Application of lox gene in promoting the growth and development of pectoral muscle in the rapid growth period after hatching of xiaoshan chicken and gene identification method
By using single-cell RNA sequencing technology and LOX gene screening, the problem of cellular heterogeneity in identifying the growth and development of breast muscles in Xiaoshan chickens after hatching has been solved by traditional techniques. This has enabled precise breeding of breast muscle traits in Xiaoshan chickens, improving breeding efficiency and meat quality.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- XIANGHU LABORATORY
- Filing Date
- 2026-05-22
- Publication Date
- 2026-06-19
Smart Images

Figure CN122235232A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the application of the LOX gene in promoting the growth and development of the pectoral muscles of Xiaoshan chickens during the rapid growth period after hatching and to a gene identification method, belonging to the field of biotechnology. Background Technology
[0002] Xiaoshan chickens, with their superior meat flavor and strong environmental adaptability, hold significant value in the specialized livestock and poultry farming industry. The post-hatching period is a crucial stage for the formation of pectoral muscle yield and quality in poultry. During this time, muscle fiber hypertrophy, intramuscular fat deposition, and protein conversion efficiency directly determine the pectoral muscle yield, meat quality, and feed conversion rate of marketable individuals. Therefore, systematically analyzing the molecular regulatory mechanisms of pectoral muscle growth and development in Xiaoshan chickens after hatching and accurately identifying key functional genes is of great significance for achieving synergistic improvement in the breed's growth efficiency and meat quality, enhancing its economic benefits and market competitiveness. Currently, most studies on the identification of genes related to chicken muscle development still rely on batch transcriptome sequencing technology based on tissue samples. This type of technology obtains the average expression signal of mixed cells in the tissue and cannot effectively distinguish the heterogeneous cell populations within the pectoral muscle, such as myoblasts, myosatellite cells, and myofibroblasts. Therefore, it is difficult to accurately reveal genes that play a core regulatory role in specific cell types or specific developmental time points. In addition, existing research mostly focuses on common broiler breeds, and there is a lack of research on the specific molecular mechanisms of pectoral muscle growth and development during the rapid growth period of Xiaoshan chicken, a local high-quality breed. A dedicated key gene identification system has not yet been established, which cannot meet the needs of precise breeding of pectoral muscle traits in Xiaoshan chicken.
[0003] The maturity of single-cell RNA sequencing (scRNA-seq) technology provides a powerful tool for analyzing cellular heterogeneity, mapping cell differentiation trajectories, and dynamic gene expression networks in poultry pectoral muscle development after hatching at the single-cell level. This technology can accurately identify different cell subpopulations and uncover key genes driving pectoral muscle development, potentially overcoming the limitations of traditional batch sequencing technologies. Therefore, there is an urgent need to establish a method based on single-cell sequencing technology to identify key genes for pectoral muscle growth and development during the rapid growth phase after hatching in Xiaoshan chickens. This would not only help fill research gaps in this field but also provide precise marker resources and theoretical support for molecular design breeding of Xiaoshan chickens, thereby breaking through the bottlenecks in breeding pectoral muscle yield and quality. Summary of the Invention
[0004] The purpose of this invention is to overcome the inherent limitations of existing batch transcriptome sequencing technology in analyzing cellular heterogeneity, to provide the application of the LOX (lysyl oxidase) gene in promoting the differentiation of myoblasts in chicken embryo pectoral muscles, and to provide a method for identifying key genes for pectoral muscle growth and development during the rapid growth period after hatching in Xiaoshan chickens based on single-cell sequencing technology.
[0005] The method of this invention can accurately reveal the different cell types in the postcapsulated pectoral muscle tissue and their gene expression dynamics at different developmental stages at single-cell resolution, thereby systematically screening out the core functional genes that regulate the proliferation, differentiation and myofibril formation of myogenic cells, providing new targets and key technical support for molecular breeding of Xiaoshan chicken pectoral muscle yield and quality.
[0006] The present invention achieves its objective through the following technical solutions: This invention first provides a method for screening the LOX gene and its application in promoting the growth and development of pectoral muscles in Xiaoshan chickens during their rapid growth period after hatching. The effects of inhibiting FHL1 gene expression using siRNA targeting the LOX gene were investigated on myoblast differentiation, proliferation, and myotube formation. The siRNA sequences are: sense (5'-3') GGCGGAUGUUAGAGACUAUdTdT, SEQ ID NO:1; antisense (5'-3') AUAGUCUCUAACAUCCGCCdTdT, SEQ ID NO:2.
[0007] Secondly, this invention provides a method for identifying key genes for pectoral muscle growth and development during the rapid growth period of Xiaoshan chickens after hatching based on single-cell sequencing, comprising the following steps: (1) Obtain the pectoral muscle tissue of Xiaoshan chickens after hatching and prepare a single-cell suspension; (2) Sequencing the single-cell suspension using single-cell sequencing technology to obtain single-cell transcriptome data; (3) Perform quality control, comparison and cell annotation on sequencing data to distinguish muscle satellite cells, myoblasts and myofibroblasts; (4) Identify the developmental trajectory of myogenic cells through pseudo-temporal analysis and screen for differentially expressed genes with dynamic changes; (5) Combine functional enrichment analysis and experimental verification to identify key genes that regulate the growth and development of pectoral muscles.
[0008] In step (1) of the above method, the time after hatching is the first week and the fourth week after hatching. In step (2), the single-cell sequencing technology is 10× Genomics platform sequencing. The cell annotation in step (3) is based on muscle satellite cell marker genes PAX7 and MYF5, myoblast marker genes MYOD1, MYOG and TOP2A, and myofibroblast marker genes MYBPC1, ATAC1 and TRM55. The experimental verification in step (5) includes gene interference experiments to detect cell differentiation, proliferation and myotube formation ability; the key gene is the LOX gene.
[0009] The beneficial effects of this invention are: (1) High specificity, focusing on precise analysis of pectoral muscle development: This invention specifically focuses on the pectoral muscle tissue of Xiaoshan chickens during the rapid growth period after hatching. By accurately separating myogenic cells, interference from other cell types is effectively eliminated, thereby enabling more accurate capture of specific gene expression patterns during the growth and development of pectoral muscles. The identification results obtained have higher breeding application value. (2) High resolution, revealing key genes specific to cell type: With the help of single-cell sequencing technology, the development process of pectoral muscles during the rapid growth period of Xiaoshan chickens was systematically analyzed at the single-cell level for the first time. The gene expression characteristics of muscle satellite cells, myoblasts, and mature muscle fibers were clarified. The key genes screened have cell type specificity, providing clear molecular targets for precise genetic regulation of pectoral muscle traits. (3) Clear application prospects and help promote the industrialization of breeding: The key genes identified in this study can be directly used for molecular marker-assisted breeding and gene editing breeding of Xiaoshan chicken breast muscle traits, which will help shorten the breeding cycle, realize the targeted improvement of breast muscle yield and quality, thereby enhance the market competitiveness of Xiaoshan chicken, and provide key technical support for the industrialization development of local high-quality chicken breeds. Attached Figure Description
[0010] Figure 1 To study the growth performance and morphological changes of pectoral muscle tissue in Xiaoshan chickens from 0 to 4 weeks.
[0011] Figure 2 Preparation of single-cell suspensions of chicken breast muscle tissue (1-week-old and 4-week-old) and 10x Genomics high-throughput sequencing process.
[0012] Figure 3 This is a comparison chart of single-cell RNA-seq data before and after quality control filtering.
[0013] Figure 4 Analysis of single-cell atlases of chicken pectoral muscle tissue.
[0014] Figure 5 To identify the temporal differentiation trajectory and key genes of myogenic cells.
[0015] Figure 6 This is for in vitro validation of LOX gene function. Detailed Implementation
[0016] Example 1 This embodiment describes a method for identifying key genes for pectoral muscle growth and development during the rapid growth period of Xiaoshan chickens after hatching based on single-cell sequencing, including the following steps: (1) Healthy Xiaoshan chicken hatching eggs (purchased from Hangzhou Xiaoshan Chicken Genetic Resource Farm) were selected and incubated in an intelligent incubator (temperature 37.9-38.1℃, humidity 58%-62%) until hatching. On the day of hatching (DOH), the first week after hatching (W1), the second week (W2), and the fourth week (W4), 10 healthy chicks / juvenile chickens were randomly selected each time. The pectoral muscle tissue was separated and precisely dissected in a clean bench under aseptic conditions. The individual body weight and pectoral muscle weight were weighed. After removing the fascia and blood vessels, some samples were placed in pre-cooled PBS containing 1% double antibody and temporarily stored on ice. Some samples were fixed with paraformaldehyde and embedded in paraffin for subsequent HE staining observation. The pectoral muscle rate was calculated from 0 to 4 weeks using the formula: pectoral muscle weight (g) / net weight (g).
[0017] (2) Preparation of single-cell suspension Pectoral muscle tissue samples from 1-week-old and 4-week-old infants were minced to 0.5-1 mm³ pieces and digested with a mixture of 0.2% collagenase IV and 0.1% trypsin-EDTA at 37°C with shaking. After digestion, the reaction was terminated with culture medium containing 10% fetal bovine serum. The cell suspension was filtered sequentially through 70 μm and 40 μm cell sieves. The filtrate was centrifuged at 800 rpm for 8 minutes at 4°C, the supernatant was discarded, and the cells were resuspended in PBS containing 0.5% BSA and washed three times. The final cell concentration was adjusted to 2 × 10⁶ cells / mL. 6 –4×10 6 Cells / mL. Trypan blue staining confirmed cell viability ≥92%.
[0018] (3) Library construction and sequencing Using the 10×Genomics Chromium X platform, 15 μL of qualified single-cell suspension was used to form gel beads (GEMs) via microfluidic technology. Cell lysis, mRNA capture, and barcoded cDNA synthesis were then performed in a water-in-oil system. The cDNA was amplified, fragmented (target 200-300 bp), end-repaired, A-tailed, and ligated with adapters to construct scRNA-seq libraries. The libraries were finally sequenced using PE150 sequencing on the Illumina NovaSeq X Plus platform.
[0019] (4) Data quality control and cell annotation Raw data quality control was performed using FastQC v0.11.9 to filter low-quality reads (Q20 < 92%, Q30 < 88%) and adapter sequences. Interfering data from ribosomal RNA and mitochondrial RNA (cells with mitochondrial gene percentage > 15%) were removed using Cell Ranger v7.1.0 software. The cleaned data was then aligned to the chicken reference genome (Gallus gallus 6.0) using STAR (alignment rate ≥ 85%), and abnormal cells with <300 or >5500 gene detections were filtered to obtain a high-quality expression matrix. Subsequently, the expression matrix was normalized using LogNormalization, screened for hypervariable genes, PCA dimensionality reduction, and UMAP clustering was performed using Seurat v4.3.0 software. Finally, cell clusters were manually annotated based on known cell type marker genes to clarify the proportion and characteristics of each cell type.
[0020] (5) Differentially expressed gene analysis and key gene screening For annotated muscle satellite cells, myoblasts, and myofibrils, single-cell differentiation trajectories were constructed along the developmental timeline. Cells were then subjected to pseudo-time sorting using the Monocle2 algorithm to identify differentially expressed genes that showed significant dynamic changes during development, particularly key "turning point genes" regulating cell fate determination. Gene expression trends were analyzed using a generalized additive model, combined with functional annotation information, to screen for candidate key genes closely related to myogenic proliferation, differentiation, and myofibril formation. LOX was identified as one of the key genes.
[0021] (6) Functional Validation: The expression of the LOX gene in primary chicken myoblasts was interfered with by siRNA to detect cell differentiation and myotube formation capabilities, confirming the biological function of LOX in pectoral muscle growth and development. The siRNA interference experiment was performed using NulenAvianTrans transfection reagent (Nulen Biotech, catalog number CT802). When the density of primary chicken myoblasts reached approximately 70%, the procedure was performed according to the reagent instructions: the siRNA oligonucleotides and the transfection reagent were diluted separately with OPTI-MEM (Gibco, catalog number 31985062) low-serum medium, gently mixed, and incubated at room temperature for 15 minutes to form a transfection complex. The complex was added dropwise to the cell culture medium, and 6 hours after transfection, the medium was replaced with DMEM complete medium containing 10% FBS. Cells were collected at specified time points for subsequent experiments.
[0022] Real-time quantitative PCR (qRT-PCR) analysis Total RNA was extracted from tissues or cells using a kit method (TIANGEN, catalog number DP451). Following the reverse transcription kit instructions (TIANGEN, catalog number KR118-02), an equal volume of RNA was reverse transcribed into complementary DNA (cDNA). Real-time quantitative PCR was performed in a 20 μL reaction mixture containing cDNA template and 10 pmol of forward and reverse primers using an Applied Biosystems 7500 real-time quantitative PCR system. Three replicates were used for each sample. Relative mRNA expression levels were calculated using the 2^(–ΔΔCt) method. All primers were synthesized by TIANGEN Biotechnology (Nanjing, China). Primer sequence LOX: TCCACCTACGTGCAGAGGAT / ATCTCAGGAGCACTCGGTTG, SEQ ID NO: 3; MYH1B: AAGAGCCGGGAGTTTCATGG / CTGCTGTATATGCAGAGGAATCT, SEQ ID NO: 4; MYOD1: GCTACTACACGGAATCACCA / CTGGGCTCCACTGTCACTCA, SEQ ID NO: 5; MYOG: CGTGTGCCACAGCCAATG / CCGCCGGAGAGAGACCTT, SEQ ID NO: 6.
[0023] Immunofluorescence staining and analysis Cells and frozen tissue sections were fixed with 4% paraformaldehyde for 15 minutes and then permeabilized with 0.1% Triton X-100 for 10 minutes. Non-specific binding sites were blocked with 5% bovine serum albumin (BSA) at room temperature for 1 hour. Subsequently, samples were incubated with primary antibodies overnight at 4°C. After washing three times (5 minutes each) with PBST (PBS containing 0.1% Tween-20), sections were incubated with species-matched fluorescently labeled secondary antibodies at room temperature in the dark for 1 hour. Cell nuclei were counterstained with DAPI, and slides were mounted with anti-quenching mounting medium. Imaging was performed using a fluorescence microscope (ZEISS Axio Imager) or a confocal laser scanning microscope (OLYMPUS FV3000), and fluorescence intensity was quantified using ImageJ2 software (v2.14.0).
[0024] Proliferation and Cell Cycle Detection Cell proliferation was assessed using the EdU assay kit (SOLARBIO, CAT#CA1170) according to the manufacturer's instructions. The proportion of EdU-positive proliferating cells was determined by fluorescence microscopy, ImageJ2 software (v2.14.0), and flow cytometry. Cell cycle distribution was analyzed by flow cytometry using the propidium iodide (PI)-based cell cycle assay kit (SOLARBIO, catalog number CA1510) according to the manufacturer's instructions. The percentage of cells in G0 / G1, S, and G2 / M phases was determined by analyzing DNA content histograms using ModFit LT software (v3.2.1).
[0025] The results showed that the growth and development indicators of the pectoral muscles of Xiaoshan chickens exhibited a regular change after hatching: during the growth and development of Xiaoshan chickens, both the weight and percentage of the pectoral muscles showed a continuous increasing trend with increasing age. H&E staining of the pectoral muscle tissue showed that, compared with 1 week, the muscle fiber diameter was significantly larger and the structure was more mature at 4 weeks. Figure 1 Figure A shows the dynamic changes in pectoral muscle weight from hatching day (DOH) to 4 weeks of age (W4); B shows the dynamic changes in pectoral muscle percentage from hatching day to 4 weeks of age; and C shows the hematoxylin-eosin (HE) staining results of pectoral muscle tissue at different developmental stages. (Scale bar = 50 μm.) This embodiment aims to establish and optimize a single-cell RNA sequencing technology system suitable for chicken pectoral muscle tissue. It demonstrates the complete workflow from sample processing to information analysis through practice. Figure 2 ), and focused on optimizing the cell filtering strategy based on multiple quality control indicators, ultimately obtaining high-quality single-cell transcriptome data ( Figure 3 This standardized process provides reliable technical support for in-depth research on cellular heterogeneity in chicken breast muscle development at the single-cell level. This embodiment provides a complete scheme for single-cell transcriptome data analysis and biological significance mining. Using this method, a single-cell atlas of Xiaoshan chicken breast muscle was systematically mapped at single-cell resolution for the first time. Figure 4 The At-SNE dimensionality reduction visualization in the figure shows the clustering results of 11 major cell types in the pectoral muscle tissue, with different colors representing different cell types; B. Dot plot shows the expression patterns of characteristic genes of each cell type, with the size of the dot indicating the proportion of cells expressing that gene and the intensity of the color indicating the average expression level of the gene; C. Stacked bar chart compares the proportion distribution of each cell type in the pectoral muscle tissue of 1-week-old (W1) and 4-week-old (W4) cells. The developmental trajectory of myogenic cells was reconstructed, and significantly differentially expressed gene clusters regulating this process were identified. Combined with previous functional enrichment analysis and screening of differentially expressed genes along the differentiation trajectory, the LOX gene was identified. Furthermore, q-PCR results also showed that the LOX gene was upregulated with increasing age. Figure 5Figure A shows the pseudo-temporal differentiation trajectory of myogenic cells visualized using UMAP dimensionality reduction, with color gradients representing pseudo-time values; B shows the dynamic changes in the expression of key myogenesis genes along the pseudo-time axis, including muscle stem cell marker genes (PAX3, PAX7, NRG1), myoblast differentiation marker genes (MYOD1, MYOG), and mature myofiber marker genes (MYH1B, ACTA1, TNNI2, TTN); C shows the myogenic cell differentiation trajectory constructed using the Monocle2 algorithm, with different colors representing three cell types: muscle stem cells (MuSCs), myoblasts, and myofibers; D shows the expression pattern of the LOX gene along the pseudo-time axis; and E shows the expression level of the LOX gene in one-week-old and four-week-old pectoral muscle tissues verified by qPCR (R value indicates the correlation between transcriptome and qPCR results). These findings suggest that LOX is a key candidate gene regulating pectoral muscle development during the rapid growth phase after hatching in Xiaoshan chickens and can serve as a molecular marker for assessing the growth and development potential of pectoral muscles.
[0026] Example 2 LOX gene function verification This embodiment investigates the effect of a target gene on muscle growth and development. siRNA-mediated RNA interference was used to knock down the target gene in cells, followed by an EdU cell proliferation assay to assess its proliferative effect. Secondly, to evaluate the regulatory role of the target gene on myoblast differentiation, after knocking down the target gene, changes in the protein and mRNA expression levels of key markers of myoblast differentiation were detected using immunofluorescence staining and quantitative real-time polymerase chain reaction (qPCR), thereby systematically analyzing the gene's function in myoblast differentiation. The expression of the LOX gene in primary chicken myoblasts was interfered with using siRNA, and the gene's role was assessed by detecting cell differentiation and proliferation. Results showed that interfering with LOX gene expression inhibited the expression of myoblast differentiation genes and myotube formation (***). P <0.001)( Figure 6In the figure: A. qPCR verifies the knockdown efficiency of three LOX siRNAs, and selects siRNA3 with the best knockdown effect for subsequent functional experiments; B. Flow cytometry detects changes in cell cycle distribution of myoblasts after LOX gene knockdown; C. EdU staining detects myoblast proliferation capacity, with red signals representing proliferating cells and blue representing DAPI nuclear staining, scale bar = 200 μm; D. MYHIB immunofluorescence staining detects myoblast differentiation capacity, with red signals representing myotubes and blue representing DAPI nuclear staining, scale bar = 50 μm; E. Flow cytometry quantitatively analyzes the proportion of EdU-positive cells; F. qPCR detects the mRNA expression levels of key myoblast differentiation genes MYHIB, MYOD1, and MYOG, and promotes myoblast proliferation (proliferating cell proportion upregulated from 15.4% to 38%). The siRNA sequences are sense (5'-3')GGCGGAUGUUAGAGACUAUdTdT, SEQ ID NO:1; and antisense (5'-3')AUAGUCUCUAACAUCCGCCdTdT, SEQ ID NO:2. These results provide direct and precise data support for the LOX gene as a key candidate gene for improving chicken meat quality and yield, and have significant theoretical value and application potential.
Claims
1. Application of Lox gene in promoting the growth and development of pectoral muscle in Xiaoshan chicken during the rapid growth period after hatching, characterized in that: This includes applications in promoting the differentiation of myoblasts in the pectoral muscles of chicken embryos and the formation of myotubes.
2. The LOX gene for use in promoting the growth and development of pectoral muscle in the rapid growth period after hatching of Xiaoshan chickens according to claim 1, characterized in that: The LOX gene promotes myotube formation by regulating the expression of myoblast differentiation marker genes.
3. Application of Lox gene in evaluation of Xiaoshan chicken germplasm resources, characterized in that: The LOX gene was used as a candidate molecular marker to evaluate the growth and development potential of the pectoral muscle of Xiaoshan chicken.
4. Application of LOX gene in constructing the developmental trajectory of pectoral muscle myogenic cells during the rapid growth phase after hatching in Xiaoshan chickens.
5. Use of a Lox gene in the study of the function of a gene in chicken myoblast cells, characterized in that: The effect of interfering with LOX gene expression on myoblast differentiation and myotube formation.
6. Use of a Lox gene in regulating differentiation of chicken embryo pectoral muscle myoblasts, characterized in that: Myoblasts were treated with siRNA targeting the LOX gene, the sequences of which are shown in SEQ ID NO:1 and SEQ ID NO:
2.
7. A method for identifying key genes for pectoral muscle growth and development during the rapid growth period after hatching in Xiaoshan chickens based on single-cell sequencing, characterized in that... Includes the following steps: (1) Obtain the pectoral muscle tissue of Xiaoshan chickens after hatching and prepare a single-cell suspension; (2) Sequencing the single-cell suspension using single-cell sequencing technology to obtain single-cell transcriptome data; (3) Perform quality control, comparison and cell annotation on sequencing data to distinguish muscle satellite cells, myoblasts and myofibroblasts; (4) Identify the developmental trajectory of myogenic cells through pseudo-temporal analysis, and screen differentially expressed genes with dynamic changes by combining functional enrichment analysis; (5) Experimental verification to identify key genes that regulate the growth and development of pectoral muscles.
8. The method for identifying key genes for pectoral muscle growth and development during the rapid growth period after hatching in Xiaoshan chickens based on single-cell sequencing according to claim 7, characterized in that: In step (1), the time after hatching is the day of hatching, the first week after hatching, and the fourth week after hatching; in step (2), the single-cell sequencing technology is 10× Genomics platform sequencing.
9. The method for identifying key genes for pectoral muscle growth and development during the rapid growth period after hatching in Xiaoshan chickens based on single-cell sequencing according to claim 7, characterized in that: The cell annotations described in step (3) are based on muscle satellite cell marker genes PAX7 and MYF5, myoblast marker genes MYOD1, MYOG and TOP2A, and myofibroblast marker genes MYBPC1, ATAC1 and TRM55.
10. The method for identifying key genes for pectoral muscle growth and development during the rapid growth period after hatching in Xiaoshan chickens based on single-cell sequencing according to claim 7, characterized in that: The experimental verification in step (5) includes gene interference experiments to detect cell differentiation and myotube formation capabilities; the key gene is the LOX gene.