Rubber grass lactation tube specific expression gene, vector, transgenic plant and application

Abstract

This invention discloses a latex duct-specific expression gene in rubber grass, including HbCPT6 , HbCPT7 and HbCPT8 , HbCPT6 The gene nucleotide sequence is shown in SEQ ID NO.1. HbCPT7 The gene nucleotide sequence is shown in SEQ ID NO.2. HbCPT8 The gene nucleotide sequence is shown in SEQ ID NO.3. This invention also discloses gene expression vectors, vector construction methods, transgenic plants, and gene applications, enabling the efficient and specific introduction of exogenous genes into rubber grass. CPT Genes can enable quantifiable and significant increases in rubber production.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a latex duct-specific expression gene in rubber grass, as well as the expression vector, transgenic plants, and applications of this gene. Background Technology

[0002] Natural rubber is a critical industrial and strategic resource. Its synthesis depends on the rubber transferase complex in the latex cells of rubber-producing plants, among which cis-isopentenyltransferase (CPT) is the core enzyme catalyzing rubber chain elongation. Rubber trees, as the primary source of natural rubber, highly express CPT in their latex cells. CPT Genes (such as) HbCPT6, HbCPT7 and HbCPT8) It has been confirmed that it is positively correlated with rubber yield. However, the long growing cycle and susceptibility to environmental constraints of rubber trees have prompted researchers to seek alternative rubber-producing plants. Rubbergrass, due to its short growth cycle, strong adaptability, and rubber quality close to that of rubber trees, is considered an ideal alternative crop. Currently, biotechnological means to increase rubbergrass yield are still limited, especially in terms of using exogenous key genes to positively enhance rubber synthesis, where effective solutions are lacking. Existing studies mostly verify CPT function in model organisms or in vitro systems, or demonstrate its necessity by inhibiting endogenous genes, but have not yet achieved heterologous expression of rubber tree rubber in rubbergrass. CPT A complete technical path to significantly improve dry rubber production through genetic engineering.

[0003] To address the aforementioned issues, existing research has attempted to utilize heterologous expression. CPT To improve rubber synthesis, Asawatreratanakul et al. (expression and characterization of cDNA encoding) cis -prenyltransferases from Hevea brasiliensis A key factor participating in natural rubber biosynthesis [J]. European Journal of Biochemistry, 2003, 270(23): 4671-4680.) Two key factors specifically expressed in rubber latex were cloned. CPT Gene HRT1 ( Hevea cis- prenyltransferase 1 Also known as HbCPT8 )and HRT2 ( Hevea cis-prenyltransferase 2 Also known as HbCPT6 They also found that prokaryotic expression of the HbCPT6 protein can enable the bottom particles after centrifugation and washing to synthesize rubber molecules. HbCPT6 and HbCPT8Heterologous expression in yeast and Arabidopsis thaliana can synthesize polypentadiene with chain lengths of C80-100, but it cannot synthesize rubber macromolecules (Post et al., 2012), as seen in Yamashita et al.'s work on "Identification and reconstitution of the rubber biosynthetic machinery on rubber particles from..." Hevea brasiliensis [J]. Elife, 2016, 5:19022-19049.) demonstrated in vitro that a multi-protein complex can enhance rubber transferase activity in rubber trees. Kwon et al. (New insights into natural rubber biosynthesis from rubber-deficient lettuce mutants expressing goldenrod orguayule) cis -prenyltransferase [J]. New Phytologist, 2023, 239(3): 1098-1111.) In lettuce, the restoration of rubber synthesis through gene complementation indicates that CPT function is somewhat conserved.

[0004] However, these existing technological solutions have significant limitations. First, the aforementioned studies have mostly focused on model plants (such as Arabidopsis thaliana and tobacco) or verifying the enzymatic activity and interactions of CPT through in vitro systems, without conducting systematic functional verification and yield assessment in alternative plants with practical rubber-producing applications (such as rubber grass). Second, even gene function studies conducted in rubber grass's close relatives (Taraxacum officinale) mainly employed gene repression strategies (such as RNAi) to demonstrate their necessity, and no successful cases of significantly increasing rubber yield through positive genetic methods (such as overexpression) have been reported. More importantly, there is a lack of research on the key genes in rubber trees that have been identified and are closely related to high yield. CPT Genes (such as) HbCPT6, HbCPT7, HbCPT8 This study aims to develop a comprehensive technical solution for latex duct-specific heterologous expression in rubber grass and to quantitatively evaluate its effect on improving dry rubber content using precise methods (such as nuclear magnetic resonance). Current technologies have not yet solved the problem of how to efficiently and specifically introduce exogenous substances into rubber grass. CPT Genes, and ultimately achieve the core industry demand of quantifiable and significant increases in rubber production. Summary of the Invention

[0005] The first objective of this invention is to provide a latex duct-specific expression gene for rubber grass by efficiently and specifically introducing exogenous genes into rubber grass. CPTGenes can enable quantifiable and significant increases in rubber production.

[0006] The second objective of this invention is to provide an expression vector for a latex duct-specific gene expression in rubber grass.

[0007] A third objective of this invention is to provide a method for constructing the aforementioned expression vector.

[0008] A fourth objective of this invention is to provide a transgenic plant that expresses a latex duct-specific gene from rubber grass.

[0009] The fifth objective of this invention is to provide the application of the above-mentioned latex duct-specific expression gene of rubber grass.

[0010] The sixth objective of this invention is to provide high-yield transgenic rubber grass plants.

[0011] The first technical solution adopted in this invention is: a latex duct-specific expression gene of rubber grass, including... HbCPT6, HbCPT7 and HbCPT8 , HbCPT6 The gene nucleotide sequence is shown in SEQ ID NO.1. HbCPT7 The gene nucleotide sequence is shown in SEQ ID NO.2. HbCPT8 The gene nucleotide sequence is shown in SEQ ID NO.3.

[0012] The second technical solution adopted in this invention is: an expression vector for a rubber grass latex duct-specific expression gene, the expression vector containing the above-mentioned expression gene and a promoter operably linked to the expression gene.

[0013] The second technical solution of the present invention is further characterized by: Furthermore, the promoter is a mammary duct-specific promoter.

[0014] The third technical solution adopted in this invention is: a method for constructing an expression vector, specifically implemented according to the following steps: (1) Target gene HbCPT6, HbCPT7, HbCPT8 Clones; (2) Through duct-specific promoters, 1Flag - 4Myc The target fragment for amplification; (3) Digest the expression vector pCAMBIA1300 with enzymes; (4) Homologous recombination: The target fragment is constructed into the linearized pCAMBIA1300 vector to obtain the recombinant plasmid; (5) Transformation of Escherichia coli using recombinant plasmids; (6) Extract plasmids from the correctly sequenced bacterial cultures to obtain recombinant vectors.

[0015] The fourth technical solution adopted in this invention is: a transgenic plant expressing a latex duct-specific gene of rubber grass.

[0016] The fifth technical solution adopted in this invention is: the application of expressing a latex duct-specific gene of rubber grass in improving rubber yield of rubber grass.

[0017] The sixth technical solution adopted in this invention is: a high-yield transgenic rubber grass plant, in which the above-mentioned latex duct-specific expression gene of rubber grass is transferred into rubber grass explants to obtain transgenic rubber grass plants.

[0018] The sixth technical solution of the present invention is further characterized by: Furthermore, the dry rubber content of the aforementioned genetically modified rubber grass plants was significantly higher than that of wild-type rubber grass.

[0019] Furthermore, the aforementioned transgenic rubber grass plants are from the p line. Thfi : 1Flag-4Myc-HbCPT6 -H-14, -19 or p Thfi : 1Flag-4Myc-HbCPT7 -H-30, -39, or p Thfi : 1Flag-4Myc-HbCPT8 -H-9, -24.

[0020] The beneficial effects of this invention are: This invention utilizes latex heterologous expression HbCPT6 , HbCPT7 and HbCPT8 It significantly increased the dry rubber content of rubber grass, proving that... HbCPT6 , HbCPT7 and HbCPT8 It positively regulates the synthesis of natural rubber.

[0021] The present invention systematically analyzes HbCPT6 , HbCPT7 and HbCPT8 The study explored the function of natural rubber in biosynthesis and created a wealth of transgenic rubber tree materials, laying the foundation for a deeper understanding of the molecular mechanism of natural rubber synthesis. Attached Figure Description

[0022] Figure 1A The rubber tree obtained in this invention HbCPT6, HbCPT7 and HbCPT8 Schematic diagram of gene sequence gel electrophoresis results; Figure 1B The invention obtained HbCPT6, HbCPT7 and HbCPT8 A schematic diagram showing the results of detecting the expression levels of genes in the roots, leaves, bark, female flowers, male flowers, latex, and seeds of the thermal research 7-33-97 using a real-time quantitative method. Figure 2 The construct obtained in this inventionHbCPT6, HbCPT7 and HbCPT8 Schematic diagram of the results of vectors specifically expressing rubber grass latex ducts; Figure 3A The genetic transformation system using rubber grass obtained in this invention has yielded... HbCPT6 , HbCPT7 and HbCPT8 A schematic diagram of the results of transgenic plants; Figure 3B The transcriptional level detection obtained in this invention HbCPT6, HbCPT7 and HbCPT8 A schematic diagram of expression level results; Figure 3C The protein level detection obtained in this invention HbCPT6, HbCPT7 and HbCPT8 A schematic diagram of expression level results; Figure 3D The invention obtained 1 A schematic diagram illustrating the results of H-NMR analysis for detecting rubber content. Detailed Implementation

[0023] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments.

[0024] This invention provides a latex-specific expression gene for rubber grass, including... HbCPT6, HbCPT7 and HbCPT8 The gene IDs are shown in the table below. HbCPT6 The gene nucleotide sequence is shown in SEQ ID NO.1. HbCPT7 The gene nucleotide sequence is shown in SEQ ID NO.2. HbCPT8 The gene nucleotide sequence is shown in SEQ ID NO.3.

[0025]

[0026] The present invention also provides an expression vector for a latex duct-specific expression gene of rubber grass, the expression vector comprising the above-described expression gene and a promoter operatively linked to the expression gene.

[0027] The promoter is a duct-specific promoter.

[0028] This invention also provides a method for constructing the above-mentioned expression vector, which is specifically implemented according to the following steps: (1) Target gene HbCPT6, HbCPT7, HbCPT8 Clones; (2) Through duct-specific promoters, 1Flag - 4Myc The target fragment for amplification; (3) Digest the expression vector pCAMBIA1300 with enzymes; (4) Homologous recombination: The target fragment is constructed into the linearized pCAMBIA1300 vector to obtain the recombinant plasmid; (5) Transformation of Escherichia coli using recombinant plasmids; (6) Extract plasmids from the correctly sequenced bacterial cultures to obtain recombinant vectors.

[0029] This invention also provides a transgenic plant expressing a latex-specific gene from rubber grass.

[0030] This invention also provides the application of expressing a latex duct-specific gene in rubber grass to improve rubber yield.

[0031] The present invention also provides a high-yield transgenic rubber grass plant obtained by the above method, wherein the latex duct-specific expression gene of rubber grass is transferred into rubber grass explants to obtain transgenic rubber grass plants.

[0032] The above-mentioned genetically modified rubber grass plants have a significantly higher dry rubber content than wild-type rubber grass.

[0033] The above-mentioned transgenic rubber grass plant, this plant is from line p Thfi : 1Flag-4Myc-HbCPT6 -H-14, -19 or p Thfi : 1Flag-4Myc-HbCPT7 -H-30, -39, or p Thfi : 1Flag-4Myc-HbCPT8 -H-9, -24.

[0034] The technical solution of the present invention will be further described below with reference to embodiments and accompanying drawings.

[0035] Example 1 Using latex cDNA from the Brazilian rubber tree (Heat-processed 7-33-97) as a template, specific primers HbCPT6-F and HbCPT6-R, HbCPT7-F and HbCPT7-R, and HbCPT8-F and HbCPT8-R were used to amplify the cDNA using the PrimerSTARHS® DNA polymerase kit, yielding products of 855bp, 891bp, and 873bp, respectively. Figure 1A As shown, Sanger sequencing analysis revealed that the amplified products were respectively related to... HbCPT6, HbCPT7 and HbCPT8 The annotation sequences were completely identical. Real-time quantitative methods were used to detect the expression levels of the three components in the roots, leaves, bark, female flowers, male flowers, latex, and seeds of *Reyan 7-33-97*, and it was found that... HbCPT6, HbCPT7 and HbCPT8 High expression in latex, such as Figure 1B As shown, and HbCPT7 and HbCPT8 It is specifically expressed in latex.

[0036] Example 2 Using duct-specific promoters, drive respectively HbCPT6, HbCPT7 and HbCPT8 The expression sequence was constructed HbCPT6, HbCPT7 and HbCPT8 In the vector specifically expressed in the latex ducts of rubber grass, namely p Thfi : 1Flag-4Myc-HbCPT6 -H, p Thfi : 1Flag-4Myc-HbCPT7 -H and p Thfi :1 Flag-4Myc-HbCPT8 -H, such as Figure 2 As shown.

[0037] Example 3 Using the genetic transformation system of rubber grass, we obtained HbCPT6, HbCPT7 and HbCPT8 Genetically modified plants, such as Figure 3A As shown. This was achieved by detecting [the virus] at both the transcriptional and protein levels. HbCPT6, HbCPT7 and HbCPT8 The expression level was found in the transgenic line p Thfi : 1Flag-4Myc-HbCPT6 -H-14, -19, p Thfi : 1Flag-4Myc-HbCPT7 -H-30, -39, and p Thfi : 1Flag-4Myc-HbCPT8 In latexes of -H-9 and -24, HbCPT6, HbCPT7 and HbCPT8 The expression levels of these cells were significantly higher than those of the wild type, such as... Figure 3B , 3C As shown.

[0038] Natural rubber was extracted from latex and analyzed by 1H-NMR. In natural rubber, hydrogen atoms bound to C2 produce a characteristic signal at a chemical shift of 5.12 ppm, such as... Figure 3D As shown, in the heterologous expression of rubber grass latex HbCPT6, HbCPT7 and HbCPT8 The peak value of the characteristic signal in the transgenic lines was significantly higher than that in the wild type. This indicates that latex heterologous expression... HbCPT6, HbCPT7 and HbCPT8 It significantly increased the dry rubber content of rubber grass.

[0039] Example 4 Milk duct-specific expression genes ( HbCPT6, HbCPT7, HbCPT8 Cloning 1. Extraction of RNA from thermally processed 7-33-97 latex 1) Pipette 10 ml of 2× latex RNA extraction buffer (Table 1) into a 50 mL centrifuge tube treated with 1‰ DEPC (soaked overnight in water containing 1‰ DEPC). Collect 10 mL of fresh latex in the tube, mix well, add 20 ml (water saturated) phenol:chloroform:isoamyl alcohol (25:24:1), vortex for 5 min, and incubate on ice for 10 min. Centrifuge at 14000 rpm for 10 min at 4℃ (1‰ DEPC water: 1 mL DEPC is diluted to 1 L with double-distilled water, shake well and let stand overnight, then autoclave at 121℃ for 30 min and cool before use).

[0040] 2) Take the supernatant, add an equal volume (water-saturated) of phenol:chloroform:isoamyl alcohol (25:24:1), vortex mix for 5 min, in an ice bath for 5 min; centrifuge at 14000 rpm for 10 min at 4℃.

[0041] 3) Take the supernatant, add an equal volume of chloroform:isoamyl alcohol (24:1), vortex mix for 5 min, and incubate on ice for 5 min; centrifuge at 14000 rpm for 10 min at 4℃.

[0042] 4) Take the supernatant, add 1 / 3 volume of 8mol / L LiCl, and precipitate overnight at -20℃; centrifuge at 14000rpm for 30min at 4℃.

[0043] 5) Discard the supernatant, dissolve the precipitate in 1 mL of 1‰ DEPC water, transfer it to a 1.5 mL centrifuge tube treated with 1‰ DEPC, add 8 mol / L LiCl to make the final concentration 2 mol / L, and precipitate again overnight at -20℃; Centrifuge at 14000rpm for 30min at 4℃ (8mol / L LiCl: 135.648g LiCl was diluted to 399.8mL with double-distilled water, 200μL of 1‰ DEPC water was added, mixed thoroughly and allowed to stand overnight, then autoclaved at 121℃ for 30min and cooled for later use); 6) Discard the supernatant, dissolve the precipitate in 300 μL of 1‰ DEPC water, add 30 μL of 3mol / L NaAc (pH=5.2) (1 / 10 volume) to a final concentration of 0.3mol / L and 700 μL of anhydrous ethanol (2.5 times volume), mix well, and precipitate at -20℃ for 2 h; centrifuge at 14000 rpm for 30 min at 4℃.

[0044] 7) Discard the supernatant and wash the precipitate twice with 500 μL of pre-cooled 75% ethanol (centrifuge at 14000 rpm for 10 min each time).

[0045] 8) Discard the supernatant, let the precipitate dry on a clean bench, and finally dissolve the precipitate in an appropriate amount (20μL) of 1‰ DEPC water; store at -80℃ for later use.

[0046] Table 1. Preparation method of RNA extraction buffer

[0047] 2. Reverse transcription of latex RNA 1) Take 1 μg of latex total RNA and use the HiScript 1st Strand cDNA Synthesis kit (+ gDNAwiper) (Novozymes Biotechnology Co., Ltd., R312) reverse transcription kit to prepare the reaction system as shown in Table 2: Table 2 Reverse transcription reaction system

[0048] 2) Incubate at 42℃ for 2 min, add 4 μL of 5×HiScript II qRT SuperMix II, incubate at 37℃ for 30 min, terminate the reaction at 85℃ for 15 s, and store the obtained cDNA in a -20℃ freezer for later use.

[0049] 3. Amplification HbCPT6、HbCPT7、HbCPT8 Expression sequence reaction system and procedure Using latex cDNA from the Brazilian rubber tree (Heat Research 7-33-97) as a template, specific primers HbCPT6-F and HbCPT6-R, HbCPT7-F and HbCPT7-R, and HbCPT8-F and HbCPT8-R were used to amplify the DNA using the PrimerSTARHS® DNA polymerase kit, yielding products of 855bp, 891bp, and 873bp, respectively. Sanger sequencing analysis revealed that the amplified products were... HbCPT6、HbCPT7 and HbCPT8 The annotated sequences were completely identical; the reaction system is shown in Table 3, and the reaction procedure is shown in Table 4; the product was detected and recovered by agarose gel electrophoresis (FastPure® Gel DNAExtraction Mini Kit, Novizan Biotechnology Co., Ltd., DC301).

[0050] Table 3 PrimerSTARHS ® DNA polymerase reaction system

[0051] Table 4 PCR Amplification Program

[0052] Example 5 HbCPT6、HbCPT7、HbCPT8 Expression profile analysis 1. RNA extraction and reverse transcription The latex RNA extraction was the same as in Example 4. RNA extraction from roots, leaves, bark, female flowers, male flowers, and seeds was performed using the Tiangen RNAprep Pure Polysaccharide and Polyphenol Plant Total RNA Extraction Kit (DP441H). The reverse transcription system and procedure were the same as in Example 4.

[0053] 2. The system and reaction procedure for real-time quantitative PCR 1) Dilute the obtained cDNA 5-fold with RNase-free ddH2O, and use qPCR-HbCPT6-F and qPCR-HbCPT6-R, qPCR-HbCPT7-F and qPCR-HbCPT7-R, and qPCR-HbCPT8-F and qPCR-HbCPT8-R as primers. HbRH2b ( HQ323243 ) is the internal reference gene, as shown in Table 13. It was prepared according to the instructions of ChamQ Universal SYBR qPCR MasterMix (Novizan Biotechnology Co., Ltd., Nanjing, Q711-02 / 03) kit. The reaction system is shown in Table 5 and the reaction conditions are shown in Table 6.

[0054] Table 5 RT-qPCR reaction system

[0055] Table 6 Reaction Procedure

[0056] 2) Perform real-time quantitative PCR according to the reaction procedure shown in Table 6: The superscripts “a” and “b” in the table indicate that 40 cycles were performed during the qRT-PCR detection process.

[0057] 3) Analyze the melting curve of each sample to determine the specificity of the designed primers. HbRH2b ( HQ323243 () is the internal reference gene, and each sample is technically replicated 3 times, according to a relative expression level of 2. -Δt The expression level of the target gene was calculated using the formula, and the analysis and plotting were performed using GraphPad Prism 8 software.

[0058] Example 6 Construction of a rubber grass latex duct-specific expression vector 1. Cloning of the latex duct-specific expression promoter sequence of rubber grass This invention uses p THFI : 1303NOOI Using plasmids as templates, the lactiferous duct-specific promoter sequence was amplified using the PrimerSTARHS® DNA polymerase kit with specific primers Pcambia1300-pTHFI-F and pTHFI-Flag-R. The reaction system is shown in Table 3, and the reaction procedure is shown in Table 4. The product was detected and recovered by agarose gel electrophoresis. The product was synthesized by Sangon Biotech Co., Ltd. 1Flag - 4Myc - Linker .

[0059] 2. Amplification of the target fragment This invention is based on HbCPT6 Using the amplification product as a template, a tagged design was created. 1Flag - 4Myc - Linker Primers 2300-Linker-HbCPT6-L and pCAMBIA1300-HbCPT6 / 8-R, representing the homologous arms, were used to amplify the target fragment using the PrimerSTARHS® DNA polymerase kit. HbCPT7 Using the amplification product as a template, a tagged design was created. 1Flag - 4Myc - Linker Primers 2300-Linker-HbCPT7-L and pCAMBIA1300-HbCPT7-R, representing the homologous arms, were used to amplify the target fragment using the PrimerSTARHS® DNA polymerase kit. HbCPT8 Using the amplification product as a template, a tagged design was created. 1Flag - 4Myc - Linker Primers 2300-Linker-HbCPT8-L and pCAMBIA1300-HbCPT6 / 8-R, representing the homologous arms, were used to amplify the target fragment using the Primer STARHS® DNA polymerase kit. The reaction system is shown in Table 5, and the reaction procedure is shown in Table 6. The products were detected and recovered by agarose gel electrophoresis.

[0060] Synthetic 1Flag - 4Myc - Linker and with homologous arms HbCPT6 Using the product as a template, the DNA polymerase was amplified using the PrimerSTARHS® DNA polymerase kit with specific primers pTHFI-Flag-L and pCAMBIA1300-HbCPT6 / 8-R. 1Flag - 4Myc - HbCPT6 The product. Synthesized by the company. 1Flag - 4Myc - Linker and with homologous arms HbCPT7 Using the product as a template, the DNA polymerase was amplified using the PrimerSTARHS® DNA polymerase kit with specific primers pTHFI-Flag-L and pCAMBIA1300-HbCPT7-R. 1Flag - 4Myc - HbCPT7 The product. Synthesized by the company. 1Flag - 4Myc - Linker and with homologous arms HbCPT8 Using the product as a template, the DNA polymerase was amplified using the PrimerSTARHS® DNA polymerase kit with specific primers pTHFI-Flag-L and pCAMBIA1300-HbCPT6 / 8-R. 1Flag - 4Myc - HbCPT7 The products were obtained. The reaction system is shown in Table 7, and the reaction procedure is shown in Table 4. The products were detected and recovered by agarose gel electrophoresis.

[0061] Table 7 Primer STARHS ® DNA polymerase reaction system

[0062] 3. Linearized plasmid pCAMBIA1300 Using restriction endonucleases respectively Mfe I and Sac I. Linearized plasmid pCAMBIA1300 was used to prepare the reaction system according to the FastDigest restriction endonuclease instructions, as shown in Table 8.

[0063] Table 8 Endonuclease Reaction System

[0064] After 37℃ (2h) and 50℃ (20min), gel electrophoresis was performed to detect the target band and the target band was recovered.

[0065] 4. Construction of recombinant plasmids Using the Clon Express Ultra One Step Cloning Kit (Novizan Biosciences Co., Ltd., C115-02) homology recombination kit, the target fragment with homologous arms was constructed into the linearized pCAMBIA1300 vector. The reaction system is shown in Table 9. Table 9. Reaction system for constructing homologous arms

[0066] 50℃ (30 min).

[0067] Example 7 Recombinant plasmid transformation of Escherichia coli 1) Thaw the chemocompetent cells DH5α used for cloning on ice.

[0068] 2) Add 5 μL of recombinant product to 50 μL of competent cells, gently tap the tube wall to mix, and let stand on ice for 30 min.

[0069] 3) After heat shock in a 42℃ water bath for 45 seconds, immediately place it on ice to cool for 3 minutes.

[0070] 4) Add 900 μL of LB liquid culture medium (without antibiotics) and incubate at 37°C and 220 rpm for 1 hour.

[0071] 5) Preheat LB solid medium plates containing 50 mg / L kanamycin resistance in a 37°C incubator.

[0072] 6) Centrifuge at 5000 rpm for 5 min at room temperature and discard 900 μL of supernatant. Resuspend the bacterial culture in the remaining culture medium and gently spread it evenly on a plate containing 50 mg / L kanamycin resistance using a sterile spreader.

[0073] 7) Incubate upside down in a 37℃ incubator for 12-16 hours.

[0074] 8) After 12 hours of culture, single-clone plaques were picked from the culture medium. Using PF and PR of 1300-pThfi-1Flag-4Myc-Hbcpt6 / 7 / 8 bacteria as primers, colony PCR was performed using 2×Es Taq MasterMix (Kangwei Century Biotechnology Co., Ltd., Beijing). The reaction system is shown in Table 10, and the reaction conditions are shown in Table 11. After agarose gel electrophoresis, the plaques were further activated in 1 mL of liquid LB medium with the corresponding antibiotics and incubated at 37℃ for 6-12 hours. The correct vector bacterial culture was obtained through sequencing.

[0075] Table 10 Escherichia coli colony PCR reaction system

[0076] Table 11 Reaction Procedure

[0077] Example 8 Positive plasmid transformation of Agrobacterium 5.1 Plasmid Extraction 1) Activated and sequenced positive clone bacterial solution.

[0078] 2) Plasmids were extracted using the Fast Pure Plasmid Mini Kit (Novaza Biosciences Co., Ltd., DC201), following the instructions. The recombinant vector p was ultimately obtained. Thfi : 1Flag-4Myc- HbCPT6 p Thfi : 1Flag-4Myc-HbCPT7 p Thfi : 1Flag-4Myc-HbCPT8 The plasmid was stored at -20℃ for later use.

[0079] 5.2 Transformation of Agrobacterium (GV3101) 1) Take the competent Agrobacterium cells stored at -80℃ and let them partially melt at room temperature or in your palm for a moment. When they are in an ice-water mixture, insert them into ice.

[0080] 2) Add 0.5 μg of plasmid DNA to each 50 μL of competent cells, mix by hand by tapping the bottom of the tube, and incubate on ice for 5 minutes, then in liquid nitrogen for 5 minutes, then in a 37°C water bath for 5 minutes, and finally in an ice bath for 5 minutes.

[0081] 3) Add 700 μL of antibiotic-free LB liquid medium and incubate at 220 rpm and 28°C for 2 hours with shaking.

[0082] 4) Spread approximately 50 μL of supernatant onto an LB agar plate containing 50 mg / L kanamycin and 25 mg / L rifampicin antibiotics (without tetracycline resistance), invert the plate, and incubate at 28°C for 2 days. Incubation at 28°C for 48 hours is required.

[0083] 5) Colony PCR: Pick a single colony and perform bacterial PCR. The reaction system and reaction procedure are the same as in Table 10 and Table 11.

[0084] Select the correctly identified positive bacterial suspensions and streak them on LB solid medium (50 mg / L Kan + 25 mg / L Rif), then incubate at 28°C upside down for 2 days. Pick a single colony from the medium and transfer it to 1 mL of LB liquid medium with the same resistance, then incubate overnight at 28°C with shaking at 220 rpm.

[0085] Example 9 Genetic transformation of rubber grass 1) Cut leaves from rubber grass tissue culture seedlings Tk20 (revive easy) in a clean bench, place them in MS liquid medium, and cut the leaves into pieces.

[0086] 2) Pre-culture: Transfer the leaves to the pre-culture medium and culture them in a light-controlled culture room at 24°C for 3 days.

[0087] 3) Infection (mother liquor concentration: Kana: 50mg / mL, Rif: 50mg / mL, AS: 1mol / L (1M)) a. Small shake: Take 100 μL of Agrobacterium (stored at -80℃) + 5 mL of liquid LB (containing 50 mg / L Kan+ and 50 mg / L Rif+) (i.e., 100 mL LB + 100 μL Kan + 100 μL Rif) into a 50 mL centrifuge tube, and centrifuge at 28℃ and 220 rpm for 12-16 h; b. Secondary activation (large shaking): Add 100 mL LB (containing antibiotics) to 300 μL of small-shaking bacterial culture to a 250 mL Erlenmeyer flask, and incubate at 28℃ and 220 rpm for about 17 hours; pipette 200 μL and measure OD600: it should be 0.6-0.7; c. Preparation of infection solution: Collect bacteria in a 50mL centrifuge tube (collect approximately 50mL according to the OD value, so that the final OD600 is 0.6), centrifuge at 6000rpm at 4℃ for 10min, and discard the supernatant. Resuspend the bacterial cells in 30mL MS liquid medium, centrifuge at 6000rpm at 4℃ for 10min, and discard the supernatant. Resuspend the bacterial cells in 30mL MS liquid medium (containing 100μmol / L AS) (i.e., 1L MS + 200μL AS), and pour the resuspended bacterial cells into a 100mL Erlenmeyer flask. Adjust the OD600 of the MS liquid medium (containing AS) to approximately 0.6. d. Place the pre-cultured leaf explants into the invasion dye solution and incubate at 23°C on a shaker at 80 rpm for 20 min; remove the explants and blot off excess bacterial solution on sterile filter paper; 4) Co-culture: Transfer the infected explants to a co-culture medium and incubate in the dark at 23°C for 3 days; 5) Recovery culture: After co-culturing for 3 days, the explants were transferred to recovery culture medium and cultured in a light-controlled culture room for 7 days.

[0088] 6) Selection culture: Transfer the recovered explants to regeneration medium and carry out shoot formation culture in a light-illuminated culture room. Change the selection medium every 10 days.

[0089] 7) Rooting Culture: Break off the newly grown adventitious buds and insert them into the rooting medium with tweezers for rooting culture. Adventitious roots will grow in about two weeks. When the roots grow to about 5cm, transfer them to the subculture medium (large bottle) and change it every 2 months.

[0090] Example 10 Identification of genetically modified rubber grass 1. Extraction and reverse transcription of latex RNA from transgenic and wild-type rubber grass RNA from transgenic and wild-type rubber grass latex was extracted using the Tiangen RNAprep Pure Polysaccharide and Polyphenol Plant Total RNA Extraction Kit (DP441H), with the reverse transcription system and procedure being the same as in 1.2.

[0091] 2. Real-time quantitative systems and reaction procedures The quantitative primers were qPCR-HbCPT6-F and qPCR-HbCPT6-R, qPCR-HbCPT7-F and qPCR-HbCPT7-R, and qPCR-HbCPT8-F and qPCR-HbCPT8-R. TkREF ( evm.model.LG01.5808 The target gene was used as an internal reference gene. Each sample was subjected to three technical replicates. The expression level of the target gene was calculated using the formula: relative expression level = 2 - Δt. GraphPad Prism 8 software was used for analysis and graphing. The reaction system and reaction procedure were the same as those in Table 5 and Table 6, respectively.

[0092] 3. Extraction of latex proteins from genetically modified and wild-type rubber grasses 1) Take a leaf of appropriate size (about the size of a little fingernail, not too large) and put it into a 2mL centrifuge tube, and write the number on it; 2) After placing the steel balls, quickly freeze in liquid nitrogen, then grind or use a sample grinding machine; 3) Add 60 μL of plant protein lysis buffer (5×SDS-PAGE loading buffer) (too much will dilute the extracted protein), and mix well; 4) Boil at 95℃ or boiling water for 10 minutes, then on ice for 2 minutes, at 4℃ and 12000 rpm for 10 minutes (the supernatant after centrifugation is the extracted protein; any unused portion can be stored at -20℃). Table 12 5×SDS-PAGE loading buffer configuration table

[0093] 5) The extracted protein was analyzed by polyacrylamide gel electrophoresis at 80V for 2 hours to detect the target protein; 6) Transfer the membrane at 80V for 1 hour. The transfer process is carried out in 1× electrotransfer solution. First, activate the PVDF membrane in methanol for 5 minutes. Place the sponge, filter paper, and gel in an iron basin and soak them in 1× electrotransfer solution. Then, stack them in the following order: black-sponge-filter paper-gel-membrane-filter paper-sponge-white. 7) Seal with skim milk powder for 2 hours, then wash three times, 5 minutes each time; 8) Primary antibody: MYC blocking overnight, wash three times, 5 min each time; 9) Block with secondary antibody for 2 hours, then wash three times, 10 minutes each time; 10) Development, Chemi blot imaging.

[0094] Example 11 Determination of rubber content by nuclear magnetic resonance (NMR) Fresh plant roots were collected and dried in a 70℃ constant temperature drying oven for 5 days, and then weighed. The roots were then transferred again to a 70℃ constant temperature drying oven for 5 hours, and the dry weight was measured again to confirm constant weight. The dried roots were ground into powder, and approximately 100 mg of the sample (Table 13) was placed in a test tube and 10 ml of toluene solution was added for extraction. After ultrasonic dissolution at 37℃ for 30 minutes, the sample was placed in a water bath at 70℃ for 24 hours. 2 mL of the extract was transferred to a cosmetic bottle, rotary evaporated, and then internal standard / deuterated chloroform was added. After ultrasonic dissolution for 30 minutes, the extract was transferred to an NMR tube.

[0095] Table 13 Sample Sampling

[0096] The primers used in the above experiments are shown in Table 14.

[0097] Table 14 Primer Table

[0098] sequence list <110> Hainan University <120> rubber grass latex duct-specific expression genes, vectors, transgenic plants and their applications <160> 3 <170> SIPOSequenceListing 1.0 <210> 1 <211> 855 <212> DNA <213> Artificial sequence <400>ATGGAATTATACACCGGTGAGAGGCCAAGTGTGTTCAGACTTTTAGGGAAGTATATGAGAAAAGGGTTATATGGCATCCTAACCCAGGGTCCCATCCCTACTCATCTTGCCTTCATATTGGATGGAAACAGGAGGTTTGCTAAGAAGCATAAACTGCCAGAAGGAGGTGGTCATAAGGCTGGATTTTTAGCTCTTCTGAACGTGCTAACTTATTGCTATGAGTTAGGAGTGAAATATGCGACTATCTATGCCTTTAGCATCGATAATTTTCGAAGGAAACCTCATGAGGTTCAGTACGTAATGAATCTAATGCTGGAGAAGATTGAAGGGATGATCATGGAAGAAAGTATCATCAATGCATATGATATTTGCGTGCGTTTTGTTGGTAATCTGAAGCTTTTAGATGAGCCACTCAAGACCGCAGCAGATAAGATTATGAGGGCTACTGCCAAAAATTCCAAATTTGTGCTTCTCCTTGCTGTATGCTACACTTCAACTGATGAGATCGTGCATGCTGTTGAAGAATCCTCTAAGGATAAATTGAAATCCAATGAAATTTGCAACGATGGAAACGGAGATTGTGTGATTAAAATTGAGGAGATGGAGCCATATTCTGAAATAAAACTTGTAGAGCTTGAGAGAAACACTTACATAAATCCTTATCCTGATGTCTTGATTCGAACTTCTGGGGAGACCCGTCTGAGCAACTACCTACTTTGGCAGACTACTAATTGCATACTGTATTCTCCTCATGCACTGTGGCCAGAGATTGGTCTCCGACACGTGGTGTGGTCAGTAATTAACTTCCAGCGTCATTATTCTTACTTAGAGAAGCATAAGGAATACTTAAAATAA <210>2 <211>891 <212>DNA <213>Artificial Sequence <400>ATGGAAATATATACGGGTCAGAGGCCAAGTGTGTTTAGAATTTTTGGGAAATACATGAGAAAAGGGTTATATAGCATCCTAACCCAAGGTCCCATCCCTACTCATCTTGCCTTCATAATGGATGGAAACCGGAGGTTTGCTAAGAAGCACAAAATGAAAGAAGCAGAAGGTTATAAGGCAGGATATTTAGCTCTTCTGAGAACACTAACTTATTGCTATGAGTTGGGAGTGAGGTATGTAACCATTTATGCCTTTAGCATTGATAATTTTCGAAGGCAACCTCGTGAGGTTCAGTGCGTAATGAATCTAATGATGGAGAAGATTGAAGAGATTATCGTGGAAGAAAGTATCATGAATGCATATGATGTTGGCGTACGTATTGTGGGTAACCTGAATCTTTTAGATGAGCCAATCAGGATCGCAGCAGAAAAGATTATGAGGGCTACTGCCAATAATTCCAGGTTTGTGCTTCTCATTGCTGTAGCCTATAGTTCAACTGATGAGATCGTGCATGCTGTTGAAGAATCCTCTAAAGACAAATTGAACTCCAATGAAGTTTGCAACAATGGGATTGAAGCTGAACAAGAATTTAAGGAGGCAAACGGAACTGGAAACAGTGTGATTCCAGTTCAGAAGACGGAGTCATATTCTGGAATAAATCTTGCAGACCTTGAGAAAAACACCTACGTAAATCCTCATCCTGATGTCTTGATTCGAACTTCTGGGTTGAGCCGTCTAAGTAACTACCTACTTTGGCAGACTAGTAATTGCATACTGTATTCTCCTTTTGCACTGTGGCCAGAGATTGGTCTCAGGCACTTGGTATGGACAGTAATGAACTTCCAACGTCATCATTCTTATTTGGAGAAGCATAAGGAATATTTAAAATAA <210>3 <211>873 <212>DNA <213>Artificial sequence <400> ATGGAATTATACAACGGTGAGAGGCCAAGTGTGTTCAGACTTTTAGGGAAGTATATGAGAAAAGGGTTATATGGCATCCTAACCCAGGGGTCCCATCCCTACTCATCTTGCCTTCATATTGGATGGAAACAGGAGGTTTTGCTAAGAAGCATAAACTGCCAGAAGGAGGTGGTCATAAGGCTGGATTTTTAGCTCTTCTGAACGTACTAACTTATTGCTA TGAGTAGGAGTGAAATATGCGACTATCTATGCCTTTAGCATCGATAATTTTCGAAGGAAACCTCATGAGGTTCAGTACGTAATGGATCTAATGCTGGAGAAGATTGATGGGATGATCAAGGAAGAAAGTATCATCAATGCTTATGATATTTGCGTACGTTTTGTGGGTAACCTGAAGCTTTTAAGTGAGCCAGTCAAGACCGCAGCAGATAAGATTA TGAGGGCTACTGCCAACAATTCCAAATGTGTGCTTCTCCTTGCTGTGTGCTATACTTCAACTGATGAGATCGTGCATGCTGTTGAAGAATCCTCTGAATTGAACTCCAATGAAGTTTGTAACAATCAAGAATTGGAGGAGGCAAATGCAACTGGAAGCAGTACTGTGATTCAAACTGAGAACATGGAGTCGTATTCTGGAATAAAACTTGTAGACCTTGAGAAAAACACCTACATAAATCCTTATCCTGATGTTCTGATTCGAACTTCTGGGGAGACCCGTCTGAGCAACTACTTACTTTGGCAGACTACTAATTGCATACTGTATTCTCCTTATGCACTGTGGCCAGAGATTGGTCTTCGACACGTGGTGTGGTCAGTAATTAACTTCCAACGTCATTATTCTTACTTGGAGAAACATAAGGAATACTTAAAATAA

Claims

1. A latex duct-specific expression gene of rubber grass, characterized in that, include HbCPT6, HbCPT7 and HbCPT8 The HbCPT6 The gene nucleotide sequence is shown in SEQ ID NO.

1. HbCPT7 The gene nucleotide sequence is shown in SEQ ID NO.

2. HbCPT8 The gene nucleotide sequence is shown in SEQ ID NO.

3.

2. The expression vector for the latex duct-specific expression gene of rubber grass according to claim 1, characterized in that, The expression vector comprises the expression gene of claim 1, and a promoter operatively linked to the expression gene.

3. The expression vector according to claim 2, characterized in that, The promoter is a duct-specific promoter.

4. The method for constructing the expression vector according to any one of claims 2 or 3, characterized in that, The specific steps are as follows: (1) Target gene HbCPT6, HbCPT7, HbCPT8 Clones; (2) Through duct-specific promoters, 1 Flag - 4Myc The target fragment for amplification; (3) Digest the expression vector pCAMBIA1300 with enzymes; (4) Homologous recombination: The target fragment is constructed into the linearized pCAMBIA1300 vector to obtain the recombinant plasmid; (5) Transformation of Escherichia coli using recombinant plasmids; (6) Extract plasmids from the correctly sequenced bacterial cultures to obtain recombinant vectors.

5. Transgenic plants expressing a gene specifically expressed in the latex ducts of rubber grass.

6. Application of expressing latex duct-specific genes in rubber grass to improve rubber yield.

7. A high-yielding transgenic rubber grass plant, characterized in that, The transgenic rubber grass plant was obtained by transferring the latex duct-specific expression gene of rubber grass as described in claim 1 into rubber grass explants.

8. The transgenic rubber grass plant according to claim 7, characterized in that, Its dry rubber content is significantly higher than that of wild rubber grass.

9. The transgenic rubber grass plant according to claim 7, characterized in that, The plant is strain p. Thfi : 1 Flag - 4Myc-HbCPT6 -H-14, -19 or p Thfi : 1Flag-4Myc-HbCPT7 -H-30, -39, or p Thfi : 1Flag-4Myc- HbCPT8 -H-9, -24.

Images