Use of prmt5 in the preparation of a product for the diagnosis and treatment of pulmonary arterial hypertension

By utilizing PRMT5 as a therapeutic target and intervening in its expression and activity with PRMT5 inhibitors, the problem of existing drugs being unable to reverse pulmonary vascular remodeling has been solved, achieving effective treatment of pulmonary hypertension.

CN122235289APending Publication Date: 2026-06-19THE NAVAL MEDICAL UNIV OF PLA

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
THE NAVAL MEDICAL UNIV OF PLA
Filing Date
2026-01-28
Publication Date
2026-06-19

AI Technical Summary

Technical Problem

Existing drugs for treating pulmonary hypertension are ineffective in reversing pulmonary vascular remodeling and have limited efficacy. There is a need to explore new molecular targets to intervene in the occurrence and development of pulmonary hypertension.

Method used

Using PRMT5 as a therapeutic target, the expression and activity of PRMT5 are intervened at the gene or drug level. PRMT5 inhibitors, such as PRMT5 gene, mRNA, cDNA, protein or its active fragment, as well as the small molecule compound EPZ015666, are used to inhibit the expression and activity of PRMT5, thereby preparing drugs for the treatment of pulmonary arterial hypertension.

Benefits of technology

It significantly reduces pulmonary vascular remodeling and right ventricular hypertrophy, improves the pathological state of pulmonary hypertension, and provides new molecular targets and treatment strategies for pulmonary hypertension.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122235289A_ABST
    Figure CN122235289A_ABST
Patent Text Reader

Abstract

This invention relates to the field of biomedical technology, providing a novel use for PRMT5, specifically its application in the preparation of products for the diagnosis and treatment of pulmonary arterial hypertension (PAH). The invention further provides a recombinant vector for a PRMT5 inhibitor, and a pharmaceutical composition for the treatment of PAH using a PRMT5 inhibitor or its recombinant expression vector as the active ingredient. This invention is the first to discover that PRMT5 expression is increased in the lung tissue of patients and models of PAH, and that intervention at the gene level (Lenti-shPRMT5) or the drug level (EPZ015666) significantly reduces the pathological damage of PAH, including pulmonary vascular remodeling and right ventricular hypertrophy, suggesting that PRMT5 plays a crucial role in the development and progression of PAH. This finding provides experimental evidence for the development of PRMT5 as a potential therapeutic target and related drugs.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biological diagnostics and pharmaceutical technology, and relates to the application of PRMT5 as a diagnostic and therapeutic target for pulmonary hypertension, specifically the application of PRMT5 in the preparation of products for the diagnosis and treatment of pulmonary hypertension. Background Technology

[0002] Pulmonary arterial hypertension (PAH) is a progressive cardiopulmonary vascular disease characterized by persistently elevated pulmonary artery pressure. This disease is primarily caused by severe remodeling of the pulmonary arterioles, manifested as excessive proliferation of vascular smooth muscle cells, endothelial cell dysfunction, and increased extracellular matrix deposition. As the disease progresses, pulmonary vascular resistance gradually increases, right ventricular load increases, and ultimately leads to right ventricular failure and death.

[0003] Currently, commonly used clinical treatments primarily target vasodilatory pathways, such as endothelin receptor antagonists, phosphodiesterase 5 inhibitors, and soluble guanylate cyclase stimulants. However, these drugs mainly exert vasodilatory effects and are unable to reverse pulmonary vascular remodeling, resulting in limited efficacy. Therefore, there is an urgent need to explore new molecular targets to intervene in the occurrence and development of pulmonary hypertension at the pathological mechanism level.

[0004] Protein arginine methyltransferase 5 (PRMT5) is a symmetrical dimethylation modifying enzyme involved in various biological processes, including gene transcription regulation, signal transduction, RNA splicing, and cell proliferation and differentiation. Recent studies have shown that PRMT5 is highly expressed in various cardiovascular diseases and inflammation-related pathological states, but its role in the pathogenesis of pulmonary hypertension and its specific mechanism of action remain unclear. Summary of the Invention

[0005] This invention is based on the above research and aims to provide a therapeutic target for pulmonary arterial hypertension (PAH) and to provide a new use for PRMT5, namely, its application in the preparation of diagnostic and therapeutic pharmaceutical compositions for pulmonary arterial hypertension.

[0006] This invention is the first to discover that PRMT5 expression is increased in the lung tissue of patients and models of pulmonary hypertension (PAH). Furthermore, intervention at the gene level (Lenti-shPRMT5) or at the drug level (EPZ015666) significantly reduced the pathological damage of PAH, including pulmonary vascular remodeling and right ventricular hypertrophy, suggesting that PRMT5 plays a crucial role in the development and progression of PAH. This finding provides experimental evidence for the development of PRMT5 as a potential therapeutic target and related drugs.

[0007] Specifically, based on the research of this invention, the following technical solution is provided:

[0008] In a first aspect, the present invention provides the application of PRMT5 as a therapeutic target for pulmonary hypertension.

[0009] In a second aspect, the present invention provides the use of PRMT5 inhibitors in the preparation of pulmonary hypertension therapeutic drugs.

[0010] Preferably, PRMT5 is selected from any of the following substances: PRMT5 gene, PRMT5 mRNA or cDNA, PRMT5 protein, or any of the aforementioned active or marker fragments.

[0011] Preferably, the PRMT5 inhibitor is selected from any of the following substances: substances that reduce PRMT5 expression levels, reduce PRMT5 activity, or promote PRMT5 metabolism. For example, the PRMT5 inhibitor may include any one of PRMT5 sgRNA and Crisper-CAS9 mRNA, small interfering RNA molecules, short hairpin RNA, antisense nucleotides, or nanoparticles, viral vectors, PEG-modified proteins, protein microspheres, liposomes, or extracellular vesicles carrying any of the above substances, and may also include small molecule compounds.

[0012] Furthermore, the target sequences of small interfering RNA molecules, short hairpin RNA, and antisense nucleotides are as follows: 5'-GGTTTCCTGTTCTTTCTAAGA-3' (SEQ ID NO.1);

[0013] The template sequence for reverse transcription (shDNA) of shRNA is as follows:

[0014] Chain of Justice: 5'GATCCGGTTTCCTGTTCTTTCTAAGATTCAAGAGATCTTAGAAAGAA

[0015] CAGGAAACCTTTTTTG-3' (SEQ ID NO. 2);

[0016] Antonym chain: 5'AATTCAAAAAAGGTTTCCTGTTCTTTCTAAGATCTCTTGAATCTT

[0017] AGAAAGAACAGGAAACCG-3' (SEQ ID NO. 3).

[0018] The small molecule inhibitor of PRMT5 was selected from EPZ015666.

[0019] The full-length sequences or fragments of the PRMT5 sgRNA and CRISPR-Cas9 mRNA of the present invention can generally be obtained by PCR amplification, recombination, or artificial synthesis. For PCR amplification, primers can be designed based on the nucleotide sequences disclosed in the present invention to amplify the relevant sequences. When the sequences are long, it is often necessary to perform two or more PCR amplifications, and then splice the fragments amplified from each amplification in the correct order.

[0020] It should be understood that the PRMT5 molecule described herein is preferably derived from humans. Other PRMT5 molecules derived from other animals that are highly homologous to human PRMT5 (e.g., having more than 70%, 75%, 80%, more preferably more than 85%, such as 85%, 90%, 95%, 98%, or even 99% or more sequence identity) are also within the scope of the preferred consideration in this invention. Methods and tools for comparing sequence identity are also well known in the art, such as BLAST.

[0021] A second aspect of the present invention provides a recombinant vector for inhibiting PRMT5 gene expression, comprising an expression vector and a coding sequence for inhibiting PRMT5 gene expression inserted into the expression vector. The target sequence of the coding sequence is shown in SEQ ID NO. 1 above, preferably an sgRNA, Crisper-CAS9 mRNA, PRMT5 siRNA, PRMT5 shRNA, or antisense nucleotide targeting the target sequence.

[0022] In a third aspect, the present invention provides the application of the above-mentioned PRMT5 inhibitor recombinant vector in the preparation of pulmonary hypertension therapeutic drugs.

[0023] In a fourth aspect, the present invention provides a pharmaceutical composition for the treatment of pulmonary arterial hypertension, comprising an active component and a medically acceptable excipient, carrier, or diluent. The active component is the aforementioned PRMT5 inhibitor or a recombinant PRMT5 inhibitor carrier.

[0024] That is, the present invention provides a pulmonary hypertension treatment product, comprising:

[0025] (A) Inhibitors of PRMT5;

[0026] (B) Pharmaceutically or immunologically acceptable carriers or excipients;

[0027] (C) Optionally, one or more other active ingredients for treating pulmonary hypertension.

[0028] The term "pharmaceutically / immunologically acceptable" refers to a substance that is suitable for use in humans and / or animals without excessive adverse side effects (such as toxicity, irritation, and allergic reactions), i.e., a reasonable benefit / risk ratio. As used herein, the term "effective amount" refers to an amount that is functional or active in humans and / or animals and is acceptable to humans and / or animals.

[0029] The term "pharmaceuticalally acceptable carrier" refers to a carrier used for the administration of therapeutic agents, including various excipients and diluents. This term refers to pharmaceutical carriers that are not essential active ingredients themselves and do not cause excessive toxicity after administration. Suitable carriers are well known to those skilled in the art. A thorough discussion of pharmaceutically acceptable excipients can be found in Remington's Pharmaceutical Sciences (Mack Pub. Co., NJ 1991).

[0030] Pharmaceutically acceptable carriers in the composition may contain liquids such as water, saline, glycerol, and ethanol. Additionally, these carriers may contain auxiliary substances such as fillers, disintegrants, lubricants, glidants, effervescent agents, wetting agents or emulsifiers, flavoring agents, pH buffers, etc. Typically, these substances are formulated in a non-toxic, inert, and pharmaceutically acceptable aqueous carrier medium, with a pH usually around 5-8, preferably around 6-8.

[0031] The compositions of the present invention can be in solid form (such as granules, tablets, lyophilized powders, suppositories, capsules) or liquid form (such as oral liquids, injectable formulations) or other suitable forms. The administration routes can be: (1) direct naked DNA / RNA injection; (2) linking PRMT5 molecule-related sgRNA and CRISPR-Cas9 mRNA with transferrin / poly-L-lysine complex to enhance their biological effects; (3) forming complexes between PRMT5 sgRNA and CRISPR-Cas9 mRNA and positively charged lipids to overcome the difficulty of crossing the cell membrane caused by the negative charge of the phosphate backbone; (4) encapsulating PRMT5 sgRNA and CRISPR-Cas9 mRNA with liposomes to mediate their entry into the cell, which is conducive to the smooth entry of macromolecules and avoids the hydrolysis of various extracellular enzymes; (5) binding PRMT5 sgRNA and CRISPR-Cas9 mRNA with cholesterol increases their cytoplasmic retention time by 10 times; (6) transporting PRMT5 sgRNA and CRISPR-Cas9 mRNA with immunoliposomes can specifically transport them to target tissues and target cells; (7) combining PRMT5 sgRNA and CRISPR-Cas9 mRNA with liposomes to enhance their biological effects. mRNA transfection into regenerating cells (such as fibroblasts) can also effectively deliver related drugs into target cells; (8) Electroporation, which uses electric current to introduce PRMT5 sgRNA and CRISPR-Cas9 mRNA into target cells.

[0032] As used in this invention, the term "unit dosage form" refers to a dosage form in which the composition of this invention is prepared for a single dose for ease of administration, including but not limited to various solid dosage forms (such as tablets), liquid dosage forms, capsules, and sustained-release formulations.

[0033] It should be understood that the effective dose of the active substance used can vary depending on the severity of the condition of the patient being treated. The specific dosage is determined based on the individual patient's circumstances (e.g., weight, age, physical condition, and desired outcome), within the judgment of a skilled physician.

[0034] In some embodiments, the present invention also provides a treatment method for pulmonary hypertension, the method comprising administering a therapeutically effective amount of a PRMT5 inhibitor to the subject in need.

[0035] In a fifth aspect, the present invention provides the application of a reagent for detecting PRMT5 expression levels in the preparation of a diagnostic kit for pulmonary hypertension.

[0036] Conventional detection methods in the biological field, such as PCR, high-throughput sequencing, and protein detection methods (immunohistochemistry, immunofluorescence, and Western blotting), are all suitable for this invention. Therefore, the reagents for detecting PRMT5 expression levels are preferably the same as those used in the above-mentioned methods.

[0037] The present invention adopts the above technical solution and has the following technical effects compared with the prior art:

[0038] This invention is the first to demonstrate that PRMT5 expression is increased in the lung tissue of patients and models of pulmonary hypertension (PAH). By inhibiting or reducing PRMT5 expression or activity, the pathological state of PAH can be effectively improved, and pulmonary vascular remodeling and right ventricular dysfunction can be significantly alleviated. This invention reveals the important role of PRMT5 in the development and progression of PAH and provides a novel molecular target and therapeutic strategy for the prevention and treatment of PAH. Attached Figure Description

[0039] Figure 1 Comparison of PRMT5 expression levels in lung tissues of patients with idiopathic pulmonary arterial hypertension (IPAH) and controls: A, sequencing results comparison; B, protein and histochemical detection; C, immunohistochemistry and immunofluorescence detection.

[0040] Figure 2 Expression levels of PRMT5 in lung tissue of PAH models induced by monocrotaline (MCT) and Sugen5416+ hypoxia (Su / Hy): A, B, expression of RVSP and right ventricular hypertrophy index (Fulton index) in the MCT group; C, D, expression of RVSP and Fulton index in the Su / Hy group; E, protein and histochemical detection; F, immunohistochemistry and immunofluorescence detection.

[0041] Figure 3 To construct a novel hairpin-shaped shRNA secondary structure (Lenti-shPRMT5) targeting the PRMT5 target sequence using lentivirus as a vector (A) and to verify the inhibitory efficiency of PRMT5 mRNA expression at the qPCR level (B).

[0042] Figure 4To improve pulmonary vascular remodeling in a rat model of MCT-induced PAH by inhibiting PRMT5 expression: A, Experimental process of the mouse model; B, C, Expression of RVSP and right ventricular hypertrophy index (Fulton index) in mice after inhibiting PRMT5 expression; D, Comparison of α-SMA staining results between CTL and MCT groups; E, Comparison of the ratio of pulmonary arteriolar wall thickness to hypertrophy (PAT / PET) between CTL and MCT groups; F, Comparison of pulmonary arteriolar wall thickness (TAPSE) between CTL and MCT groups; G, Comparison of HE staining results between CTL and MCT groups; H, Comparison of PA wall thickness between CTL and MCT groups.

[0043] Figure 5 To improve pulmonary vascular remodeling in a Su / Hy-induced PAH mouse model by inhibiting PRMT5 enzyme activity with the small molecule drug EPZ015666: A, experimental procedure in the mouse model; B, C, EPZ015666 improving RVSP in Su / Hy mice; D, EPZ015666 improving Fulton index in Su / Hy mice; E, EPZ015666 improving PAT / PET in Su / Hy mice; F, EPZ015666 improving pulmonary arteriole wall thickness (TAPSE) in Su / Hy mice; G, EPZ015666 improving PA wall thickness in Su / Hy mice. Detailed Implementation

[0044] The present invention will now be described in detail with reference to the embodiments and accompanying drawings, but the implementation of the present invention is not limited thereto.

[0045] All reagents and raw materials used in this invention are commercially available or can be prepared according to literature methods. Experimental methods in the following examples, unless otherwise specified, are generally performed under standard conditions or as recommended by the manufacturer.

[0046] This invention systematically evaluates the expression of PRMT5 in PAH and the effect of its inhibition on PAH phenotype by combining human samples and animal models with molecular biology, histopathology, hemodynamics and functional indicators.

[0047] This invention is mainly described in five parts:

[0048] (1) Expression and localization of PRMT5 in lung tissue of human iPAH patients;

[0049] (2) Expression and localization of PRMT5 in lung tissue of a rodent PAH animal model;

[0050] (3) The shPRMT5 vector was constructed using lentivirus. The hairpin structure of shRNA was designed with the PRMT5 target sequence and verified by qPCR. The results showed that Lenti-PRMT5 could improve hemodynamics, right ventricular hypertrophy and pulmonary artery remodeling in MCT-induced PAH rats.

[0051] (4) The use of small molecule PRMT5 inhibitor (EPZ015666) can reverse the hemodynamics, right ventricular hypertrophy and pulmonary vascular remodeling in Su / Hy induced PAH mice.

[0052] I. Expression and localization of PRMT5 in lung tissue of human iPAH patients

[0053] 1. Case / Control and Sample Source

[0054] In accordance with the aforementioned recruitment protocol, confirmed iPAH patients (n=5) and matched healthy control lung tissues (e.g., normal lung tissue from the distal end of lung cancer surgery or autopsy controls, n=3) were selected. All tissue collection was conducted with the approval of the ethics committee and with written informed consent obtained.

[0055] 2. Tissue processing and preservation: Fresh lung tissue was taken, a portion of which was fixed with 4% paraformaldehyde and embedded in paraffin, and the other portion was flash-frozen in liquid nitrogen and stored at –80°C for protein / nucleic acid detection.

[0056] 3. Detection Method

[0057] Immunohistochemistry and immunofluorescence: Sections were warmed, dewaxed, rehydrated with gradient alcohol, and subjected to antigen retrieval with EDTA buffer (microwave oven); after blocking endogenous peroxidase and non-specific binding, they were incubated with anti-PRMT5 primary antibody (CY5454, 1:200), followed by secondary antibody, and finally DAPI staining was performed for immunofluorescence; human lung tissue was used as a control; semi-quantitative assessment of PRMT5 expression in the distal pulmonary artery wall was performed, or the PRMT5 staining intensity and the proportion of positive cells were statistically analyzed using image analysis software (ImageJ), and reported as average fluorescence density.

[0058] Western blot: Total protein was extracted from frozen tissues, separated by SDS-PAGE, transferred to a membrane, and detected using anti-PRMT5 antibody. GAPDH was used as an internal control. The differences between the control group and the IPAH group were statistically analyzed.

[0059] The results are as follows Figure 1 The results showed that the expression level of PRMT5 in the lung tissue of iPAH patients was significantly higher than that in the healthy control group (P<0.001). Figure 1A). Immunohistochemical and immunofluorescence results showed that PRMT5 was mainly located in the smooth muscle layer and endothelial cells of pulmonary arterioles, and immunofluorescence showed that the proportion of PRMT5-positive cells in the smooth muscle cells of the distal pulmonary arteries of iPAH patients was significantly increased. Figure 1 C); Protein and histochemical results confirmed that PRMT5 was significantly upregulated in the lung tissue of iPAH patients, mainly in smooth muscle cells (C). Figure 1 B).

[0060] II. PRMT5 expression in the PAH model

[0061] Animals and Models: Male SD rats (8–10 weeks old) were randomly assigned to two groups: 1) PAH was induced by a single dose of monocrotaline (MCT): a single subcutaneous injection of MCT (50 mg / kg); the control group received an equal volume of saline. Right ventricular pressure and hypertrophy were assessed via right heart catheterization at the endpoint after model establishment (4 weeks). 2) PAH was induced by Sugen5416 + hypoxia (Su / Hy): after 3 weeks of intraperitoneal injection (20 mg / kg) followed by 2 weeks of normoxic treatment, right ventricular pressure and hypertrophy were assessed via right heart catheterization.

[0062] Tissue and Detection: PRMT5 protein expression in lung tissues of the MCT group and the control group was compared. Co-staining of PRMT5 with vascular remodeling-related markers (α-SMA) could be simultaneously detected to clarify the localization of PRMT5 expression.

[0063] The results are as follows Figure 2 As shown, in rat PAH models induced by cylindrical alkaloid (MCT) and Sugen+hypoxia (Su / Hy), the expression level of PRMT5 in lung tissue was significantly increased (P<0.05). Compared with the control group, the expression of PRMT5 in the distal pulmonary artery of the MCT group and the Su / Hy group was significantly increased, suggesting that PRMT5 plays a promoting role in the occurrence and development of PAH.

[0064] III. Lentivirus-mediated PRMT5 silencing intervention in an MCT rat model

[0065] 1. Lentiviral construction

[0066] A novel hairpin-shaped shRNA structure was designed targeting the PRMT5 target sequence, with a calculated free energy of -36.1 kcal / mol, indicating its stable formation in vivo. After in vitro synthesis, the shRNA sequence was packaged into a lentiviral structure via genetic engineering. Following in vivo infection and expression, a stable hairpin-shaped structure was formed. This structure further assembles automatically in vivo into an antisense sequence targeting the endogenous PRMT5 target sequence, inducing PRMT5 mRNA degradation and inhibiting PRMT5 expression at both the mRNA and protein levels. The final transcription product is a short hairpin RNA structure, and its sequence details are shown in Table 1 below.

[0067] Table 1 PRMT5 target sequence and shRNA sequence

[0068]

[0069] Simultaneously, a control vector (Lenti-empty vector, Lenti-EV) was constructed; Lenti-shPRMT5 expression was verified by transfection in primary smooth muscle cells (qPCR).

[0070] The results are as follows Figure 3 As shown, Figure 3 A represents a novel hairpin-shaped shRNA structure designed targeting the PRMT5 sequence, with a free energy of -36.1 kcal, indicating its stable formation in vivo. This shRNA sequence was synthesized in vitro and then packaged using lentiviral engineering. After in vivo infection and expression, it forms the structure shown below. Figure 3 The hairpin-like structure of A is further assembled in vivo into an antisense sequence targeting the endogenous PRMT5 target sequence, causing PRMT5 mRNA degradation and thus inhibiting PRMT5 expression. In vitro, qPCR results from primary smooth muscle cells transfected with Lenti-shPRMT5 and controls showed that Lenti-shPRMT5 significantly inhibited PRMT5 expression. Figure 3 B).

[0071] 2. Animal grouping and dosing regimen

[0072] Rats were randomly divided into four groups: Control+Lenti-EV, Control+Lenti-shPRMT5, MCT+Lenti-EV, and MCT+Lenti-shPRMT5, with approximately 5–10 rats in each group. Example of administration: Lenti-shPRMT5 lentivirus was administered intratracheally two weeks after MCT injection. The control group received an equal volume of Lenti-EV. Rats were observed and finally tested after four weeks.

[0073] Endpoint assessment: Hemodynamics: Right ventricular systolic pressure (RVSP) was measured by right heart catheterization in rats; right ventricular hypertrophy was assessed using the Fulton index (i.e., right ventricle (RV) and left ventricle plus septum (LV+S)), and the ratio of RV / (LV+S) was calculated; pulmonary artery acceleration time (PAT), pulmonary ejection time (PET), and tricuspid annular plane systolic excursion (TAPSE) were measured by echocardiography. Histology: Lung tissue was fixed, sectioned, and subjected to HE or α-smoothmuscle actin (α-SMA) immunofluorescence staining to assess distal pulmonary artery wall thickness (diameter 50–100 μm), and the lumen (outer diameter - inner diameter) / outer diameter ratio was measured.

[0074] Statistical analysis: Comparison of RVSP, Fulton index, and quantitative indicators of vascular remodeling between the MCT+Lenti-PRMT5 group and the MCT+Lenti-EV group.

[0075] The results are as follows Figure 4 As shown, lentivirus-mediated PRMT5 silencing (Lenti-shPRMT5) significantly improved the MCT-induced PAH phenotype in rats. Compared with the MCT+ control group, the right ventricular systolic pressure (RVSP) and right ventricular hypertrophy index (Fulton index) of rats in the Lenti-shPRMT5 group were significantly reduced (P<0.01), and HE and α-SMA staining showed a significant reduction in the proportion of pulmonary arteriolar wall thickening (P<0.01), indicating that PRMT5 inhibition can alleviate pulmonary artery pathological remodeling in rat PAH.

[0076] IV. Treatment of SuHy mouse model with the small molecule PRMT5 inhibitor EPZ015666

[0077] Su / Hy-induced PAH mouse model: C57BL / 6 or other strains of mice (6–8 weeks old) were randomly divided into groups; Sugen (SU5416) was injected subcutaneously or intraperitoneally (20 mg / kg) once, followed by a hypoxic environment (10% O2) for 3 weeks, and then transferred back to normoxic reoxygenation for 2 weeks. The control group was injected with solvent and kept in normoxic conditions.

[0078] EPZ015666 Dosing Regimen and Control: The PRMT5 inhibitor (EPZ015666) can be administered via intraperitoneal injection; the dosage is 80 mg / kg, administered once daily via intraperitoneal injection for 2 weeks after 3 weeks of hypoxia, while the control group is given a carrier solvent.

[0079] Assessment endpoints: As above, RVSP was measured, echocardiography (PAT / PET, TAPSE), right ventricular hypertrophy (Fulton index), and pulmonary vascular remodeling (HE) were performed and quantitative analysis was conducted.

[0080] The results are as follows Figure 5 As shown, the PRMT5 small molecule inhibitor EPZ015666 effectively improved the Su / Hy-induced PAH model in mice. The RVSP, Fulton index, and degree of pulmonary vascular remodeling in the EPZ015666 treatment group were significantly lower than those in the control group (P<0.01). HE staining showed a significant reduction in the proportion of pulmonary arteriolar wall thickening. Figure 5 (AG), suggesting that PRMT5 inhibition can improve PAH pathological changes by blocking pathological methylation signaling pathways.

[0081] V. Statistical Methods

[0082] The statistical methods used in the above experiments are as follows:

[0083] (1) Continuous variables that follow a normal distribution are represented by Mean ± SEM. The Student's t test or one-way ANOVA (multiple group comparisons) is used for intergroup comparisons. The Mann-Whitney U test or Kruskal-Wallis test is used for non-normal distributions.

[0084] (2) Perform post-hoc pairwise comparisons after multiple group comparisons (e.g., Tukey correction).

[0085] (3) P < 0.05 was considered statistically significant. All analyses were performed using software such as GraphPad Prism 8.2.

[0086] The methods for inhibiting PRMT5 in this invention are not limited to lentiviruses and EPZ015666 small molecules, but may also include siRNA, antisense oligonucleotides, CRISPR intervention, other small molecules or natural products, etc.; the routes of administration may be intravenous, intraperitoneal, oral, inhalation or local pulmonary administration, etc.

[0087] Furthermore, the applicable models of this invention are not limited to MCT and Su / Hy, but can also be extended to chronic high-flow, chronic hypoxia, or transgenic animal models.

[0088] Endpoint assessments can be expanded to include exercise capacity, myocardial function ultrasound, molecular omics / epigenomic indicators, etc.

[0089] In summary, through multi-method validation (immunohistochemistry, Western blot, qPCR, hemodynamics, and histological analysis) using the aforementioned human samples and two types of animal models, this invention demonstrates that PRMT5 expression is upregulated in PAH (including IPAH and animal models). Furthermore, downregulating PRMT5 at the gene level (Lenti-shPRMT5) or through drug inhibition (EPZ015666 small molecule) can significantly alleviate pulmonary vascular remodeling, reduce right ventricular pressure, and improve right ventricular hypertrophy. These results collectively demonstrate that PRMT5 plays a crucial regulatory role in the occurrence and development of PAH, supporting the feasibility and innovation of the invention related to "PAH treatment risk prediction using PRMT5 inhibition," and providing experimental evidence for the development of PRMT5 as a potential therapeutic target and related drugs.

[0090] The undescribed parts of this invention are the same as or implemented using existing technology. The applicant declares that this invention is illustrated through the above embodiments, but the invention is not limited to the above detailed methods, i.e., it does not mean that the invention must rely on the above detailed methods to be implemented. Those skilled in the art should understand that any improvements to this invention, equivalent substitutions of raw materials for the product of this invention, additions of auxiliary components, and selection of specific methods all fall within the protection and disclosure scope of this invention.

Claims

1. Application of PRMT5 as a therapeutic target for pulmonary hypertension.

2. Application of PRMT5 inhibitors in the preparation of drugs for the treatment of pulmonary hypertension.

3. The application according to claim 2, characterized in that: in, The PRMT5 is selected from any of the following substances: the PRMT5 gene, PRMT5 mRNA or cDNA, PRMT5 protein, or any of the aforementioned active or marker fragments. The PRMT5 inhibitor is selected from any of the following substances: substances that reduce PRMT5 expression levels, reduce PRMT5 activity, or promote PRMT5 metabolism.

4. The application according to claim 3, characterized in that: in, The PRMT5 inhibitors include any one of PRMT5 sgRNA and Crisper-CAS9 mRNA, small interfering RNA molecules, short hairpin RNA, antisense nucleotides, or nanoparticles, viral vectors, PEG-modified proteins, protein microspheres, liposomes, or extracellular vesicles carrying any of the above substances, and also include small molecule drugs.

5. The application according to claim 4, characterized in that, in, The target sequences of sgRNA, small interfering RNA molecules, short hairpin RNA, and antisense nucleotides are shown in SEQ ID NO.1; The reverse transcription template sequence of shRNA is shown in SEQ ID NO. 2 and 3; The small molecule drug was selected from the PRMT5 inhibitor EPZ015666.

6. A recombinant vector for a PRMT5 inhibitor, characterized in that, The expression vector includes an expression vector and PRMT5 sgRNA and Crisper-CAS9 mRNA, PRMT5 siRNA, PRMT5 shRNA or PRMT5 antisense nucleotide inserted into the expression vector, wherein the target sequence is shown in SEQ ID NO.

1.

7. The use of the PRMT5 inhibitor recombinant vector according to claim 6 in the preparation of pulmonary hypertension treatment drugs.

8. A pharmaceutical composition for treating pulmonary hypertension, characterized in that, This includes the active ingredient and pharmaceutically or immunologically acceptable excipients, carriers, or diluents. The active component is the PRMT5 inhibitor according to any one of claims 2 to 5 or the PRMT5 inhibitor recombinant vector according to claim 6.

9. The pulmonary hypertension treatment pharmaceutical composition according to claim 8, characterized in that, This pharmaceutical composition is used in combination with other drugs for the treatment of pulmonary hypertension.

10. Application of reagents for detecting PRMT5 expression levels in the preparation of diagnostic kits for pulmonary hypertension.