Cytochrome p450 oxidase sto1, encoding gene and application thereof

By identifying and cloning the cytochrome P450 oxidase STO1 from potato, and constructing an engineered strain of Saccharomyces cerevisiae, the problem of the lack of identification of the key enzyme in the synthesis of spirotropin was solved, and the efficient synthesis of spirotropin was achieved, laying the foundation for industrial production.

CN121022946BActive Publication Date: 2026-06-19YUNNAN NORMAL UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511575782.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-10-31
Publication Date
2026-06-19
Estimated Expiration
2045-10-31

AI Technical Summary

Technical Problem

The cytochrome P450 oxidase responsible for catalyzing the synthesis of spirotropin has not yet been cloned and identified from potatoes, limiting in-depth research on the biosynthetic mechanism of spirotropin and its industrial production.

Method used

Cytochrome P450 oxidase STO1 was identified and cloned from potatoes. By constructing an engineered strain of Saccharomyces cerevisiae, genetic modification and heterologous expression technologies were used to catalyze the conversion of tofu zearalenone into spirophyllotoxin and/or spirophyllotoxin ketone. This included replacing the ERG9 genome with the weak promoter HXT1, expressing cytochrome P450 oxidase STO1, cytochrome P450 reductase AtCPR, and terpene synthase STS.

Benefits of technology

The efficient heterologous synthesis of spirochetone was achieved, with a laboratory shake flask yield of 291 mg/L, providing a theoretical basis for industrial production and enriching the diversity of cytochrome P450 oxidases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121022946B_ABST
    Figure CN121022946B_ABST
Patent Text Reader

Abstract

This invention relates to a cytochrome P450 oxidase STO1, its encoding gene, and its applications. This invention is the first to clone and identify a cytochrome P450 oxidase gene, STO1, from potato responsible for catalyzing the synthesis of spirogelothoraxone, and to determine the nucleotide sequence and translated amino acid sequence of this gene. This invention provides expression vectors, recombinant microorganisms, or transgenic cell lines containing this gene. This invention constructs an engineered Saccharomyces cerevisiae strain for producing spirogelothoraxone, in which the strong promoter ERG9 is replaced by the weak promoter HXT1 in the strain's genome, and the STO1, AtCPR, tHMG1, and STS genes are integrated. This invention also provides a method for constructing this engineered strain and a method for producing spirogelothoraxone using this engineered strain, which can be used for the preparation of spirogelothoraxone.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biosynthesis technology, specifically to a cytochrome P450 oxidase STO1, its encoding gene, and its applications. Background Technology

[0002] Terpenes are the most diverse and chemically varied class of natural products in nature, widely found in higher plants and microorganisms, and possess significant economic and medicinal value. Sesquiterpenes, in particular, are a class of compounds containing 15 carbon atoms and their derivatives, composed of three isoprene structural units. These compounds exhibit significant biological activity and important biological functions, and are widely used in medicine, pesticides, fragrances, and flavorings.

[0003] Cytochrome P450 (P450 for short) is a group of B-family cytochrome superfamily proteases with heme as a cofactor. Plant cytochrome P450s possess broad catalytic activity and are key enzymes in the synthesis pathways of plant secondary metabolites, playing a crucial role in the biosynthesis of sesquiterpenes. Studies have shown that the biosynthesis of isoprene units in organisms mainly occurs through two pathways: the mevalonate (MVA) pathway and the 2-C-methyl-D-erythrose-4-phosphate (MEP) pathway. All terpenes originate from two isomers of the C5 precursor isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP). IPP and DMAPP, as universal precursors for all terpenes, undergo condensation reactions under the action of different isopentenyltransferases to generate linear precursors of different chain lengths. Sesquiterpenes are complex and diverse diterpenoid active compounds generated from the precursor farnesyl pyrophosphate (FPP) through cyclization, rearrangement, oxidation, and other reactions under the action of terpene synthases and cytochrome P450 oxidases.

[0004] Spirospiracolone is an important sesquiterpene phytoprotective agent that exhibits significant antifungal activity in Solanaceae plants such as potatoes, playing a crucial role in plant defense responses against pathogen infection. With a deeper understanding of plant natural defense mechanisms, the acquisition and production of such active substances using biotechnology has become a research hotspot.

[0005] However, the cytochrome P450 oxidase responsible for catalyzing the synthesis of spirotylocereus has not yet been cloned and identified from potato. Although previous studies have shown that spirotylocereus plays an important role in potato disease resistance, the key enzymes in its biosynthetic pathway have not been identified, which limits in-depth research on the biosynthetic mechanism of spirotylocereus and its industrial production. Therefore, identifying the cytochrome P450 oxidase responsible for catalyzing the synthesis of spirotylocereus in potato and constructing engineered strains capable of efficiently producing spirotylocereus is of significant scientific and practical value for in-depth research on plant defense mechanisms and the development of biopesticides. Summary of the Invention

[0006] To address the problems of existing technologies, this invention provides a potato spirulina ketone synthase STO1, its encoding gene, and its applications.

[0007] This invention is achieved through the following technical solution:

[0008] In a first aspect, the present invention provides the use of cytochrome P450 oxidase STO1 in the preparation of spirophyllotoxin and / or spirophyllotoxin ketone, wherein the amino acid sequence of the cytochrome P450 oxidase STO1 is selected from:

[0009] (1) The amino acid sequence shown in SEQ ID No. 1; or

[0010] (2) The amino acid sequence generated by substituting, deleting and / or adding one or more amino acids to the amino acid sequence shown in SEQ ID No.1, and having the same catalytic activity as the former.

[0011] The cytochrome P450 oxidase STO1 is derived from potatoes and can catalyze the conversion of tofu zeispiradiene into spirophyllotoxin and / or spirophyllotoxin ketone.

[0012] Preferably, the catalytic active site is the 302nd amino acid GLY shown in the amino acid sequence SEQ ID No. 1 of the cytochrome P450 oxidase STO1, and the catalytic activity is best when the 302nd amino acid is GLY.

[0013] Secondly, the present invention also provides a gene encoding the aforementioned cytochrome P450 oxidase STO1, the nucleotide sequence of which is selected from:

[0014] (1) The nucleotide sequence shown in SEQ ID NO.2; or

[0015] (2) A nucleotide sequence that has more than 80% homology with the nucleotide sequence shown in SEQ ID NO.2, and the enzyme it encodes has the same catalytic activity as the enzyme it encodes.

[0016] Furthermore, the present invention provides an amplification primer pair for the above-mentioned gene, comprising an upstream primer and a downstream primer, wherein the upstream primer sequence is shown in SEQ ID NO.3 and the downstream primer sequence is shown in SEQ ID NO.4.

[0017] Thirdly, the present invention also provides expression vectors, recombinant microorganisms, or transgenic cell lines containing the above-mentioned coding genes.

[0018] The expression vectors described in this invention are well-known to those skilled in the art, including but not limited to plasmids, bacteriophages, and viral vectors. By recombining the STO1 gene into a vector to construct a biological module, the cytochrome P450 oxidase STO1 gene can be readily and rapidly utilized to obtain large quantities of the target gene or protein. In this invention, the preferred vector is pESC-LEU.

[0019] The recombinant microorganisms described in this invention are known to those skilled in the art, including but not limited to Escherichia coli, yeast, etc. This invention preferably uses yeast, and more preferably Saccharomyces cerevisiae WAT11.

[0020] Fourthly, the present invention also provides the application of the above-mentioned gene, expression vector, recombinant microorganism or transgenic cell line in the preparation of spirotropin and / or spirotropinone.

[0021] The cytochrome P450 oxidase can catalyze the conversion of tofu zearamidene into spirotenoidol and / or spirotenoidone.

[0022] Fifthly, the present invention also provides an engineered Saccharomyces cerevisiae strain for producing spirochetone, wherein the strong promoter ERG9 in the genome of the engineered Saccharomyces cerevisiae strain is replaced with the weak promoter HXT1, and it contains the aforementioned cytochrome P450 oxidase STO1 gene, cytochrome P450 reductase gene AtCPR, terpene synthase gene STS, and truncated HMG-CoA reductase gene tHMG1; the nucleic acid sequence of the P450 reductase gene AtCPR is shown in GenBank:829144; the nucleic acid sequence of the truncated HMG-CoA reductase gene tHMG1 is shown in GenBank:42650; and the nucleic acid sequence of the terpene synthase gene STS is shown in GenBank:AB023816.1.

[0023] ERG9 is the gene encoding farnesyl pyrophosphate synthase in Saccharomyces cerevisiae. This enzyme catalyzes the conversion of farnesyl pyrophosphate to squalene and is a key enzyme in the synthesis of ergosterol in yeast cells. By replacing its strong promoter with the weak promoter HXT1, the expression level of ERG9 can be reduced, thereby decreasing the flux of farnesyl pyrophosphate to the ergosterol synthesis pathway and increasing the carbon flux allocation to the target product synthesis pathway.

[0024] tHMG1 encodes hydroxymethylglutaryl-CoA reductase, which is the rate-limiting enzyme in the mevalonate pathway. Overexpression of this gene can increase the supply of farnesyl pyrophosphate, thereby increasing the yield of spirotropin.

[0025] AtCPR is the cytochrome P450 reductase of Arabidopsis thaliana, responsible for providing electrons to P450 enzymes, and is a key cofactor in plant secondary metabolic pathways.

[0026] STS is a terpene synthase in potatoes that catalyzes the conversion of farnesyl pyrophosphate (FPP) into tocopheryl pyrophosphate.

[0027] Sixthly, the present invention provides a method for constructing the above-mentioned engineered brewer's yeast, comprising the following steps:

[0028] (1) Construct a recombinant expression vector pESC-LEU / AtCPR / STO1 containing the above-mentioned cytochrome P450 oxidase STO1 gene and cytochrome P450 reductase gene AtCPR;

[0029] (2) Construct a recombinant expression vector pESC-TRP / tHMG1 / STS containing the truncated HMG-CoA reductase gene tHMG1 and the terpene synthase gene STS;

[0030] (3) The strong promoter ERG9 of the Saccharomyces cerevisiae genome was replaced with the weak promoter HXT1 by PCRCT-mediated gene integration.

[0031] (4) The recombinant expression vectors pESC-LEU / AtCPR / STO1 and pESC-TRP / tHMG1 / STS were transformed into the Saccharomyces cerevisiae obtained in step 3 to obtain the engineered Saccharomyces cerevisiae strain that produces spirochetone.

[0032] Preferably, the vector construction method in step (1) is as follows: first, the AtCPR gene is inserted between the corresponding restriction sites of the expression plasmid pESC-LEU and ligated to obtain the intermediate recombinant plasmid pESC-LEU / AtCPR; then, the STO1 gene is inserted between the corresponding restriction sites of pESC-LEU / AtCPR and ligated to obtain pESC-LEU / AtCPR / STO1.

[0033] Preferably, the vector construction method in step (2) is as follows: first, the tHMG1 gene is inserted between the corresponding restriction sites of the expression plasmid pESC-TRP and ligated to obtain the intermediate recombinant plasmid pESC-TRP / tHMG1; then, the STS gene is inserted between the corresponding restriction sites of pESC-TRP / tHMG1 and ligated to obtain pESC-TRP / tHMG1 / STS.

[0034] Preferably, the conversion method in step (4) is the lithium acetate conversion method.

[0035] Preferably, the brewing yeast is brewing yeast WAT11.

[0036] In a seventh aspect, the present invention provides a method for producing spirotropin, comprising the step of inoculating the above-mentioned engineered Saccharomyces cerevisiae or the engineered Saccharomyces cerevisiae obtained by the above-mentioned construction method into a fermentation medium for fermentation culture to obtain spirotropin.

[0037] Preferably, the fermentation culture method is as follows: first, culture in 2% glucose YPDA medium at 30°C with shaking for 2-3 days; after centrifugation and discarding the supernatant, transfer to YPD medium containing 2% galactose for fermentation for 2-4 days.

[0038] Eighthly, the present invention provides a method for separating and purifying spirochetone produced by the above method, comprising the following steps:

[0039] (1) Extract the fermentation broth with ethyl acetate, collect the organic phase, concentrate and recover the solvent to obtain the extract.

[0040] (2) The extract was purified by silica gel column chromatography to obtain spirocarpus ketone. The silica gel column chromatography elution method was: elution with petroleum ether-ethyl acetate gradient of 1:0, 30:1, 20:1, 5:1, and 0:1.

[0041] The beneficial effects of this invention are as follows: This invention is the first to identify and clone the cytochrome P450 oxidase STO1 from potato. This enzyme can catalyze the conversion of tofu zeyrodiene into spirotenoid and / or spirotenoidin, enriching the diversity of cytochrome P450 oxidases. Molecular docking, kinetic simulation, and mutagenesis experiments verified that the key amino acid site in STO1 determining the yield of spirotenoidin is position 302, and its catalytic activity is optimal when amino acid 302 is GLY. Furthermore, using *Saccharomyces cerevisiae* as the chassis cell, by replacing the strong promoter ERG9 in the genome with the weak promoter HXT1, and simultaneously introducing the cytochrome P450 oxidase STO1 gene, the cytochrome P450 reductase gene AtCPR, the terpene synthase gene STS, and the truncated HMG-CoA reductase gene tHMG1, highly efficient heterologous synthesis of the compound spirotenoidin was achieved. The laboratory shake-flask yield reached 291 mg / L, providing a theoretical basis for further increasing yield and making industrial production possible. This invention provides an effective method for producing the active sesquiterpene compound spirotropin using bioengineering technology, and has significant application value. Attached Figure Description

[0042] Figure 1The image shows the PCR agarose gel electrophoresis of the gene encoding the cytochrome P450 oxidase STO1 of spirochete, where lane M is the Tiangen DNA Marker 2K Plus and lane 1 is the target band (1509 bp).

[0043] Figure 2 This is a schematic diagram of the recombinant expression vector pESC-LEU / AtCPR / STO1.

[0044] Figure 3 A schematic diagram of the molecular docking and kinetic simulation results of the cytochrome P450 oxidase STO1 expressing spirochetone and the mutant STO1G302E. In the diagram, a is a comparison of the structure of STO1 before and after simulation, b is a comparison of the structure of STO1G302E before and after simulation, and c is the close distance between the H at the C-2 position and the heme-O of the substrate zeyrodiene at the 100ns kinetic simulation scale.

[0045] Figure 4 This is a schematic diagram of the recombinant expression vector pESC-TRP / tHMG1 / STS.

[0046] Figure 5 The image shows the GC-MS analysis of the yeast engineered bacteria fermentation broth constructed in Example 3, where A is the gas chromatographic detection spectrum of the fermentation broth, B is the mass spectrum of peak 1, and C is the mass spectrum of the compound spirocarboxone standard.

[0047] Figure 6 This is a schematic diagram of the 1H NMR spectrum of the purified spirochetone compound from Example 4.

[0048] Figure 7 This is a schematic diagram of the carbon NMR spectrum of the purified spirochetone compound from Example 4.

[0049] Figure 8 A schematic diagram illustrating the process of obtaining modified yeast chassis cells by replacing the strong promoter of the yeast genome ERG9, which is involved in squalene synthesis, with the weak promoter HXT1.

[0050] Figure 9 This describes the biosynthetic pathway of spirochetone. Detailed Implementation

[0051] The present invention will now be described in further detail with reference to the accompanying drawings and embodiments, but this does not limit the present invention in any way. Any modifications or improvements made based on the teachings of the present invention shall fall within the protection scope of the present invention.

[0052] The processes, conditions, reagents, and experimental methods used in implementing this invention, except as specifically mentioned below, are all common knowledge and general knowledge in the field, and this invention does not have any particular limitations. Experimental methods in the embodiments that do not specify specific conditions are generally performed under conventional conditions or as recommended by the manufacturer.

[0053] Unless otherwise stated, all technical terms and scientific terms used in this specification have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. However, in the event of any conflict, the specification containing the definitions shall prevail.

[0054] The following are some of the sources of reagents and consumables in the examples:

[0055] The potato variety is E4-63, and the samples were collected from the planting base of Yunnan Normal University.

[0056] pESC-LEU was purchased from the Hangzhou branch of Wuhan Gray Algae Biotechnology Co., Ltd., item number: HZB800238;

[0057] pESC-TRP was purchased from Wenzhou Kemiao Biotechnology Co., Ltd., product number: KM212984;

[0058] Yeast strain WAT11, purchased from Taisto Biotechnology, catalog number TSPLA104250.

[0059] Example 1 Cloning and expression vector construction of the gene encoding cytochrome P450 oxidase STO1

[0060] 1. Gene cloning

[0061] RNA was extracted from potato leaves using the Trizol method. The procedure was described in the Vayzme RNA isolater TotalRNA Extraction Reagent manual. RNA was obtained and reverse transcribed into cDNA using the abm 5X All-In-One RT MasterMix kit. Using SEQ ID NO.3 (ATGCAATTCTTGAGCTTGGCTTC) as the upstream primer and SEQ ID NO.4 (TCATTGTCGAGGTGGTTCATAAGG) as the downstream primer, PCR amplification was performed using the high-fidelity enzyme KOD. The PCR system was 50 μL, and the reaction program was: 25 μL KOD, 1.5 μL Primer F, 1.5 μL Primer R, 0.5 μL Template DNA, and deionized water to a final volume of 50 μL. The PCR program was as follows: 98℃ for 5 min, 98℃ for 30 sec, 58℃ for 30 sec, 68℃ for 1 min 30 sec, 68℃ for 5 min, for 34 cycles. After the program was completed, the band size was detected by 1% agarose gel electrophoresis, and the product was recovered and purified to obtain the STO1 gene.

[0062] 2. Construction of expression vector pESC-LEU / AtCPR / STO1

[0063] (1) Construction of pESC-LEU / AtCPR vector

[0064] RNA was extracted from Arabidopsis thaliana leaves using the Trizol method. The procedure was described in the Vayzme RNA isolater TotalRNA Extraction Reagent manual. RNA was obtained and reverse transcribed into cDNA using the abm 5X All-In-One RT MasterMix kit. Using SEQ ID NO.5 (ATR1-F: GGGCGTCGACATGACTTCT) as the upstream primer and SEQ ID NO.6 (ATR1-R: CGGTACCTCACCAGACATCTCT) as the downstream primer, PCR amplification was performed using the high-fidelity enzyme KOD. The PCR system was 50 μL, and the reaction program was: 25 μL KOD, 1.5 μL Primer F, 1.5 μL Primer R, 0.5 μL Template DNA, and deionized water to a final volume of 50 μL. The PCR program was as follows: 98℃ for 5 min, 98℃ for 30 sec, 58℃ for 30 sec, 68℃ for 1 min 30 sec, 68℃ for 5 min, for 34 cycles. After the program, the band size was detected by 1% agarose gel electrophoresis, and the product was recovered and purified to obtain the PCR product. The pESC-LEU vector was double-digested with restriction endonucleases salⅠ and HindⅢ, reacted at 37℃ for 3 h, and the band size was detected by 1% agarose gel electrophoresis, and the product was recovered and purified. The PCR product was ligated into the digested vector pESC-LEU, transformed into E. coli DH5α, plated on LB agar plates supplemented with ampicillin (100 μg / mL) for screening, and incubated overnight at 37℃ until single colonies grew. Single colonies were picked for PCR and restriction enzyme digestion verification, and positive clones were selected for DNA sequencing verification. The successful construction of the AtCPR encoding gene expression vector pESC-LEU / AtCPR was confirmed by positive clone DNA sequencing verification.

[0065] (2) Constructing the pESC-LEU / AtCPR / STO1 vector

[0066] The pESC-LEU-AtCPR vector was digested with the restriction endonuclease NotI, reacted at 37°C for 3 h, and the band size was detected by 1% agarose gel electrophoresis. The product was then recovered and purified. The PCR product was ligated into the digested vector pESC-LEU-AtCPR, transformed into E. coli DH5α, and plated on LB agar plates supplemented with ampicillin (100 μg / mL) for screening. The plates were incubated overnight at 37°C until single colonies grew. Single colonies were picked for PCR and restriction enzyme digestion verification, and positive clones were selected for DNA sequencing verification.

[0067] Verification via positive clone DNA sequencing confirmed the successful construction of the expression vector pESC-LEU / AtCPR / STO1, which encodes the cytochrome P450 oxidase STO1 gene. The 1% agarose gel electrophoresis image of the STO1 gene fragment amplification product is shown below. Figure 1 Carrier map as follows Figure 2 The open reading frame (ORF) of the gene encoding cytochrome P450 oxidase STO1 is 1509 bp (SEQ ID NO.2) and encodes 502 amino acids (SEQ ID NO.1).

[0068] Example 2: STO1 Key Amino Acid Site Protein Molecular Docking and Kinetic Simulation

[0069] Molecular docking was performed using AutoDock Vina software to conduct molecular dynamics simulations of the STO1-substrate tofu zisporidiene complex. During the molecular dynamics simulation preparation, the resp charge was calculated using bcc, and the prepared complex structure and force field parameters were imported into TLEAP software to construct TOP and CRD files. After structural verification, the protein backbone was fixed for a 5 ns pre-simulation. After a second structural verification to ensure correct coupling mode, a 100 ns molecular dynamics simulation was performed on the entire system. Following the simulation, trajectory file analysis was performed using cpptrai. All structures were viewed and plotted using PyMOL 2.3.0.

[0070] The docking complex structure for the target binding mode was selected and optimized. When the amino acid at position 302 is GLY, the H atom of the substrate *Zephyranthes tofu* is close to the heme ligand (heme-O) of cytochrome P450 (2.6 Å), which is conducive to the binding of the substrate to the protein pocket. When the amino acid at position 302 is mutated to GLU, the substrate becomes unstable in the pocket and gradually moves away from the heme ligand, resulting in a significant reduction in catalytic activity. The results of protein-protein docking and kinetic simulations at the key amino acid site of STO1 are as follows: Figure 3 .

[0071] Comparative Example 1: STO1G mutant of cytochrome P450 oxidase STO1 302E Construction of expression carrier

[0072] Based on the results of molecular docking and kinetic simulations, the key amino acid mutation sites were identified, and the following primers were designed and used:

[0073] STO1 G302E -F:TGCTGCGGAAACAGAGACTTCATCGTCAACACTTG(SEQ ID NO.7);

[0074] STO1G 302E-R:AGTCTCTGTTTCCGCAGCAAACATGTCG(SEQ ID NO.8);

[0075] Using the STO1 expression vector as a template, PCR amplification was performed using the high-fidelity enzyme KOD. The PCR system was 50 μL, and the reaction program was as follows: 25 μL KOD, 1.5 μL Primer F, 1.5 μL Primer R, 0.5 μL Template DNA, and deionized water to a final volume of 50 μL. The PCR program was: 98℃ for 5 min, 98℃ for 30 sec, 58℃ for 30 sec, 68℃ for 1 min 30 sec, 68℃ for 5 min, for 34 cycles. After the program, the band size was detected by 1% agarose gel electrophoresis, and the product was recovered and purified. The pESC-LEU-AtCPR vector (constructed in the same way as in Example 1) was digested with the restriction endonuclease NotI, reacted at 37℃ for 3 h, and the band size was detected by 1% agarose gel electrophoresis, and the product was recovered and purified. The PCR product was ligated with the enzyme-digested vector pESC-LEU-AtCPR, transformed into Escherichia coli DH5α, plated on LB agar plates supplemented with ampicillin (100 μg / mL) for screening, and incubated overnight at 37°C until single colonies grew. Single colonies were picked for PCR and enzyme digestion verification, and positive clones were selected for DNA sequencing verification.

[0076] The successful construction of STO1G was confirmed by positive clone DNA sequencing. 302E The gene expression vector pESC-LEU / AtCPR / STO1G 302E .

[0077] Example 3: Cytochrome P450 oxidase STO1 and its mutant STO1G 302E Heterologous expression in Saccharomyces cerevisiae

[0078] (1) Construct the recombinant expression vector pESC-LEU / AtCPR / STO1 (method as in Example 1)

[0079] (2) Construction of recombinant expression vector pESC-TRP / tHMG1 / STS

[0080] 1) Construction of pESC-TRP / tHMG1 vector

[0081] Yeast genomic DNA was extracted using the Trizol method, following the instructions in the TIANGEN TIANamp Bacteria Kit. DNA was obtained and amplified by PCR using the high-fidelity enzyme KOD. The PCR system consisted of 50 μL of KOD, with the following reaction program: 25 μL KOD, 1.5 μL Primer F, 1.5 μL Primer R, 0.5 μL template DNA, and deionized water to a final volume of 50 μL. The PCR program was: 98℃ for 5 min, 98℃ for 30 sec, 58℃ for 30 sec, 68℃ for 1 min 30 sec, 68℃ for 5 min, for 34 cycles. After the PCR, band size was detected by 1% agarose gel electrophoresis, and the PCR product was recovered and purified. The pESC-TRP vector was double-digested with restriction endonucleases kpnⅠ and xhoⅠ, reacted at 37℃ for 3 h, and the band size was detected by 1% agarose gel electrophoresis. The product was then recovered and purified. The PCR product was ligated into the digested pESC-TRP vector, transformed into E. coli DH5α, and plated on LB agar plates supplemented with ampicillin (100 μg / mL) for screening. The plates were incubated overnight at 37℃ until single colonies grew. Single colonies were picked for PCR and restriction enzyme digestion verification, and positive clones were selected for DNA sequencing verification. DNA sequencing verification of positive clones confirmed the successful construction of the AtCPR encoding gene expression vector pESC-TRP / tHMG1.

[0082] 2) Constructing the pESC-TRP / tHMG1 / STS vector

[0083] RNA was extracted from potato leaves using the Trizol method. The procedure was described in the Vayzme RNA isolater TotalRNA Extraction Reagent manual. RNA was obtained and then reverse transcribed into cDNA using the abm 5X All-In-One RT MasterMix kit. The primers used were as follows:

[0084] STS-F:AGAATTTTTGAAAATTCGAATTCATGGCCTCAGCTGCTGCAGTAATG (SEQ ID NO. 11);

[0085] STS-R:TTGTAATCCATCGATACTAGTGCTTAAATTTCAATAGAGTCCACCAACAACGCAATA (SEQ ID NO. 12);

[0086] PCR amplification was performed using the high-fidelity enzyme KOD. The PCR system was 50 μL, and the reaction program was as follows: 25 μL KOD, 1.5 μL Primer F, 1.5 μL Primer R, 0.5 μL Template DNA, and deionized water to a final volume of 50 μL. The PCR program was: 98℃ for 5 min, 98℃ for 30 sec, 58℃ for 30 sec, 68℃ for 1 min 30 sec, 68℃ for 5 min, for 34 cycles. After the program, the band size was detected by 1% agarose gel electrophoresis, and the product was recovered and purified to obtain the STS gene (its nucleic acid sequence is shown in GenBank: AB023816.1). The pESC-TRP-tHMG1 vector was double-digested with restriction endonucleases EcoRI and NotI, reacted at 37℃ for 3 h, and the band size was detected by 1% agarose gel electrophoresis, and the product was recovered and purified. The PCR product was ligated into the enzyme-digested vector pESC-TRP-tHMG1, transformed into *E. coli* DH5α, and plated on LB agar plates supplemented with ampicillin (100 μg / mL) for screening. The plates were incubated overnight at 37°C until single colonies appeared. Single colonies were picked for PCR and enzyme digestion verification, and positive clones were selected for DNA sequencing verification. DNA sequencing verification of positive clones confirmed the successful construction of the *STS* expression vector pESC-TRP / tHMG1 / STS, which encodes the tofu spirodiene synthase gene. The vector map is shown below. Figure 4 .

[0087] (3) Constructing engineered brewer's yeast

[0088] Competent cells of *Saccharomyces cerevisiae* were prepared using the lithium acetate conversion method. Single yeast colonies were picked and cultured in YPDA liquid medium at 30°C and 220 rpm for 15 h. The OD600 was measured to be 0.6-0.8 using UV spectrophotometry. After centrifugation at 2500 rpm for 5 min at room temperature, the supernatant was removed, and the precipitate was resuspended in sterile water. The centrifugation was repeated twice at 2500 rpm for 5 min at room temperature. 300 μL of freshly prepared PEG / LiOAc solution (35 μL of 1M LiOAC, 260 μL of 50% 6PEG, and 5 μL of salmon sperm DNA) was added to the yeast suspension. 1.5 μg of recombinant expression plasmids pESC-LEU / AtCPR / STO1 and pESC-TRP / tHMG1 / STS were added respectively. The cells were resuspended in 150 μL of sterile water. 50 μL of the resuspended cells were plated onto LEU-deficient plates and incubated upside down at 30°C for 3 days. Single colonies were selected for verification. The verified single colonies were inoculated into LEU-deficient YPDA medium containing 2% glucose and cultured at 30°C with shaking for 2 days. After centrifugation, the supernatant was discarded and transferred to LEU-deficient YPD medium containing 2% galactose for fermentation for 2 days. The samples were extracted with ethyl acetate, and the organic layer was collected. The samples were concentrated by vacuum evaporation to obtain the in vivo enzyme activity reaction samples. The samples were analyzed and detected by GC-MS.

[0089] In addition, the mutants prepared in Comparative Example 1, recombinantly expressing pESC-LEU / AtCPR / STO1G302E and pESC-TRP / tHMG1 / STS, were co-transformed into Saccharomyces cerevisiae and fermented using the same method.

[0090] GC-MS chromatographic conditions: HP-5MS quartz capillary (30m × 250μm × 0.25μm); column temperature program settings: initial temperature 80℃, hold for 0 min; increase to 220℃ at 10℃ / min, hold for 0 min; then increase to 270℃ at 4℃ / min, hold for 3.5 min; injection in splitless mode, injection volume 1μL, carrier gas helium, helium flow rate 3 mL / min, column inlet pressure 40 kPa. GC-MS mass spectrometry conditions: EI ion source, ion source temperature 230℃, electron energy 70 eV, mass range 35-550.

[0091] The retention times and main peaks of the concentrated in vivo enzyme activity reaction sample obtained by GC-MS analysis were consistent with those of the standard sample by GC-MS analysis. The GC-MS results are as follows: Figure 5 As shown in the figure. The results show that the yeast strain constructed in this invention can synthesize spirophyllin, while the amount of spirophyllin is significantly reduced after mutation, indicating that amino acid 302 is its key active site, determining its catalytic activity.

[0092] Example 4: Isolation and purification of spirochetone from fermentation broth

[0093] The *Saccharomyces cerevisiae* strain containing the cytochrome P450 oxidase STO1 gene constructed in Example 3 was fermented for 8 L. The fermentation broth was extracted three times with ethyl acetate, and the organic phase was concentrated to recover the solvent, yielding an extract. The extract was subjected to silica gel column chromatography with a gradient elution of petroleum ether-ethyl acetate (1:0, 30:1, 20:1, 5:1, 0:1). The combined eluent containing spirochetone was analyzed by TLC, concentrated, and dried to obtain the monomeric compound, which was then identified by NMR spectroscopy.

[0094] Its NMR spectrum is as follows Figure 6 , Figure 7 Further analysis of the nuclear magnetic resonance (NMR) spectrum confirmed that the product was spirotropin.

[0095] Example 5 Construction of a high-yield engineered strain of *Saccharomyces cerevisiae* producing spirochetes

[0096] (1) Construct a recombinant expression vector pESC-LEU / AtCPR / STO1 containing the cytochrome P450 oxidase STO1 gene and the cytochrome P450 reductase gene AtCPR (the method is the same as in Example 1).

[0097] (2) Construct a recombinant expression vector pESC-TRP / tHMG1 / STS containing truncated HMG-CoA reductase gene and terpene synthase gene (method as in Example 3);

[0098] (3) The strong promoter ERG9 of the Saccharomyces cerevisiae genome was replaced with the weak promoter HXT1 by gene editing technology;

[0099] The target gene was integrated into a specific site in the genome of yeast strain WAT11 using the PCRCT-mediated gene integration method. First, the N20 sequence of the target gene was determined, and the N20 sequence of the target fragment was designed to consist of: BSAI restriction site + N20 sequence + BSAI restriction site. The synthesized gene fragment (10 μL reaction volume, plus 2 μL) was ligated with the vector plasmid using the NEB® Golden Gate Assembly Mix kit, followed by coliform transformation, colony PCR verification, and plasmid extraction for sequencing. Using the constructed target gene expression vector as a template, PCR was performed. The PCR fragment had overlapping sequences >40 bp at both ends and was purified and recovered. Using the yeast genome as a template, homologous arms (500-1000 bp) upstream and downstream of the insertion site were amplified by PCR and purified and recovered. The upstream and downstream homologous arms had overlapping sequences >40 bp between them and the target gene to be inserted (step 4). The correctly sequenced plasmid, the gene fragment to be inserted, and upstream and downstream homologous arms are transferred into yeast using the lithium acetate method (the target fragment can be mixed thoroughly and then dried and concentrated). The yeast is then plated on SC-URA plates and cultured for 4 days to grow single colonies. Target single colonies are selected by colony PCR. The constructed yeast cells are then cultured in URA-supplemented liquid medium (such as YPD) for 2–3 days, and passaged multiple times. URA-deficient strains are screened on 5-FOA plates, thus achieving plasmid loss.

[0100] Single colonies of *Saccharomyces cerevisiae* were picked from 5-FOA plates and verified by PCR. A *Saccharomyces cerevisiae* engineered strain with the strong promoter ERG9 replaced by the weak promoter HXT1 was successfully obtained. A flowchart illustrating the process of modifying yeast chassis cells is shown below. Figure 8 .

[0101] (4) The recombinant expression vectors pESC-LEU / AtCPR / STO1 and pESC-TRP / tHMG1 / STS were transformed into the Saccharomyces cerevisiae obtained in step 3 (the method is the same as in Example 3) to obtain the engineered Saccharomyces cerevisiae that produces spirochetone.

[0102] Example 6: Production of Spirovelotone using the engineered strain of Saccharomyces cerevisiae constructed in Example 5

[0103] A single colony of the engineered Saccharomyces cerevisiae constructed in Example 5 was inoculated into 100 mL of LEU-deficient YPDA medium containing 2% glucose and cultured at 30°C with shaking for 2 days. After centrifugation, the supernatant was discarded and transferred to LEU-deficient YPD medium containing 2% galactose for fermentation for 2 days to obtain a fermentation broth containing spirovestilbene.

[0104] The fermentation broth was extracted with ethyl acetate, the organic layer was collected, and the sample of spirochetone was obtained by vacuum evaporation and concentration. The sample was analyzed and detected by GC-MS, and the detection method is the same as in Example 3.

[0105] Quantitative analysis was established using standard curves, and the results showed that the yield of spirochetone reached 291 mg / L.

[0106] In this construction method, by replacing the strong ERG9 promoter in the *Saccharomyces cerevisiae* genome with the weak HXT1 promoter, the flow of farnesyl pyrophosphate to sterols was reduced, while the carbon flow to zearalenone synthase was increased. Simultaneously, the complete spirochetone biosynthesis pathway was constructed by co-expressing the cytochrome P450 oxidase STO1 gene, the cytochrome P450 reductase gene AtCPR, the terpene synthase gene STS, and the truncated HMG-CoA reductase gene tHMG1 in *Saccharomyces cerevisiae* (see...). Figure 9 Among them, tHMG1 is the rate-limiting enzyme in the mevalonate pathway. Overexpression of this gene can increase the supply of farnesyl pyrophosphate. STS catalyzes the production of tocospiradiene from farnesyl pyrophosphate. STO1, under the electron transfer action of AtCPR, oxidizes tocospiradiene to spirospirone. This upstream and downstream multi-gene synergistic expression strategy significantly improves the biosynthetic efficiency of spirospirone.

[0107] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A Saccharomyces cerevisiae engineering bacterium for producing spiroxan, characterized in that, The strong promoter ERG9 in the genome of the engineered Saccharomyces cerevisiae is replaced with the weak promoter HXT1, and it contains the cytochrome P450 oxidase STO1 gene, the cytochrome P450 reductase gene AtCPR, the terpene synthase gene STS, and the truncated HMG-CoA reductase gene tHMG1; the amino acid sequence of the protein encoded by the cytochrome P450 oxidase STO1 gene is shown in SEQ ID No. 1, and the nucleotide sequence of the terpene synthase gene STS is shown in GenBank: AB023816.

1.

2. The method for constructing the engineered Saccharomyces cerevisiae strain according to claim 1, wherein, Includes the following steps: (1) Construct a recombinant expression vector pESC-LEU / AtCPR / STO1 containing the cytochrome P450 oxidase STO1 gene and the cytochrome P450 reductase gene AtCPR; (2) Construct a recombinant expression vector pESC-TRP / tHMG1 / STS containing a truncated HMG-CoA reductase gene tHMG1 and a terpene synthase gene STS; (3) The strong promoter ERG9 of the Saccharomyces cerevisiae genome was replaced with the weak promoter HXT1 by PCRCT-mediated gene integration. (4) The recombinant expression vectors pESC-LEU / AtCPR / STO1 and pESC-TRP / tHMG1 / STS were transformed into the Saccharomyces cerevisiae obtained in step 3 to obtain the engineered Saccharomyces cerevisiae strain that produces spirochetone.

3. A method of producing spiroxanone, characterized by: To obtain spirochete ketone by inoculating the engineered Saccharomyces cerevisiae of claim 1 or the engineered Saccharomyces cerevisiae constructed by the construction method of claim 2 into a fermentation medium for fermentation culture.

Citation Information

Patent Citations

  • Saccharomyces cerevisiae for producing cembratrienol and application of saccharomyces cerevisiae

    CN113416662A

  • Sectional treatment method for paper-making process reconstituted tobacco wastewater

    CN116058528A