Wheat stripe rust InDel molecular marker primer and application thereof

By developing a primer set of InDel molecular markers for wheat stripe rust resistance, and utilizing PCR amplification and gel electrophoresis techniques, the problems of strong environmental dependence and long cycle in the traditional stripe rust resistance variety breeding were solved. This enabled efficient and accurate identification of disease-resistant genotypes in wheat seedlings, thus improving breeding efficiency.

CN122235366APending Publication Date: 2026-06-19SOUTHWEAT UNIV OF SCI & TECH

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
SOUTHWEAT UNIV OF SCI & TECH
Filing Date
2026-05-18
Publication Date
2026-06-19

AI Technical Summary

Technical Problem

Traditional stripe rust-resistant variety breeding relies on manual inoculation and identification in the field, which is greatly affected by environmental conditions, has unstable accuracy, a long cycle, and lacks practical molecular markers, resulting in low breeding efficiency.

Method used

We developed a primer set of InDel molecular markers for wheat stripe rust resistance, and used PCR amplification and gel electrophoresis to rapidly identify homozygous, heterozygous, and homozygous susceptible genotypes, which can be applied to the identification of disease-resistant genotypes in wheat seedlings.

Benefits of technology

It has enabled the accurate identification of wheat stripe rust genotypes, shortened the screening cycle by more than 60%, achieved a detection accuracy rate of 95%, and improved breeding efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122235366A_ABST
    Figure CN122235366A_ABST
Patent Text Reader

Abstract

This invention discloses an InDel molecular marker primer for wheat stripe rust resistance and its application, belonging to the field of molecular biotechnology. This invention develops a specific InDel molecular marker, InDel-2B5646, targeting the stripe rust resistance gene QYrPI660072.swust-2BL on wheat chromosome 2BL. The primer pair sequences are SEQ ID NO.9 and SEQ ID NO.10. This molecular marker exhibits stable and distinguishable polymorphism between the resistant donor parent PI660072 and the main cultivated varieties Mianmai 902 and Chuanmai 104. PCR detection results show a concordance rate of over 95% with field stripe rust resistance identification. Screening of resistant materials can be completed at the wheat seedling stage, shortening the screening cycle by more than 60% compared to traditional field planting identification. This provides a reliable tool for molecular-assisted breeding of wheat stripe rust-resistant varieties and can significantly improve the breeding efficiency of new stripe rust-resistant wheat varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, and in particular relates to an InDel molecular marker primer for wheat resistance to stripe rust and its application. Background Technology

[0002] Wheat is one of my country's three major staple crops, with an annual planting area consistently exceeding 350 million mu (approximately 23.3 million hectares). Its yield stability directly impacts national food security. Stripe rust, caused by *Strombus styracifolius*, is a global airborne fungal disease and the leading cause of wheat production in my country. It commonly affects over 100 million mu (approximately 6.6 million hectares) annually, with severely affected fields experiencing yield reductions exceeding 40%. It also significantly reduces the nutritional and processing quality of wheat grains. Currently, the most economical, green, and safe method for stripe rust control is planting disease-resistant wheat varieties. However, the physiological races of stripe rust mutate rapidly, and the resistance of most promoted varieties is lost after 3-5 years as dominant races change. Therefore, continuously breeding new disease-resistant wheat varieties is one of the core objectives of wheat breeding.

[0003] Traditional stripe rust resistance breeding relies on field inoculation for resistance identification. The results are highly susceptible to environmental factors such as temperature, humidity, and inoculum purity, leading to inconsistent accuracy. Furthermore, screening can only be completed after the wheat has developed symptoms during the jointing and heading stages, resulting in a single screening cycle of over six months and extremely low breeding efficiency. Molecular marker-assisted breeding (MAB) technology, on the other hand, can accurately identify disease-resistant genotypes at the wheat seedling stage, is not limited by environmental conditions, and can shorten the breeding cycle for disease-resistant varieties, making it the mainstream technology in the field of disease-resistant breeding. However, most of the currently identified wheat stripe rust resistance genes lack practical molecular markers that can be directly applied to breeding practices. Summary of the Invention

[0004] To address the above technical problems, this invention provides a primer set of InDel molecular markers for wheat stripe rust resistance. The primer set consists of primers with sequences as shown in SEQ ID NO. 9 and 10. The wheat is obtained through multiple hybridization and transformation processes using PI660072 as the stripe rust-resistant donor parent. Amplification using the primer set reveals the following genotypes: those exhibiting only bands at the same migration position as PI660072 are identified as homozygous resistant; those exhibiting both bands at the same migration position as PI660072 and bands at the same migration position as the recipient parent are identified as heterozygous resistant; and those exhibiting only bands at the same migration position as the recipient parent are identified as homozygous susceptible.

[0005] Preferably, the wheat is (Mianmai 902 × PI660072) × Chuanmai 104 or (Chuanmai 104 × PI660072) × Mianmai 902.

[0006] The present invention also provides a molecular detection kit for wheat resistance to stripe rust, comprising the above-mentioned primer combination.

[0007] This invention also provides the application of the above-mentioned InDel molecular marker in identifying the wheat stripe rust resistance gene QYrPI660072.swust-2BL.

[0008] This invention also provides the application of the above-mentioned InDel molecular marker primer combination in identifying the wheat stripe rust resistance gene QYrPI660072.swust-2BL.

[0009] This invention also provides the application of the above-mentioned InDel molecular marker primer combination in the identification of wheat resistant to stripe rust.

[0010] This invention also provides the application of the above-mentioned InDel molecular marker primer combination in molecular-assisted breeding of wheat for resistance to stripe rust.

[0011] This invention also provides a method for detecting the stripe rust resistance genotype of wheat QYrPI660072.swust-2BL, comprising the following steps: (1) Extract genomic DNA from the wheat material to be tested; (2) PCR amplification of the genomic DNA to be tested using the primer combination described in claim 1; (3) The PCR amplification products were detected by gel electrophoresis, with PI660072 as a positive control and the corresponding transgenic recipient parent as a negative control. The genotype was determined based on the position of the bands: Those showing only bands at the same migration positions as PI660072 are identified as homozygous disease-resistant genotypes; Those that show bands at the same migration position as PI660072 and at the same migration position as the recipient parent are identified as heterozygous disease-resistant genotypes. If only the same migration site band as the recipient parent is present, it is determined to be a homozygous genotype.

[0012] Preferably, the PCR amplification reaction system in step (2) is 10 μL: 5 μL of 2×San Taq PCR Mix, 2 μL of primer pair mixture, 2 μL of genomic DNA, and 1 μL of ddH2O; the reaction program is: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 35 s, 58℃ annealing for 35 s, 72℃ extension for 35 s, for a total of 35 cycles; and 72℃ final extension for 10 min.

[0013] Compared with the prior art, the present invention has the following beneficial effects: The InDel molecular marker provided by this invention is tightly linked to the stripe rust resistance gene QYrPI660072.swust-2BL on the wheat 2BL chromosome. It exhibits stable and distinguishable polymorphisms between the resistant parent PI660072 and the main cultivated varieties Mianmai 902 and Chuanmai 104. Detection can be rapidly completed using only conventional PCR combined with gel electrophoresis, eliminating the need for complex operations such as enzyme digestion and sequencing. This marker allows for precise identification of stripe rust resistance genotypes in early wheat growth populations, regardless of field environment or disease conditions. Compared to traditional field inoculation resistance identification, it can shorten the screening cycle by more than 60%, achieving an accuracy rate of over 95%. It can efficiently screen wheat plants carrying the target resistance gene and exhibiting excellent agronomic traits, providing a reliable tool for molecular-assisted breeding of wheat resistant to stripe rust and significantly improving the breeding efficiency of new stripe rust-resistant wheat varieties. Attached Figure Description

[0014] Figure 1 Electrophoresis diagrams of the wheat 902, PI660072, Sichuan wheat 104 and AvS InDel labeled in Example 2. Detailed Implementation

[0015] Example 1: Molecular marker development and assisted selection of the stripe rust resistance gene QYrPI660072.swust-2BL Previous studies used the AvS / PI660072 recombinant inbred line population for QTL mapping, initially mapping the stripe rust resistance gene QYrPI660072.swust-2BL throughout its entire growth period to the 376.5–682.8 Mb region of chromosome 2B. This study further developed molecular markers and will use the successfully developed markers for the identification of the transgenic population.

[0016] 1. Experimental Materials Transformation population construction: In 2023-2024, in a greenhouse, Chuanmai 104, Mianmai 902, and Yangmai 33 were used as female parents and wheat variety PI660072 was used as male parent to obtain F1 (Chuanmai 104 / PI660072, Mianmai 902 / PI660072, and Yangmai 33 / PI660072). Then, using this F1 as female parent and Chuanmai 104, Mianmai 902, and Yangmai 33 as male parent, they were used to obtain the transformed breeding population. Population F1 (Mianmai 902 / PI660072 / Chuanmai 104, Yangmai 33 / PI660072 / Chuanmai 104, Mianmai 902 / PI660072 / Yangmai 33, Chuanmai 104 / PI660072 / Yangmai 33, Yangmai 33 / PI660072 / Mianmai 902, Chuanmai 104 / PI660072 / Mianmai 902) was constructed, and this F1 population was then added to F2. The specific construction process is as follows: Wheat varieties Chuanmai 104, Mianmai 902, and Yangmai 33 were used as recipient background parents, and wheat line PI660072 was used as donor parents. Transplantation populations were constructed under greenhouse conditions in 2023-2024. Conventional wheat cultivation management was implemented in the greenhouse, including sowing, watering, fertilization, and pest and disease control, to ensure normal growth and successful heading and flowering of all parent plants. To ensure that flowering periods coincided among the parents, sowing was staggered according to the differences in the growth stages of each parent, or the heading period was regulated by adjusting greenhouse temperature, light, and water and fertilizer management to ensure that the emasculation period of the female parent was roughly consistent with the pollen shedding period of the male parent.

[0017] Before sowing the parent lines, plump, disease-free, and mechanically undamaged seeds of Chuanmai 104, Mianmai 902, Yangmai 33, and PI660072 were selected and sown in greenhouse cultivation pots or troughs after routine surface disinfection. Each parent line was planted in a separate area and clearly labeled with the parent name, sowing date, planting batch, and plant number. Physical isolation was maintained between the materials during plant growth to prevent pollen mixing. After heading, robust plants with normal plant type and uniform ear development were selected as the hybrid parents.

[0018] First, initial hybridization was conducted. Chuanmai 104, Mianmai 902, and Yangmai 33 were used as female parents, and PI660072 as the male parent, to create three hybrid combinations: Chuanmai 104 / PI660072, Mianmai 902 / PI660072, and Yangmai 33 / PI660072. The specific procedure was as follows: Artificial emasculation was performed when the female parent's ear had emerged but had not yet naturally flowered, and the pistils were developing normally and the anthers had not yet shed pollen. During emasculation, the main stem ear or a robust tiller ear of the female parent was selected. The unevenly developed spikelets at the top and base of the ear were removed, leaving the uniformly developed spikelets in the middle. The glumes and lemma were gently pried open with tweezers, and all anthers inside each floret were removed, taking care not to damage the stigma or ovary. Immediately after emasculation, the ears were covered with a sulfuric acid paper bag or a breathable hybridization bag, and the name of the female parent, the name of the male parent, the date of emasculation, and the ear number were clearly marked on the outside of the bag.

[0019] Pollination should be carried out 1-2 days after emasculation, when the stigma of the female parent is feathery and capable of receiving pollen. During pollination, collect fresh anthers or pollen from PI660072 on the same day, and evenly apply or shake the pollen onto the stigma of the emasculated female parent florets. Each hybrid ear should be re-bagted immediately after pollination to prevent contamination by exogenous pollen. To improve the seed set rate, a supplementary pollination can be performed on the same hybrid ear the day after the first pollination. After pollination, continue to label each ear according to the hybrid combination, recording the hybrid combination, female parent plant number, male parent plant number, pollination date, and operator.

[0020] After the hybrid ears mature, the hybrid seeds are harvested on a per-ear basis. During harvesting, each ear is threshed, dried, and stored separately; seeds from different combinations and ear numbers must not be mixed. The resulting hybrid seeds are the initial F1 hybrid seeds, corresponding to three F1 combinations: Chuanmai 104 / PI660072, Mianmai 902 / PI660072, and Yangmai 33 / PI660072. These F1 seeds are sown to obtain initial F1 hybrid plants. During the F1 plant growth period, the plant morphology, ear type, plant height, awn color, and heading date are compared with those of the parents, and obviously self-pollinated or mixed plants are removed; if necessary, molecular marker detection can be used to confirm their heterozygosity. Confirmed genuine F1 plants are used for subsequent crossbreeding.

[0021] Specifically, when F1 plants exhibit traits distinct from the self-pollinated offspring of the maternal parent, or show intermediate, paternal-biased, or identifiable heterozygous traits related to both parents, they can be preliminarily identified as true hybrid offspring. For materials with unclear phenotypes, further detection can be performed using SSR markers, SNP markers, InDel markers, or other molecular markers capable of distinguishing parental genotypes. If the tested F1 plant contains specific amplified bands or allelic variations from both the maternal and paternal parents, it is determined to be a true F1 hybrid plant. If its test results are only consistent with the maternal parent and do not contain paternal-specific fragments, it is determined to be a self-pollinated or mixed plant and should be discarded.

[0022] Genuine F1 plants confirmed by the above-mentioned conventional methods are used for subsequent crossbreeding. The above-mentioned F1 authenticity identification is only used to ensure the accuracy of the source of the hybrid offspring and is not the only identification method that limits the crossbreeding population construction method of this invention; those skilled in the art can also confirm the authenticity of F1 plants by using equivalent conventional identification methods based on distinguishable phenotypic differences between parents or known molecular markers.

[0023] Subsequently, crossbreeding was carried out. Using the initial F1 hybrids as the female parent, and another cultivar from Chuanmai 104, Mianmai 902, and Yangmai 33 as the male parent, a three-way cross was performed. However, the same cultivar as the initial female parent was not used as the male parent for the second cross, thus obtaining six F1 hybrid combinations. The specific combinations are as follows: Using the F1 plants of Mianmai 902 / PI660072 as the female parent and Chuanmai 104 as the male parent, the F1 generation of Mianmai 902 / PI660072 / Chuanmai 104 was obtained; Using the F1 plants of Yangmai 33 / PI660072 as the female parent and Chuanmai 104 as the male parent, the F1 generation of Yangmai 33 / PI660072 / Chuanmai 104 was obtained; Using the F1 plants of Mianmai 902 / PI660072 as the female parent and Yangmai 33 as the male parent, the F1 generation of Mianmai 902 / PI660072 / Yangmai 33 was obtained; Using the F1 plants of Chuanmai 104 / PI660072 as the female parent and Yangmai 33 as the male parent, the F1 generation of Chuanmai 104 / PI660072 / Yangmai 33 was obtained; Using the F1 plants of Yangmai 33 / PI660072 as the female parent and Mianmai 902 as the male parent, the F1 generation of Yangmai 33 / PI660072 / Mianmai 902 was obtained; Using the F1 plants of Chuanmai 104 / PI660072 as the female parent and Mianmai 902 as the male parent, the F1 generation of Chuanmai 104 / PI660072 / Mianmai 902 was obtained.

[0024] The above three-way combination can also be expressed as: Mianmai 902 / PI660072 / Chuanmai 104 means “(Mianmai 902×PI660072)×Chuanmai 104”; Yangmai 33 / PI660072 / Chuanmai 104 means “(Yangmai 33×PI660072)×Chuanmai 104”; Mianmai 902 / PI660072 / Yangmai 33 means “(Mianmai 902×PI660072)×Yangmai 33”; Chuanmai 104 / PI660072 / Yangmai 33 means “(Chuanmai 104×PI660072)×Yangmai 33”; Yangmai 33 / PI660072 / Mianmai 902 means “(Yangmai 33×PI660072)×Mianmai 902”; Chuanmai 104 / PI660072 / Mianmai 902 means "(Chuanmai 104×PI660072)×Mianmai 902".

[0025] The methods for emasculation, pollination, bagging, tagging, and seed harvesting in the conversion hybridization are the same as those for the initial hybridization described above. Specifically, after the initial hybrid F1 plants (serving as the female parent) produce ears, select ears that have not yet flowered and whose anthers have not yet released pollen for artificial emasculation. Immediately after emasculation, bag the ears for isolation. When the stigmas are capable of pollination, collect fresh fresh pollen from the corresponding male parents (Chuanmai 104, Mianmai 902, or Yangmai 33) for artificial pollination. After pollination, continue bagging and store the ears according to combination and individual ear numbering. Upon maturity, harvest the conversion hybrid seeds by individual ear; the resulting seeds are the conversion F1 seeds of the six conversion combinations mentioned above.

[0026] After maturity, the seeds of the transgenic hybrids are harvested on a single-ear basis, and the resulting seeds are the transgenic F1 seeds of the six transgenic combinations mentioned above. After sowing the transgenic F1 seeds, the authenticity of the obtained transgenic F1 plants can be confirmed using conventional methods in the art, including phenotypic identification and / or molecular marker identification. If the transgenic F1 plants exhibit traits distinct from the self-pollinated offspring of the initial F1 of the maternal parent, or if molecular marker detection reveals the presence of fragments from both the initial F1 of the maternal parent and the second hybrid paternal parent, they are determined to be genuine transgenic F1 plants; if they only exhibit the self-pollinated type of the maternal parent or if no fragments from the second hybrid paternal parent are detected, they are determined to be self-pollinated or mixed plants and are discarded. The transgenic F1 plants that have been confirmed to be genuine self-pollinated produce seeds, obtaining the corresponding transgenic F2 population.

[0027] Seeds from six F1 hybrid combinations were sown separately in greenhouses or isolated in the field, planted in designated areas according to combination, and each combination was individually numbered and managed. After emergence, healthy, clearly labeled plants were retained, while weak, mixed, and poorly labeled seedlings were removed. During flowering, the F1 hybrid plants were not subjected to artificial hybridization; instead, they were allowed to self-pollinate under bagging or spatial isolation conditions. To avoid contamination by foreign pollen, the main spike and strong tillers of each F1 plant were bagged before heading or flowering, or sufficient isolation distance was maintained between different combinations, and any plants of unknown origin in the field or greenhouse were promptly removed. After maturity, self-pollinated seeds were harvested individually or by combination, threshed, dried, cleaned, and numbered for preservation to obtain the corresponding F2 hybrid population seeds.

[0028] Thus, six F2 populations were ultimately obtained, namely: The F2 populations are: Mianmai 902 / PI660072 / Chuanmai 104 F2, Yangmai 33 / PI660072 / Chuanmai 104 F2, Mianmai 902 / PI660072 / Yangmai 33 F2, Chuanmai 104 / PI660072 / Yangmai 33 F2, Yangmai 33 / PI660072 / Mianmai 902 F2, and Chuanmai 104 / PI660072 / Mianmai 902 F2. All of these F2 populations originated from seeds produced by self-pollination of the corresponding F1 plants. Each combination was independently numbered and managed during hybridization, seed harvesting, sowing, self-pollination, and storage, ensuring that those skilled in the art can obtain F2 populations with consistent origins and essentially identical genetic makeup using this method.

[0029] Avocet S (AvS) is an Australian spring wheat variety that is susceptible to most races in Australia, China, the United States, and many other countries. It is often used as a recurrent parent to develop near-isogenic lines and other mapping populations for identifying stripe rust resistance.

[0030] PI660072 is a line derived from a cross between susceptible spring wheat Avocet S (AvS) and the Indian stripe rust-resistant spring wheat line PI180957, and is deposited in the National Small Grain Germplasm Bank of the USDA Agricultural Research Service. In seedling tests, PI660072 showed resistance to American races PST-114 and PST-127, moderate resistance to PST-43 and PST-100, and high resistance in naturally susceptible field conditions. Therefore, it is considered to possess all-life-cycle resistance (ASR) and high-temperature adult-stage resistance (HTAP). In China, PI660072 also showed high resistance to major Pst races in greenhouse seedling and field adult-stage tests. Previous studies have located two stripe rust resistance genes in PI660072 on chromosomes 2B and 4B, QYrPI660072.swust-2BL and QYrPI660072.swust-4BL, respectively. Field observations showed that PI660072 performed well in terms of spike length, number of spikelets, number of grains per spike, grain length, grain width, and thousand-grain weight, but its plant height was relatively high, which was not conducive to production.

[0031] Chuanmai 104 (Sichuan Approved Wheat 2012001, National Approved Wheat 2012002) is a new wheat variety bred by the Crop Research Institute of the Sichuan Academy of Agricultural Sciences using Chuanmai 42 and Chuannong 16 as parents. It was approved by Sichuan Province and the state in 2012. Chuanmai 104 combines the excellent traits of its parents, exhibiting excellent agronomical characteristics, high yield, and multiple resistances.

[0032] Mianmai 902 (Sichuan Approved Wheat 20190005) is a breakthrough variety developed by the Mianyang Academy of Agricultural Sciences and approved in 2019. It was bred over many years using Mianmai 37 / 1848 / Mai 367. It features high resistance to stripe rust, short stalks for lodging resistance, and high yield.

[0033] Yangmai 33 (National Approval Number 20210078) is a spring wheat variety bred by the Jiangsu Lixiahe Agricultural Science Research Institute through hybridization of Sumai 6 / 97G59 and Yangmai 18. It has moderate lodging resistance and full grains. It is resistant to wheat scab and highly susceptible to wheat stripe rust.

[0034] 2. Identification of bacterial strains To identify the seedling resistance of the stripe rust resistance gene QYrPI660072.swust-2BL, physiological races CYR32 and CYR34 were used for identification in the greenhouse. After natural stripe rust infection in the field, the resistance of mature plants was investigated using the fully infected susceptible variety AvS as a control.

[0035] 3. Test methods: Field Experiment Design and Disease Resistance Identification (1) Field trials In the 2024-2025 season, the F2 generation of the transplanted population was planted together with Chuanmai 104, Mianmai 902, Yangmai 33, and PI660072 in Bayi Town, Mianyang, Sichuan Province. After the susceptible control group developed sufficient disease, disease resistance was assessed at the mature stage. Plant height, spike length, and number of spikelets were also assessed at maturity. The plots were 1 m long, with approximately 10 seeds sown per row and a row spacing of 30 cm. The AvS (Average vs. Suppressed) control group served as the disease-susceptible control. Furthermore, seedlings were sown around the experimental field to increase the incidence of disease in the field.

[0036] (2) Greenhouse seedling identification Seedling Stage Identification: To identify the resistance of the stripe rust resistance gene QYrPI660072.swust-2BL in seedlings throughout the entire growth period, AvS and PI660072, as well as two families containing only the stripe rust resistance gene QYrPI660072.swust-2BL (line-5 and line-19 of the 209 recombinant inbred lines of AvS / PI660072), were selected. Under greenhouse conditions, seedlings were inoculated with CYR32 and CYR34 at the two-leaf stage. After AvS showed full disease development, seedling stage identification was performed. Six to eight seeds from each family were planted in small flowerpots. Inoculation was carried out when the wheat reached the two-leaf stage. Inoculation Method: Active stripe rust fungus was mixed evenly with talcum powder at a ratio of 1:50. After dewaxing the upper surface of the leaves with water using fingertips, the spore mixture was evenly applied with a cotton swab. An isolation cover was placed over the leaves to prevent contamination, and water was sprayed upwards so that water droplets fell onto the cover and the leaves to maintain moisture. After inoculation, the cells were placed in a dark, humidified room at 8°C for 24 hours to promote spore germination, and then transferred to a greenhouse at 16°C (photoperiod 16 h / 8 h) while maintaining suitable humidity. Once the infected control AvS had fully developed the disease, the disease incidence in each variety was investigated.

[0037] (3) Identification of stripe rust resistance in mature plants Three surveys were conducted on the initial, peak, and final stages of disease occurrence in the transferred breeding population, with the susceptible variety AvS serving as a control. Infection type (IT) was graded according to a 9-level standard: 0 for immune, 1-3 for highly resistant, 4-6 for moderately resistant, and 7-9 for susceptible. Disease severity (DS) was classified into 0, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, and 100%. Toxicity reaction types on each family and parent were recorded, with grades 0-6 representing resistant types and grades 7-9 representing susceptible types.

[0038] 4. Exon capture sequencing and marker development To further develop molecular markers closely linked to disease resistance genes, high-quality genomic DNA extracted from the disease-resistant parent PI660072 and the susceptible parent AvS was sent to Sichuan Tianling Gene Rapid Analysis Technology Co., Ltd. Exon capture technology was used to perform deep sequencing on the target regions, obtaining high-density SNP and InDel data of the parents in the whole genome exon regions.

[0039] (1) DNA extraction from wheat leaves Samples were taken from AvS, PI660072, Chuanmai 104, Mianmai 902, Yangmai 33, and the F2 generation of the transplanted population when they reached the two-leaf stage. Genomic DNA was extracted using the CTAB method.

[0040] a. Place an appropriate amount of fresh leaves into a 2 mL centrifuge tube and freeze quickly in liquid nitrogen. Use a tissue homogenizer (QIAGEN, Germany) to grind the leaves into powder.

[0041] b. Quickly add 1.5×CTAB 1000 uL of preheated solution to the centrifuge tube and shake to mix.

[0042] c. Then place the centrifuge tubes in a 65°C water bath for 1 hour, and remove the centrifuge tubes every 15 minutes, inverting them to mix.

[0043] d. After the water bath, add 200 uL of chloroform, shake to mix, and then centrifuge for 10 min (4℃, 12000 rpm) using a benchtop centrifuge (Eppendorf Centrifuge 5415R).

[0044] e. After centrifugation, take 750 μL of the supernatant into a 1.5 mL centrifuge tube and add an equal volume of pre-cooled isopropanol, then vortex to mix. At this point, white flocculent DNA will be observed precipitated.

[0045] f. Place the aspirated supernatant and isopropanol mixture in a -20°C freezer for 30 min, then centrifuge for 10 min (4°C, 12000 rpm) and discard the supernatant.

[0046] g. Add 500 μL of 75% ethanol to the centrifuge tube to wash the precipitated DNA, centrifuge for 10 min (4℃, 12000 rpm), and discard the supernatant. After air drying, add 50 μL of ddH2O to dissolve the DNA and store at 4℃.

[0047] The concentration and quality of DNA were determined using a NanoDrop ND-1000 spectrophotometer, and the DNA was stored at -20°C for long-term preservation. (2) Analysis of exon capture sequencing data First, FASTP was used for data quality control. The base data was of high quality, the sequencing results were reliable, and the data was ready for experimentation. Base content distribution was used to detect the presence of AT and GC separation in the sequencing data. Library construction and sequencing showed good uniformity, which is suitable for subsequent information analysis.

[0048] Data filtering: The raw sequencing reads obtained from sequencing are filtered using the software FastP (version 0.23.4, parameters: -n 15 -q 15 -u 40) to remove low-quality reads containing adapters, resulting in clean reads. These clean reads are then used for subsequent analysis. The processing steps are as follows: 1) Remove adapter sequence; 2) When the number of N bases in a sequencing read exceeds 15, the paired reads need to be removed; 3) When the number of low-quality (Q ≤ 15) bases in a sequencing read exceeds 40% of the length of the read, the paired reads need to be removed.

[0049] Genome alignment: Clean reads were aligned to the Chinese spring reference genome (v2.1) using the BWA-MEM algorithm to evaluate the capture efficiency of the target region.

[0050] SNP and InDel analysis: SNP variant detection was performed using GATK, a best-practice bioinformatics analysis tool, to ensure the accuracy and reliability of the data analysis. After filtering out variants with low confidence, Snpeff software was used to annotate the remaining variant sites in detail. GATK and bcftools were used to obtain the InDel sites for each sample. To ensure the reliability of the InDel sites, the obtained InDel sites were further filtered according to the following criteria: 1) Quality of Variation (QUAL) > 100 2) Sequencing depth (DP) ≥ 5; 3) Population missing rate (F_MISSING) ≤1.

[0051] (3) KASP tag design and development Based on the exon capture sequencing results of the parents AvS and PI660072, homozygous and differentially expressed SNP loci were screened within the region. A total of 13 SNP loci were screened. SNP locus sequences were obtained using the wheatomics website (https: / / wheatomics.sdau.edu.cn / ), and homologous sequences were searched and aligned using the NCBI (https: / / www.ncbi.nIm.nih.gov / ) and IWGSC (http: / / www.wheatgenome.org / ) websites. Based on the SNP sequences and the searched homologous sequences, KASP markers were developed and designed using the PolyMarker website (http: / / polymarker.tgac.ac.uk / ) and primer3plus (https: / / www.primer3plus.com / ), from which chromosome-specific markers were selected.

[0052] (4) InDel tag development Simultaneously, InDel markers were developed targeting parentally differentiated InDel sites within the physical region of the target gene on chromosome 2BL. Specific PCR primers were designed using software such as Primer3 on conserved sequences flanking the five selected InDel sites. Information on the five primers is shown in Table 1. The primers were synthesized by Shanghai Sangon Biotech Co., Ltd.

[0053] 5. Validation and application of markers in transitional populations The designed InDel marker was validated in the transgenic population, and based on the results, the transgenic population Mianmai 902 / PI660072 / Chuanmai 104 F2 was screened for those containing the marker. QYrPI660072.swust-2BL The pedigree was determined. After synthesizing primers, PCR amplification was performed according to the PCR amplification reaction system and procedure shown in Tables 2 and 3. The results were detected by agarose gel electrophoresis and polyacrylamide gel electrophoresis. The electrophoresis steps are as follows.

[0054] (1) Agarose gel electrophoresis 1) Preparation stage Prepare the mold: Clean the agarose mold and place it on a horizontal stand.

[0055] Prepare electrophoresis buffer: Prepare sufficient 1X TBE electrophoresis buffer.

[0056] Preparation of agarose solution: Prepare a 2.5% agarose solution using electrophoresis buffer and heat to dissolve.

[0057] 2) Gel preparation Cooling and mixing: Cool the heated agarose solution, add 10 μL of nucleic acid dye, and mix thoroughly.

[0058] Forming sample wells: While the agarose solution is cooling, use a comb to form sample wells at the bottom of the tray.

[0059] Gel pouring: Pour the warm agarose solution into the mold and wait for it to solidify completely to prepare the PCR product.

[0060] 3) Electrophoresis process Gel loading: Place the gel into the electrophoresis tank and add electrophoresis buffer to submerge the gel.

[0061] Sample addition: Use a micropipette to slowly add 4 μL of PCR product into the sample wells that are submerged in the gel.

[0062] Electrophoresis: Close the electrophoresis tank cover, connect the electrode plugs, set the voltage to 100 V and the time to 1 hour, and perform electrophoresis.

[0063] 4) Observation and Recording Observation results: After electrophoresis, the gel was observed using a UV lamp and the electrophoresis results were recorded by taking photographs.

[0064] Cleaning: After the experiment, clean the equipment, clean the work surface, and return the samples to their place.

[0065] (2) Polyacrylamide gel electrophoresis 1) Preparation stage: Preparation: Wash the flat plate and concave plate with clean water. Use anhydrous ethanol to clean the surface of the washed and dried flat plate and concave plate. Wipe evenly with lint-free wiping paper until clean.

[0066] Preparation of affinity silane: Add 1960 μL of anhydrous ethanol, 20 μL of affinity silane stock solution and 20 μL of glacial acetic acid to a 2.0 mL centrifuge tube.

[0067] Treatment of flat and concave plates: After thoroughly mixing the prepared affinity silane, it is evenly coated onto the surface of the flat plate. 1 mL of stripping silane solution is applied to the surface of the concave plate.

[0068] Assembly: Overlap the treated surfaces that have been coated with affinity silane and stripping silane respectively, place red isolation strips at the edges, and use special clamps to fix the middle and lower parts of the glass plate.

[0069] 2) Glue making Gel preparation: Take 60 mL of 6% polyacrylamide gel solution in a beaker, add 380 μL of 10% ammonium persulfate (AP) as a coagulant accelerator, and TEMED (tetramethylethylenediamine, C6H) as an accelerator. 16 Mix 35 μL of N2 with a glass rod until homogeneous.

[0070] Preparing the gel solution: Tilt the two assembled glass plates at a certain angle and slowly pour in the gel solution. Spread the gel solution evenly over the entire glass plate, insert a shark ruler, and secure the top with clips to prevent the gel solution from solidifying.

[0071] 3) Electrophoresis: Preheating: Remove the glass plate from the clamp, rinse it clean, and place it in the electrophoresis tank. Inject 1×TBE electrophoresis buffer and perform a seal test. After confirming that everything is correct, turn on the electrophoresis apparatus to preheat at 1200 V for 30 minutes.

[0072] Sample loading and electrophoresis: Remove air bubbles from the sample loading well using a syringe and insert the comb. Load 4 μL of PCR product per well, and add an equal amount of DNA marker to each well. Electrophoresis at 1200 V for 1 h.

[0073] 4) Staining and developing: Staining: After electrophoresis, drain the buffer solution, remove the glass plates, separate the two plates, and rinse thoroughly with water. Immerse the gel in silver nitrate solution for staining for 30 minutes, taking care to avoid light. After staining, rinse the plates again quickly in distilled water for 10 seconds.

[0074] Development: Immerse the cleaned plate in a NaOH-formaldehyde solution until the bands are clearly visible. Rinse the plate with distilled water to remove residual NaOH before recording.

[0075] Cleaning: After the experiment, clean the equipment, clean the work surface, and return the samples to their place.

[0076] Table 1 InDel marker names and primer sequence information

[0077] Table 2 PCR amplification reaction system

[0078] Table 3 Primers 2B-5646 PCR reaction procedure

[0079] 6. Experimental Results Target region sequence analysis based on exon capture sequencing (1) Quality control and filtration After quality control and filtering, the raw data yielded 163,834,640 high-quality reads for AvS and 179,756,638 for PI660072. The effective sequence data amounts were 24,539 Mb and 26,909 Mb, with effective proportions of 99.81% and 99.77%, respectively. The percentages of bases with a quality value greater than or equal to 30 (Q30) were 88.8% and 90.7%, respectively, and the GC content was 49.2% and 49.1%, respectively. This indicates that the sample data volume was sufficient, the sequencing quality was acceptable, and the GC distribution was normal (Table 4).

[0080] Table 4. Statistics of AvS and PI660072 sequencing data

[0081] a Sample: Sample name; b Clean_base (bp): Bases of high-quality reads; c Clean_reads: The number of high-quality reads; d Raw_bases (bp): Total number of bases; e Raw_reads: Total number of Reads; f Clean_bases_rate: The base ratio of high-quality reads; g Clean_reads_rate: The percentage of high-quality reads; h Q30%: The percentage of bases with an accuracy rate of over 99.9% in base identification; i GC %: GC content.

[0082] (2) Reference genome alignment Using the mem alignment algorithm in BWA software, the positions of clean reads in the Chinese Spring reference genome v2.1 were precisely located, with a focus on evaluating the capture efficiency of the target exon regions. The average sequencing coverage for each genomic locus was analyzed by calculating the sequencing depth. The alignment rates were 99.96% (AvS) and 99.98% (PI660072), indicating high data integrity and suitability for further analysis (Table 5). Table 5. Statistics of AvS and PI660072 sequence alignments

[0083] a Sample: Sample name.

[0084] bMapping Rate %: Alignment rate, the proportion of reads aligned to the reference genome out of the total number of reads.

[0085] c Average depth: The average sequencing depth of the exon region, calculated by dividing the total number of bases aligned to the exon region by the total number of bases in the exon region.

[0086] d Capture Rate %: The percentage of reads in the captured region out of the total number of reads in the captured region.

[0087] (3) SNP variation analysis 1) SNP analysis of the target region SNP variant detection was performed using GATK-based best practice bioinformatics analysis tools. After filtering out variants with low confidence, SnpEff software was used to annotate the remaining variant sites in detail. For each SNP (single nucleotide polymorphism) site, fine genotyping and annotation were performed, resulting in complete annotation results. Table 6 shows that there are 298,873 and 239,315 transition SNP sites in the exon regions of AvS and PI660072, respectively; 181,256 and 144,507 transversion SNP sites, respectively; and 146,460 and 81,789 monoclonal mutation sites, respectively. After filtering out variants with low confidence, the number of mutated SNP sites in the exon regions of AvS and PI660072 are 588,118 and 465,186, respectively (Table 7).

[0088] Table 6. Statistics of AvS and PI660072 SNP samples

[0089] a Sample: Sample name; b Total: Represents the total number of observations or data points in the sample; c nRefHom: Number of homozygous reference alleles; d nNonRefHom: Number of homozygous non-reference alleles; e nHets: Number of heterozygotes; f nMissing: Number of missing genotypes g nSingletons: Number of singlet mutation sites; h nTransitions: Number of transition mutations; i nTransversions: Number of transversion mutations.

[0090] Table 7. Statistics of AvS and PI660072 SNP annotation results

[0091] a Sample: Sample name; b Downstream: The number of SNPs in the 5 kb region downstream of the transcription termination site; c Exonic: The number of SNPs in the exon region; d Intergenic: The number of SNPs in intergenic regions; e Intron: The number of SNPs in the contained subregion; f Splice Site Region: The number of SNPs in the splice site region; g Upstream: The number of SNPs in the 5 kb region upstream of the transcription start site; h UTR 3 Prime: The number of SNPs in the 3' untranslated region of the transcript; i UTR 5Prime: The number of SNPs in the 5' untranslated region of the transcript.

[0092] 2) SNP analysis of the capture region (panel region) Exon regions were excluded, and all quality-controlled SNPs within the targeted capture region were analyzed. Table 8 shows that AvS and PI660072 had 916,706 and 785,206 SNPs undergoing transitions in the capture region, respectively; 490,546 and 408,795 transversion SNPs, respectively; and 415,349 and 276,198 monoclonal mutations, respectively. After filtering out low-confidence variants, SnpEff software was used to annotate the variant sites. The number of mutated SNPs in the exon regions of AvS and PI660072 were 549,951 and 439,030, respectively (Table 9).

[0093] Table 8. Statistics of AvS and PI660072 SNP samples

[0094] a Sample: Sample name; b Total: Represents the total number of observations or data points in the sample; c nRefHom: Number of homozygous reference alleles; d nNonRefHom: Number of homozygous non-reference alleles; e nHets: Number of heterozygotes; fnMissing: Number of missing genotypes; g nSingletons: Number of singlet mutation sites; h nTransitions: Number of transition mutations; i nTransversions: Number of transversion mutations.

[0095] Table 9. Statistics of AvS and PI660072 SNP annotation results

[0096] a Sample: Sample name; b Downstream: The number of SNPs in the 5 kb region downstream of the transcription termination site; c Exonic: The number of SNPs in the exon region; d Intergenic: The number of SNPs in intergenic regions; e Intron: The number of SNPs in the contained subregion; f Splice Site Region: The number of SNPs in the splice site region; g Upstream: The number of SNPs in the 5 kb region upstream of the transcription start site; h UTR 3 Prime: The number of SNPs in the 3' untranslated region of the transcript; iUTR 5 Prime: The number of SNPs in the 5' untranslated region of the transcript.

[0097] (4) InDel variation analysis 1) InDel analysis of exon regions (target regions) This study also detected InDel variant sites. After obtaining the InDel sites for each sample, the obtained InDel sites were further filtered to ensure their reliability. As shown in Table 10, the number of heterozygous insertion variants in AvS and PI660072 were 15473 and 11826, respectively, while the number of heterozygous deletion variants were 12316 and 10941, respectively. According to the annotation results, AvS and PI660072 have 9,012 and 7,080 InDels in the 5 kb region downstream of the transcription termination site, respectively; 32,983 and 26,885 InDels in the exon region, respectively; 137 and 117 InDels in the intergenic region, respectively; 1,460 and 1,152 InDels in the intron region, respectively; 7 and 6 InDels in the splice site region, respectively; 4,821 and 4,020 InDels in the 5 kb region upstream of the transcription start site, respectively; 385 and 284 InDels in the 3' untranslated region of the transcript, respectively; and 373 and 299 InDels in the 5' untranslated region of the transcript, respectively (Table 11).

[0098] Table 10. Statistics of AvS and PI660072 InDel Samples

[0099] a Sample: Sample name; b Total: Represents the total number of observations or data points in the sample; c nRefHom: Number of homozygous reference alleles; d nInsHets: Number of heterozygotes with insertion mutations; e nDelHets: Number of heterozygotes with deletion variants; f nInsAltHoms: Number of homozygous insertion variants; g nDelAltHoms: Number of homozygous for deletion variants; h nMissing: The number of missing data; i nSingletons: The number of single variants.

[0100] Table 11 Statistics of AvS and PI660072 InDel annotation results

[0101] a Sample: Sample name; bDownstream: The number of InDels in the 5 kb region downstream of the transcription termination site; c Exonic: The number of InDels in the exon region; d Intergenic: The number of InDels in the intergenic region; e Intron: The number of InDels containing subregions; f Splice Site Region: The number of InDels in the splice site region; g Upstream: The number of InDels in the 5 kb region upstream of the transcription start site; h UTR 3 Prime: The number of InDels in the 3' untranslated region of the transcript; i UTR 5 Prime: The number of 5' untranslated region InDels in the transcript.

[0102] 2) Panel region InDel analysis Simultaneously, InDel variants in the captured region were detected, filtered, and annotated. Table 12 shows that the number of heterozygous insertion variants in AvS and PI660072 were 15473 and 11826, respectively, while the number of heterozygous deletion variants were 89,581 and 68,295, respectively. According to the annotation results, the number of InDels located in the exon regions of AvS and PI660072 were 30,226 and 25,040, respectively (Table 13).

[0103] Table 12. Statistics of AvS and PI660072 InDel Samples

[0104] a Sample: Sample name; b Total: Represents the total number of observations or data points in the sample; c nRefHom: Number of homozygous reference alleles; d nInsHets: Number of heterozygotes with insertion mutations; e nDelHets: Number of heterozygotes with deletion variants; f nInsAltHoms: Number of homozygous insertion variants; g nDelAltHoms: Number of homozygous for deletion variants; h nMissing: The number of missing data; i nSingletons: The number of single variants.

[0105] Table 13 Statistics of AvS and PI660072 InDel annotation results

[0106] a Sample: Sample name; b Downstream: The number of InDels in the 5 kb region downstream of the transcription termination site; c Exonic: The number of InDels in the exon region; d Intergenic: The number of InDels in the intergenic region; e Intron: The number of InDels containing subregions; f Splice Site Region: The number of InDels in the splice site region; g Upstream: The number of InDels in the 5 kb region upstream of the transcription start site; h UTR 3 Prime: The number of InDels in the 3' untranslated region of the transcript; i UTR 5 Prime: The number of 5' untranslated region InDels in the transcript.

[0107] Example 2: Development and Polymorphism Verification of the InDel Marker InDel-2B5646 Based on the parental AvS and PI660072 exon capture sequencing data, this study developed KASP markers in the QYrPI660072.swust-2BL localization region. According to the obtained SNP locus information, homozygous and differentially expressed SNP loci in both parents within this region were converted into KASP markers, totaling 13 SNP loci. These were sent to a company for genotyping. Preliminary experimental results showed that no expected polymorphism was detected between the parents using the submitted markers.

[0108] Since the development of the KASP marker was unsuccessful and the InDel variant site existed within the region, this study further developed the InDel marker. Based on the sequencing results, candidate sites with insertion / deletion differences between the two parents were selected within this region, and specific primers were designed based on their conserved flanking sequences. The marker names and primer sequence information are shown in Table 1. The designed primers were amplified by PCR and detected by agarose gel electrophoresis and polyacrylamide gel electrophoresis. PCR amplification was performed according to the PCR reaction system and procedure shown in Tables 2 and 3.

[0109] The marker InDel-2B5646 was successfully developed. Electrophoresis results showed that InDel-2B5646 did not exhibit polymorphism in AvS and PI660072. However, the marker InDel-2B5646 (containing flanking reference sequences of the InDel site as shown in SEQ ID NO. 11) could be used to detect polymorphic bands in the F2 population with parents Mianmai 902, PI660072, and Chuanmai 104, amplifying clear, stable, and easily distinguishable polymorphic bands among the three parents. See details [link to documentation]. Figure 1 , Figure 1 The actual amplification region of the marker in PI660072 is a 341 bp fragment between the forward primer InDel-2B5646-F and the reverse primer InDel-2B5646-R (as shown in SEQ ID NO.12). This marker was subsequently used for population detection. The population detection results in Table 14 show that in the Mianmai 902 / PI660072 / Chuanmai 104 F2 population, there were 14 homozygous positive families, 30 homozygous negative families, and 89 heterozygous families; in the Chuanmai 104 / PI660072 / Mianmai 902 F2 population, there were 3 homozygous positive families, 3 homozygous negative families, and 7 heterozygous families (Tables 15 and 16).

[0110] SEQ ID NO.11: CCGGCAACCTCAGACAGAGGCAGGAAACTTAGGCGCAAAGGAAGGAAGCAGAGCAAGTCTTCACCTCCTCGTCGTCTTACGAGAGAAAGAAGTCTCCGGGTTCTTCGTTCCAACAGCAAATGGAGAAGGCACGAAATGCGCATGTGATTGGCATCCCAGTGAGCAGCACTGCTATCGGCATCGAGGAGCCCGAGTTCACCAG CGGCGATGCAAAGTATTCGACGAGCCTGCGTACCGGCGGCAAGTCGGGCCGCAGGACCGGGGACAAGTTTGCTCGGGGCATCAAAGAACATCTTAAGTCCTCCTTCAGTCCTTCTAGTCCATCTGGATAAATCTTTGTAGCTCTGGTTGTGAATTAGACACTGAACATATGTTTCTGCAGTGACTCTCGGCCCAAAGC.

[0111] SEQ ID NO.12: CAAGTCTTCACCTCCTCGTCGTCTTACGAGAGAAAGAAGTCTCCGGGTTCTTCGTTCCAACAGCAAATGGAGAAGGCACGAAATGCGCATGTGATTGGCATCCCAGTGAGCAGCACTGCTATCGGCATCGAGGAGCCCGAGTTCACCAGCGGCGATGCAAAGTATTCGACGA GCCTGCGTACCGGCGGCAAGTCGGGCCGCAGGACCGGGGACAAGTTTGCTCGGGGCATCAAAGAACATCTTAAGTCCTCCTTCAGTCCTTCTCTAGTCCATCTGGATAAATCTTTGTAGCTCTGGTTGTGAATTAGACACTGAACATATGTTTCTGCAGTGACTCTCGGC.

[0112] In this invention, the primers shown in SEQ ID NO. 9 and SEQ ID NO. 10 were used to amplify the genomic DNA of the wheat materials to be tested by PCR. The resistant donor parent PI660072 was used as a positive control, and Chuanmai 104, Mianmai 902, or the corresponding recipient parent were used as negative controls or susceptible parent controls. After amplification, the PCR amplification products were detected by gel electrophoresis. The genotype of the test material at the target resistance site was determined based on whether the migration position of the amplified band of the test material was consistent with that of the amplified band of the parent control.

[0113] The specific judgment criteria are as follows: PI660072, Chuanmai 104, and Mianmai 902 were amplified using primers SEQ ID NO. 9 and 10, respectively. The specific band obtained from the amplification of PI660072 was denoted as band P; the parental band obtained from the amplification of Chuanmai 104 was denoted as band C; the parental band obtained from the amplification of Mianmai 902 was denoted as band M; and the parental band obtained from the amplification of Yangmai 33 was denoted as band Y. Band P is the indicator band of the target resistance allelic fragment derived from PI660072, and bands C, M, and Y are the indicator bands of the allelic fragments derived from the corresponding cultivated parents.

[0114] When the amplification product of the F2 plant under test only shows a band consistent with the migration position of the P-type band of PI660072, but does not show the band of the corresponding cultivated parent, the plant is determined to be homozygous for the resistance allelic fragment from PI660072 at the target site, that is, the homozygous genotype of resistance at the target site.

[0115] When the amplification product of the F2 plant being tested simultaneously shows a band that corresponds to the migration position of band P of PI660072 and a band that corresponds to the migration position of band C, band M or band Y of the corresponding cultivated parent, the plant is determined to be heterozygous at the target site, that is, it carries both the target resistance allele from PI660072 and the allele from the corresponding cultivated parent, and belongs to the target site resistance heterozygous genotype.

[0116] When the amplification product of the F2 plant under test does not show the PI660072 band P, but only shows a band with the same migration position as the corresponding cultivated parent band C, band M or band Y, it is determined that the plant is not the PI660072 donor parent at the target site, that is, it does not carry the target resistance allele fragment from PI660072.

[0117] This invention uses the specific amplification band of PI660072 as the molecular basis for determining the target resistance allelic fragment. If the amplification product of the tested F2 single plant contains the band pattern P, it is determined that it carries the target resistance allelic fragment derived from PI660072; those containing only the band pattern P are determined to be homozygous for the target site resistance; those containing both the band pattern P and the corresponding cultivated parent band pattern are determined to be heterozygous for the target site resistance; and those containing only the corresponding cultivated parent band pattern but not the band pattern P are determined to be non-donor parent type for the target site.

[0118] Table 14 Statistical analysis of InDel-2B5646 marker detection results

[0119] Table 15 Results of InDel-2B5646 detection of the F2 population marker Mianmai 902 / PI660072 / Chuanmai 104

[0120] Note: A is the homozygous disease-resistant genotype, H is the heterozygous genotype, and B is the homozygous disease-susceptible genotype.

[0121] The InDel-2B5646 marker identification results of the Mianmai 902 / PI660072 / Chuanmai 104 F2 population in Table 15 were compared with the stripe rust resistance identification results at the adult stage in the field. The matching accuracy rate was 95%.

[0122] Table 16. Markers of the F2 population of Chuanmai 104 / PI660072 / Mianmai 902 InDel-2B5646 Test results

[0123] Note: A is the homozygous disease-resistant genotype, H is the heterozygous genotype, and B is the homozygous disease-susceptible genotype.

[0124] The InDel-2B5646 marker identification results of the Chuanmai 104 / PI660072 / Mianmai 902 F2 population in Table 16 were compared with the stripe rust resistance identification results at the adult stage in the field. The matching accuracy rate was 96%.

[0125] Example 3: Screening of offspring from breeding programs that combine disease resistance genes with superior agronomic traits Based on field surveys, this study screened individual plants containing stripe rust resistance (QYrPI660072.swust-2BL) and exhibiting excellent agronomic traits from the Mianmai 902 / PI660072 / Chuanmai 104 F3 population (F3 families obtained through self-pollination of F2 individual plants). The screening criteria referenced the agronomic traits of the three main varieties used in this study's breeding population under the same conditions: plant height: 60-75 cm; spike length ≥ 8 cm; number of spikelets ≥ 12; number of grains per spike ≥ 30. Superior individual plants were selected based on these criteria. As shown in Table 17, four disease-resistant individual plants with excellent agronomic traits were selected from the Mianmai 902 / PI660072 / Chuanmai 104 F3 population.

[0126] Table 17 Disease resistance and agronomic traits of superior single plants in the F3 wheat varieties Mianmai 902 / PI660072 / Chuanmai 104

[0127] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A wheat stripe disease resistant InDel molecular marker primer combination, characterized in that, The primer combination consists of primers with sequences as shown in SEQ ID NO. 9 and 10; the wheat was obtained through multiple hybridization and transformation processes using PI660072 as the stripe rust resistant donor parent; amplification using the primer combination showed that if only bands with the same migration position as PI660072 appeared, it was determined to be a homozygous disease-resistant genotype; if bands with the same migration position as both PI660072 and the recipient parent appeared, it was determined to be a heterozygous disease-resistant genotype; if only bands with the same migration position as the recipient parent appeared, it was determined to be a homozygous disease-susceptible genotype.

2. The wheat stripe rust InDel molecular marker primer combination according to claim 1, characterized in that, The wheat is (Mianmai 902×PI660072)×Chuanmai 104 or (Chuanmai 104×PI660072)×Mianmai 902.

3. A molecular detection kit for wheat resistance to stripe rust, characterized in that, It includes the primer combination as described in claim 1.

4. The application of the InDel molecular marker as described in claim 1 in identifying the wheat stripe rust resistance gene QYrPI660072.swust-2BL.

5. The application of the InDel molecular marker primer combination as described in claim 1 in identifying the wheat stripe rust resistance gene QYrPI660072.swust-2BL.

6. The application of the InDel molecular marker primer combination as described in claim 1 in the identification of wheat resistant to stripe rust.

7. The application of the InDel molecular marker primer combination as described in claim 1 in molecular-assisted breeding of wheat for resistance to stripe rust.

8. A method for detecting the stripe rust resistance genotype of wheat QYrPI660072.swust-2BL, characterized in that, Includes the following steps: (1) Extract genomic DNA from the wheat material to be tested; (2) PCR amplification of the genomic DNA to be tested using the primer combination described in claim 1; (3) The PCR amplification products were detected by gel electrophoresis, with PI660072 as a positive control and the corresponding transgenic recipient parent as a negative control. The genotype was determined based on the position of the bands: Those showing only bands at the same migration positions as PI660072 are identified as homozygous disease-resistant genotypes; Those that show bands at the same migration position as PI660072 and at the same migration position as the recipient parent are identified as heterozygous disease-resistant genotypes. If only the same migration site band as the recipient parent is present, it is determined to be a homozygous genotype.

9. The method according to claim 8, characterized in that, The PCR amplification reaction system in step (2) is 10 μL: 5 μL of 2×San Taq PCR Mix, 2 μL of primer pair mixture, 2 μL of genomic DNA, and 1 μL of ddH2O; the reaction program is: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 35 s, 58℃ annealing for 35 s, 72℃ extension for 35 s, for a total of 35 cycles; and 72℃ final extension for 10 min.