , 2024. 72(50):27715-27725., The “laboratory-modified strains capable of producing squalene” mentioned below are the same as those here, and will not be repeated hereafter) related fragments at the 511b site.

[0116] (3) The sequences SEQ1 to SEQ6 were subjected to fusion PCR using primer 9 / primer 12 (reaction system as shown in Table 3, reaction procedure as shown in Table 4) to obtain the complete fragment for genome integration. The CRISPR / Cas9 gene editing tool (for detailed description and editing methods, please refer to the reference: Reider Apel A., d'Espaux L., Wehrs M., et al., ACas9-based toolkit to program gene expression in Saccharomyces cerevisiae[J]) was used. Nucleic Acids Res, 2017. 45(1): 496-508.), and integrated into a squalene-producing Saccharomyces cerevisiae strain (a laboratory-modified squalene-producing strain, detailed above, will not be repeated) using the lithium acetate conversion method. After cloning verification (the sample processing system for verification is shown in Table 6, the reaction system is shown in Table 3, and the reaction procedure is shown in Table 4) and sequencing confirmation, the strain that successfully constructed the artificial liquid lipid droplet exosome pathway was obtained.

[0117] (4) The strain that successfully constructed the artificial liquid lipid droplet exosome pathway in step (3) was inoculated into YPD liquid medium and cultured overnight at 30°C and 220 rpm to obtain the seed culture for fermentation. The seed culture was then cultured at OD... 600 A starting inoculum of 0.5 μL was used for fermentation in YPG liquid medium containing 2% (w / v) galactose, covered with 10% (v / v) dodecane, and cultured at 30°C and 220 rpm for 6 days. Simultaneously, a squalene-producing *Saccharomyces cerevisiae* strain (i.e., a strain not converted to the artificial liquid lipid droplet exosome pathway, a laboratory-modified squalene-producing strain, detailed above, will not be repeated here) was cultured in the same manner as a control.

[0118] (5) After fermentation, the fermentation broth was centrifuged at 4000 rpm for 10 min. The upper layer of dodecane organic phase and the lower layer of bacterial precipitate were collected for quantitative analysis. The results are as follows: Figure 3 As shown. Figure 3 This is a comparison chart of squalene production in Example 1. Figure 3 In the text, “control” refers to the result of strains that have not been transformed into the artificial liquid lipid droplet exosome pathway, and “introduction pathway” refers to the structure of strains that have successfully constructed the artificial liquid lipid droplet exosome pathway in step (3). Figure 3 a) represents the squalene content in extracellular dodecane. Figure 3 b) is the intracellular squalene content.

[0119] from Figure 3 It was found that, compared with strains not converted to the artificial liquid lipid droplet exosome pathway, the intracellular squalene content in *Saccharomyces cerevisiae* cells increased by approximately 100% after the artificial liquid lipid droplet exosome pathway was introduced. This indicates that the introduction of the artificial liquid lipid droplet exosome pathway can increase the squalene production of *Saccharomyces cerevisiae* cells.

[0120] Example 2 This embodiment utilizes the apical membrane transport and secretion pathway to further increase brassinosteroid production. The specific operation is as follows: (1) The lipid droplet-coated protein (PLIN2) sequence was cloned from cDNA derived from Norwegian rats using primers 13 / 14 (the sequence is shown in SEQ ID NO.7, abbreviated as SEQ7 sequence); the protein sequence of A1 (BTN1a1), a member of the lactophilic lipoprotein subfamily 1, was cloned from cDNA derived from Norwegian rats using primers 15 / 16 (the sequence is shown in SEQ ID NO.8, abbreviated as SEQ8 sequence); and adenine-producing Botrytis cinerea was obtained by primer-based gene synthesis technology (the gene sequence was synthesized by Suzhou Genewise Biotechnology Co., Ltd.). Blastobotrys adeninivorans The sequence of xanthine oxidoreductase (AXOR) from [source missing] (its sequence is shown in SEQ ID NO.9, abbreviated as SEQ9 sequence). The above three sequence fragments are a combination of key structural proteins in the apical membrane transport and secretion pathway.

[0121] (2) The SRC kinase sequence (as shown in SEQ ID NO. 10, hereinafter referred to as SEQ10 sequence) was cloned from cDNA derived from Norwegian rats by PCR using primer 17 / primer 18; the lockout protein (OCLN) sequence (as shown in SEQ ID NO. 11, hereinafter referred to as SEQ11 sequence) was cloned from cDNA derived from Norwegian rats by PCR using primer 19 / primer 20. The above two sequence fragments are proteins related to the phosphorylation activation pathway of the apical membrane transport and secretion pathway.

[0122] (3) Using primers 21 / 22 and 23 / 24, the bidirectional promoter sequence of GAL1 / GAL10 with fusion adapter (as shown in SEQ ID NO.12, hereinafter referred to as SEQ12 sequence) and the promoter sequence of GAL1 (as shown in SEQ ID NO.13, hereinafter referred to as SEQ13 sequence) with fusion adapter were cloned from the genome of Saccharomyces cerevisiae (CEN.PK2-1C) by PCR; using primers 25 / 26, 27 / 28, and 29 / 30, the terminator sequence of TDH2 with fusion adapter (as shown in SEQ ID NO.14, hereinafter referred to as SEQ14 sequence), the terminator sequence of ADH1 (as shown in SEQ ID NO.15, hereinafter referred to as SEQ15 sequence), and the terminator sequence of CYC1 (as shown in SEQ ID NO.15, hereinafter referred to as SEQ ID NO.15 sequence) with fusion adapter were cloned from the genome of Saccharomyces cerevisiae (CEN.PK2-1C) by PCR. As shown in NO.16 (abbreviated as SEQ16 sequence), the above sequence fragments are promoter and terminator sequences used to construct combinatorial expression elements of key structural proteins in the apical membrane transport and secretion pathway.

[0123] (4) Using primers 31 / 32 and 33 / 34, the upstream homologous sequence (as shown in SEQ ID NO. 17, hereinafter referred to as SEQ17 sequence) and the downstream homologous sequence (as shown in SEQ ID NO. 18, hereinafter referred to as SEQ18 sequence) of the integration site were cloned from the genome of Saccharomyces cerevisiae (CEN.PK2-1C) by PCR. Subsequently, primers 31 / 35 were used to perform fusion PCR on fragments SEQ17, SEQ14, SEQ8, SEQ12 and SEQ9 (reaction system as shown in Table 3, reaction procedure as shown in Table 4). Then, primers 36 / 34 were used to perform fusion PCR on fragments SEQ9, SEQ15, SEQ13, SEQ7, SEQ16 and SEQ18 (reaction system as shown in Table 3, reaction procedure as shown in Table 4) to obtain two fragments for genome integration. The CRISPR / Cas9 gene editing tool was used (for a detailed description and editing method, please refer to the reference: Reider Apel A., d'Espaux L., Wehrs M., et al., A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae [J]. Nucleic Acids Res , 2017. 45(1):496-508.), which was integrated into a Saccharomyces cerevisiae strain that can produce brassinosteroids (a laboratory-modified strain that can produce brassinosteroids) using the lithium acetate conversion method. After cloning verification (the sample processing system in the verification is shown in Table 6, the reaction system is shown in Table 3, and the reaction procedure is shown in Table 4) and sequencing confirmation, a chassis strain with a combination of key structural proteins was obtained.

[0124] (5) The CIT1 promoter sequence with fusion adapter was cloned from the genome of Saccharomyces cerevisiae (CEN.PK2-1C) by primer 37 / primer 38 (the sequence is shown in SEQ ID NO.19, abbreviated as SEQ19 sequence); the CYC1 promoter sequence with fusion adapter was cloned from the genome of Saccharomyces cerevisiae (CEN.PK2-1C) by primer 39 / primer 40 (the sequence is shown in SEQ ID NO.20, abbreviated as SEQ20 sequence); the TDH2 terminator sequence with fusion adapter (the sequence is shown in SEQ ID NO.21, abbreviated as SEQ21 sequence) and the ADH1 terminator sequence (the sequence is shown in SEQ ID NO.22, abbreviated as SEQ22 sequence) with fusion adapter were cloned from the genome of Saccharomyces cerevisiae (CEN.PK2-1C) by primer 41 / primer 42 and primer 43 / primer 44, respectively. The above sequence fragments are promoter and terminator sequences used to construct expression elements of proteins related to the phosphorylation activation pathway of the apical membrane transport and secretion pathway.

[0125] (6) The upstream homologous sequence (as shown in SEQ ID NO. 23, hereinafter referred to as SEQ23 sequence) and the downstream homologous sequence (as shown in SEQ ID NO. 24, hereinafter referred to as SEQ24 sequence) of the integration site were cloned from the genome of Saccharomyces cerevisiae (CEN.PK2-1C) using primers 45 / 46 and 47 / 48, respectively. Fusion PCR was performed on fragments SEQ23, SEQ21, SEQ11, SEQ19, SEQ10, SEQ22, and SEQ24 using primers 43 / 46 (reaction system as shown in Table 3, reaction procedure as shown in Table 4) to obtain the complete fragment for genome integration. The CRISPR / Cas9 gene editing tool (for detailed description and editing methods, please refer to the reference: Reider Apel A., d'Espaux L., Wehrs M., et al., A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae [J]) was used. Nucleic Acids Res, 2017. 45(1): 496-508.), and integrated into a Saccharomyces cerevisiae strain capable of producing brassinosteroids using the lithium acetate conversion method (a laboratory-modified strain capable of producing brassinosteroids, i.e., using Saccharomyces cerevisiae, CEN.PK2-1C as the starting strain, inserting the heterologous biosynthetic pathway of brassinosteroids into its genome, the specific description of the heterologous biosynthetic pathway of brassinosteroids can be found in the reference: Xu S., Chen C., and Li Y., Engineering of Phytosterol-Producing YeastPlatforms for Functional Reconstitution of Downstream Biosynthetic Pathways[J]. ACS Synth Biol , 2020. 9(11): 3157-3170., The “laboratory-modified strains capable of producing brassinosteroids” mentioned below are the same as those here, and will not be repeated hereafter) or the chassis strains with constructed key structural protein combinations obtained in step (4) above. After cloning verification (the sample processing system in the verification is shown in Table 6, the reaction system is shown in Table 3, and the reaction procedure is shown in Table 4) and sequencing confirmation, the strains of the apical membrane transport and secretion pathway were successfully constructed.

[0126] (7) The strain that successfully constructed the apical membrane transport and secretion pathway in step (6) was inoculated into YPD liquid medium and cultured overnight at 30°C and 220 rpm to obtain the seed culture for fermentation. The seed culture was then cultured at OD... 600 A starting inoculum of 0.5 μL was used for fermentation in YPG liquid medium containing 2% (w / v) galactose, covered with 10% (v / v) dodecane, and cultured at 30°C and 220 rpm for 6 days. Simultaneously, a *Saccharomyces cerevisiae* strain capable of producing brassinosteroids (a laboratory-modified strain capable of producing brassinosteroids, i.e., a strain not converted to the apical membrane transport and secretion pathway) was cultured in the same manner as a control.

[0127] (8) After the fermentation broth is finished, centrifuge at 4000 rpm for 10 min, take the upper dodecane organic phase and the lower cell precipitate, and perform quantitative analysis.

[0128] Test results as follows Figure 4 As shown. Figure 4 This is a comparison chart of brassinosteroid yield in Example 2. Figure 4 a) represents the brassinosteroid content in extracellular dodecane. Figure 4 b) represents the intracellular brassinosteroid content. Figure 4 In the table, "-" indicates that the text is not imported, and "+" indicates that it is imported. For example... Figure 4In (a), in the table corresponding to the first bar chart, key structural protein combinations are marked with "-", and phosphorylation activation pathways are marked with "-", indicating that this bar chart represents the results of a Saccharomyces cerevisiae strain that did not incorporate key structural protein combinations or phosphorylation activation pathways. For example... Figure 4 In section b), in the table corresponding to the third bar, key structural protein combinations are marked with "-", and phosphorylation activation pathways are marked with "+". This indicates that the bar represents the results of a Saccharomyces cerevisiae strain that did not introduce key structural protein combinations but did introduce phosphorylation activation pathways. The same logic applies to other strains, without further elaboration.

[0129] like Figure 4 As shown, the addition of the apical membrane transport and secretion pathway increased the extracellular and intracellular brassinosteroid content in Saccharomyces cerevisiae cells in different combinations. This indicates that the introduction of the apical membrane transport and secretion pathway can increase the brassinosteroid production in Saccharomyces cerevisiae cells.

[0130] In summary, this application expresses transport and secretion pathways in microbial chassis cells and provides the construction and application of artificial liquid lipid droplet exosome pathways and apical membrane transport and secretion pathways, which can improve the production of lipid-soluble compounds such as squalene and brassinosteroids and can be used in the production of lipid-soluble compounds such as squalene and brassinosteroids.

[0131] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.

Claims

1. A recombinant bacterium, characterized in that, The recombinant bacteria are obtained by modifying chassis cells, which are microorganisms that produce lipid-soluble compounds. The modification includes inserting genes related to transport and secretion pathways into the chassis cells. The lipid-soluble compounds include one of squalene and brassinosteroids, and the transport and secretion pathways include one of the liquid lipid droplet exosome pathway and the apical membrane transport and secretion pathway.

2. The recombinant bacteria according to claim 1, characterized in that, The lipid-soluble compound is squalene, the transport and secretion pathway is the liquid lipid droplet exosome pathway, and the genes related to the liquid lipid droplet exosome pathway include liquid lipid droplet subcellular organelle localization peptide sequences and endosome protein sorting and transport complex gene sequences. Furthermore, the liquid lipid droplet subcellular organelle localization peptide sequence and the endosome protein sorting and transport complex gene sequence are fused together in the recombinant bacteria via a first fusion adapter.

3. The recombinant bacteria according to claim 2, characterized in that, The source of the liquid lipid droplet subcellular organelle localizing peptide includes Norwegian rats, and the source of the endosome protein sorting and transport complex includes Saccharomyces cerevisiae; Further, the nucleotide sequence of the liquid lipid droplet subcellular organelle localization peptide sequence with the first fusion adapter is shown in SEQ ID NO.1; the endosome protein sorting and transport complex gene sequence includes the VPS32 gene sequence, and the nucleotide sequence of the endosome protein sorting and transport complex gene sequence with the first fusion adapter is shown in SEQ ID NO.

2.

4. The recombinant bacteria according to any one of claims 2-3, characterized in that, The lipid droplet exosome pathway-related genes also include a promoter sequence and a terminator sequence, both of which are connected to the recombinant bacteria via the first fusion adapter; Furthermore, the nucleotide sequence of the promoter with the first fusion linker is shown in SEQ ID NO.3, and the nucleotide sequence of the promoter with the first fusion linker is shown in SEQ ID NO.

4.

5. The recombinant bacteria according to claim 1, characterized in that, The lipid-soluble compound is brassinosteroid, the transport and secretion pathway is the apical membrane transport and secretion pathway, and the genes related to the apical membrane transport and secretion pathway include key protein combination genes, the key proteins include lipid droplet coating protein, A1 member of the lactolipin subfamily 1, and xanthine oxidoreductase.

6. The recombinant bacteria according to claim 5, characterized in that, The lipid droplet coating protein is derived from Norwegian rats, the lactolipin subfamily 1 member A1 is derived from Norwegian rats, and the xanthine oxidoreductase is derived from Botrytis cinerea budding yeast. Furthermore, the nucleotide sequence of the lipid droplet-coated protein is shown in SEQ ID NO.7, the nucleotide sequence of the lactolipin subfamily 1 member A1 is shown in SEQ ID NO.8, and the nucleotide sequence of the xanthine oxidoreductase is shown in SEQ ID NO.

9.

7. The recombinant bacteria according to claim 5, characterized in that, The genes related to the apical membrane transport and secretion pathway also include key protein promoter sequences and key protein terminator sequences, both of which are connected to the recombinant bacteria via a second fusion adapter; Furthermore, the key protein promoters include the GAL1 / GAL10 bidirectional promoter and the GAL1 promoter, and the key protein terminators include the TDH2 terminator, the ADH1 terminator, and the CYC1 terminator. Furthermore, the nucleotide sequence of the GAL1 / GAL10 bidirectional promoter with the second fusion linker is shown in SEQ ID NO. 12; the nucleotide sequence of the GAL1 promoter with the second fusion linker is shown in SEQ ID NO. 13; the nucleotide sequence of the TDH2 terminator with the second fusion linker is shown in SEQ ID NO. 14; the nucleotide sequence of the ADH1 terminator with the second fusion linker is shown in SEQ ID NO. 15; and the nucleotide sequence of the CYC1 terminator with the second fusion linker is shown in SEQ ID NO.

16.

8. The recombinant bacteria according to any one of claims 5-7, characterized in that, The genes related to the apical membrane transport and secretion pathway also include genes related to the phosphorylation activation pathway, which includes SRC kinase and lockout protein.

9. The recombinant bacteria according to claim 8, characterized in that, The SRC kinase is derived from Norwegian rats, and the occlusion protein is derived from Norwegian rats; Furthermore, the nucleotide sequence of the SRC kinase is shown in SEQ ID NO.10, and the nucleotide sequence of the lockout protein is shown in SEQ ID NO.

11.

10. The recombinant bacteria according to claim 8, characterized in that, The genes related to the apical membrane transport and secretion pathway also include activation pathway promoter sequences and activation pathway terminator sequences, both of which are connected to the recombinant bacteria via a third fusion adapter; Furthermore, the activation pathway promoters include the CIT1 promoter and the CYC1 promoter, and the activation pathway terminators include the TDH2 terminator and the ADH1 terminator; Furthermore, the nucleotide sequence of the CIT1 promoter with the third fusion linker is shown in SEQ ID NO.19; the nucleotide sequence of the CYC1 promoter with the third fusion linker is shown in SEQ ID NO.20; and the nucleotide sequence of the TDH2 terminator with the third fusion linker is shown in SEQ ID NO.

21. The nucleotide sequence of the ADH1 terminator with the third fusion linker is shown in SEQ ID NO.

22.

11. The method for constructing recombinant bacteria according to any one of claims 1-10, characterized in that, Includes the following steps: The recombinant bacteria were obtained by inserting the genes related to the transport and secretion pathway into the chassis cells.

12. The construction method according to claim 11, characterized in that, The lipid-soluble compound is squalene, the transport and secretion pathway is the liquid lipid droplet exosome pathway, and the genes related to the liquid lipid droplet exosome pathway include liquid lipid droplet subcellular organelle localization peptide sequences and endosome protein sorting and transport complex gene sequences. The step of inserting genes related to the transport and secretion pathway into chassis cells includes: (1) The liquid lipid droplet subcellular organelle localization peptide sequence with the first fusion adapter and the endosome protein sorting and transport complex gene sequence with the first fusion adapter were obtained by genetic engineering technology. (2) The promoter sequence with the first fusion adapter, the CYC1 terminator sequence with the first fusion adapter, the upstream homologous sequence of the cloning integration site in the chassis cell with the first fusion adapter, and the downstream homologous sequence of the cloning integration site in the chassis cell with the first fusion adapter were obtained by genetic engineering technology. (3) Perform fusion PCR on the sequences obtained in steps (1) and (2), and integrate the fused sequence fragments into the chassis cells using gene editing technology to obtain the recombinant bacteria.

13. The construction method according to claim 12, characterized in that, The upstream homologous sequence of the clonal integration site in the chassis cell with the first fusion connector is shown in SEQ ID NO.5, and the downstream homologous sequence of the clonal integration site in the chassis cell with the first fusion connector is shown in SEQ ID NO.

6. Furthermore, the primers used in steps (1) to (2) include primers with nucleotide sequences as shown in SEQ ID NO.25 to SEQ ID NO.

36.

14. The construction method according to claim 11, characterized in that, The fat-soluble compound is brassinosteroid, the transport and secretion pathway is the apical membrane transport and secretion pathway, and the genes related to the apical membrane transport and secretion pathway include key protein combination genes. The key proteins include lipid droplet coating protein, A1 member of the lactolipin subfamily 1, and xanthine oxidoreductase. The step of inserting genes related to the transport and secretion pathway into chassis cells includes: (1) The sequences of cloned lipid droplet-coated proteins, A1 protein of the lactolipin subfamily 1, and xanthine oxidoreductase were obtained by genetic engineering techniques. (2) The following sequences were obtained by genetic engineering: a GAL1 / GAL10 bidirectional promoter sequence with the second fusion adapter, a GAL1 promoter sequence with the second fusion adapter, a TDH2 terminator sequence with the second fusion adapter, an ADH1 terminator sequence with the second fusion adapter, a CYC1 terminator sequence with the second fusion adapter, an upstream homologous sequence of the cloning integration site in the chassis cells, and a downstream homologous sequence of the cloning integration site in the chassis cells. (3) Perform fusion PCR on the sequences obtained in steps (1) and (2), and integrate the fused sequence fragment into the chassis cells using gene editing technology to obtain the recombinant bacteria.

15. The construction method according to claim 14, characterized in that, The genes related to the apical membrane transport and secretion pathway also include genes related to the phosphorylation activation pathway, which includes SRC kinase and lockout protein; step (3) includes: (a) The sequences obtained in steps (1) and (2) are subjected to fusion PCR, and the fused sequence fragments are integrated into the chassis cells using gene editing technology to obtain recombinant cells; (b) The SRC kinase sequence and the lockout protein sequence were obtained by genetic engineering techniques; (c) Using genetic engineering techniques, obtain the CIT1 promoter sequence with the third fusion adapter, the CYC1 promoter sequence with the third fusion adapter, the TDH2 terminator sequence with the third fusion adapter, the ADH1 terminator sequence with the third fusion adapter, the upstream homologous sequence of the clonal integration site in the recombinant cell, and the downstream homologous sequence of the clonal integration site in the recombinant cell. (d) The sequences obtained in steps (b) and (c) are subjected to fusion PCR, and the fusion sequence fragments are integrated into the recombinant cells using gene editing technology to obtain the recombinant bacteria.

16. The construction method according to claim 15, characterized in that, The upstream homologous sequence of the clonal integration site in the chassis cell is shown in SEQ ID NO.17, and the downstream homologous sequence of the clonal integration site in the chassis cell is shown in SEQ ID NO.

18. And / or, the upstream homologous sequence of the clonal integration site in the recombinant cell is shown in SEQ ID NO.23, and the downstream homologous sequence of the clonal integration site in the recombinant cell is shown in SEQ ID NO.24; And / or, the primers used in steps (1) to (3) include primers with nucleotide sequences as shown in SEQ ID NO.37 to SEQ ID NO.

72.

17. The use of the recombinant bacteria according to any one of claims 1-10 in the preparation of fat-soluble compounds.

Images