Methods of treating, ameliorating and / or preventing progressive fibrodysplasia ossificans and heterotopic ossification and kits therefor

Abstract

This document discloses methods for treating, improving, and / or preventing progressive ossifying fibrous dysplasia (FOP) in subjects of need, as well as methods for treating, improving, and / or preventing non-FOP heterotopic ossification (HO) in subjects of need. The methods include downregulating matrix metalloproteinase 9 (MMP-9) levels and / or activity in the subjects. Kits for carrying out the methods disclosed herein are also disclosed.

Description

[0001] Cross-reference to related applications This application claims priority to U.S. Provisional Patent Application No. 63 / 587,880, filed October 4, 2023, pursuant to 35 USC § 119(e) (the entire contents of which are incorporated herein by reference).

[0002] Electronic Sequence List Reference An XML file named “046483-7440WO1_Seq Listing.xml”, created on September 27, 2024, contains 61,462 bytes. Its entire contents are incorporated into this article by reference. Background Technology

[0003] Fibrocystic dysplasia of Progress (FOP; MIM#135100) is the most disastrous form of extraskeletal formation in humans. In this disease, muscle tissue, as well as connective tissues such as tendons and ligaments, are gradually replaced by bone (ossification), forming extraskeletal bone (exoskeletal or ectopic bone) that restricts movement.

[0004] Individuals with FOP present normally at birth, but all typically affected individuals exhibit a characteristic big toe deformity. During the first decade of life, paroxysmal soft tissue swelling (or flare-ups) occurs in the neck and back, undergoing pathological deformation into mature heterotopic bone via an intracartilaginous pathway. Minor trauma, such as intramuscular immunization, mandibular blocks for dental work, muscle over-exertion, blunt muscle trauma, lumps, bruises, falls, or influenza-like viral illnesses, can trigger flare-ups of FOP, leading to progressive heterotopic ossification (HO). Most patients are immobile by age 30 and require lifelong assistance with activities of daily living. The median estimated lifespan is 56 years; death is often caused by complications of thoracic insufficiency syndrome.

[0005] Currently, palovarotene is approved for the treatment of febrile osteoporosis (FOP). However, the efficacy of this compound is unsatisfactory, and current standard of care is largely supportive. There is a need for methods and kits that can be used to treat, improve, and / or prevent FOP. This invention addresses this need.

[0006] Besides the genetic predisposition of FOP, heterotopic ossification can also be caused by bone trauma or injury, severe burns, stroke, poliomyelitis, tetanus, syringomyelia, myelodysplastic syndrome, multiple sclerosis (MS), carbon monoxide poisoning, spinal tumors, etc. Therefore, there is a need for methods and kits that can be used to treat, improve, and / or prevent non-FOP HO. This invention addresses this need. Summary of the Invention

[0007] In some aspects, the present invention relates to the following non-limiting embodiments: Methods for treating, improving, and / or preventing progressive fibrous ossifying dysplasia (FOP) In some aspects, the present invention relates to methods for treating, improving, and / or preventing progressive ossifying fibrous dysplasia (FOP) in patients in need.

[0008] In some embodiments, the method includes downregulating the level and / or activity of matrix metalloproteinase 9 (MMP-9) in the object.

[0009] In some embodiments, downregulating the MMP-9 level and / or activity in the subject includes administering an effective amount of a small molecule MMP-9 inhibitor to the subject.

[0010] In some embodiments, downregulating the MMP-9 level and / or activity in the subject includes administering an effective amount of a protein MMP-9 inhibitor to the subject.

[0011] In some embodiments, downregulating the MMP-9 level and / or activity in the subject includes administering an effective amount of nucleic acid (and / or an expression vector expressing the nucleic acid) to the subject to downregulate MMP-9 via RNA interference.

[0012] In some embodiments, downregulating the MMP-9 level and / or activity in the subject includes administering an effective amount of a ribozyme that downregulates MMP-9 (and / or a vector expressing the ribozyme) to the subject.

[0013] In some embodiments, downregulating the MMP-9 level and / or activity in the object comprises administering an effective amount of an expression vector comprising an expression cassette to the object, wherein the expression cassette expresses a CRISPR component that downregulates MMP-9 by CRISPR knockout and / or CRISPR knockdown.

[0014] In some embodiments, downregulating the MMP-9 level and / or activity in the subject includes administering an effective amount of a trans-dominant negative mutant protein of MMP-9 to the subject and / or an expression vector expressing the trans-dominant negative mutant protein of MMP-9.

[0015] In some implementations, the object has a mutated ACVR1 gene.

[0016] In some embodiments, the mutated ACVR1 gene encodes an active ACVR1 polypeptide.

[0017] In some embodiments, the ACVR1 peptide includes at least one mutation selected from L196P, P197-F198 del ins L, R202I, R206H, Q207E, F246Y, R258S, R258G, G325A, G328E, G328W, G328R, G356D, R375P, and K400E.

[0018] In some embodiments, the small molecule MMP-9 inhibitor is selected from metformin, doxycycline, incyclinide, and minocycline, or their salts or solvates.

[0019] In some embodiments, the protein MMP-9 inhibitor is an anti-MMP-9 antibody or its antigen-binding fragment.

[0020] In some embodiments, the anti-MMP-9 antibody or its antigen-binding fragment includes heavy chain complementarity-determining region 1 (CDR1) listed in SEQ ID NO: 3, heavy chain CDR2 listed in SEQ ID NO: 4, heavy chain CDR4 listed in SEQ ID NO: 5, light chain CDR1 listed in SEQ ID NO: 6, light chain CDR2 listed in SEQ ID NO: 7, and light chain CDR3 listed in SEQ ID NO: 8.

[0021] In some embodiments, the anti-MMP-9 antibody or its antigen-binding fragment includes heavy chain CDR1 listed in SEQ ID NO: 15, heavy chain CDR2 listed in SEQ ID NO: 16, heavy chain CDR4 listed in SEQ ID NO: 17, light chain CDR1 listed in SEQ ID NO: 18, light chain CDR2 listed in SEQ ID NO: 19, and light chain CDR3 listed in SEQ ID NO: 20.

[0022] In some embodiments, the anti-MMP-9 antibody or its antigen-binding fragment includes heavy chain CDR1 listed in SEQ ID NO: 35, heavy chain CDR2 listed in SEQ ID NO: 36, heavy chain CDR4 listed in SEQ ID NO: 37, light chain CDR1 listed in SEQ ID NO: 38, light chain CDR2 listed in SEQ ID NO: 39, and light chain CDR3 listed in SEQ ID NO: 40.

[0023] In some embodiments, the anti-MMP-9 antibody or its antigen-binding fragment includes light chain CDR1 listed in SEQ ID NO: 45, light chain CDR2 listed in SEQ ID NO: 46, and light chain CDR3 listed in SEQ ID NO: 47.

[0024] In some embodiments, the anti-MMP-9 antibody or its antigen-binding fragment includes the heavy chain variable region listed in SEQ ID NO: 9 and the light chain variable region listed in SEQ ID NO: 10.

[0025] In some embodiments, the anti-MMP-9 antibody or its antigen-binding fragment includes a heavy chain variable region selected from SEQ ID NO: 21, 23, 25, 27 and 29 and a light chain variable region selected from SEQ ID NO: 22, 24, 26, 28 and 30.

[0026] In some embodiments, the anti-MMP-9 antibody or its antigen-binding fragment includes the heavy chain variable region listed in SEQ ID NO: 21 and the light chain variable region listed in SEQ ID NO: 22.

[0027] In some embodiments, the anti-MMP-9 antibody or its antigen-binding fragment includes the heavy chain variable region listed in SEQ ID NO: 27 and the light chain variable region listed in SEQ ID NO: 30.

[0028] In some embodiments, the anti-MMP-9 antibody or its antigen-binding fragment includes the heavy chain variable region listed in SEQ ID NO: 41 and the light chain variable region listed in SEQ ID NO: 42.

[0029] In some embodiments, the anti-MMP-9 antibody or its antigen-binding fragment includes the light chain variable region listed in SEQ ID NO: 48.

[0030] In some embodiments, the method further includes surgically removing ossified tissue from the object.

[0031] In some implementations, the surgical removal step is performed after the MMP-9 level or activity in the subject has been downregulated.

[0032] In some implementations, the object is a person.

[0033] Methods for treating, improving, and / or preventing non-FOP heterotopic ossification (HO) In some embodiments, the present invention relates to methods for treating, improving, and / or preventing non-FOP heterotopic ossification (HO) in subjects in need.

[0034] In some embodiments, the method includes downregulating the level and / or activity of matrix metalloproteinase 9 (MMP-9) in the object.

[0035] In some embodiments, downregulating the MMP-9 level and / or activity in the subject includes administering an effective amount of a small molecule MMP-9 inhibitor to the subject.

[0036] In some embodiments, downregulating the MMP-9 level and / or activity in the subject includes administering an effective amount of a protein MMP-9 inhibitor to the subject.

[0037] In some embodiments, downregulating the MMP-9 level and / or activity in the subject includes administering an effective amount of nucleic acid (and / or an expression vector expressing the nucleic acid) to the subject to downregulate MMP-9 via RNA interference.

[0038] In some embodiments, downregulating the MMP-9 level and / or activity in the subject includes administering an effective amount of a ribozyme that downregulates MMP-9 (and / or a vector expressing the ribozyme) to the subject.

[0039] In some embodiments, downregulating the MMP-9 level and / or activity in the object comprises administering an effective amount of an expression vector comprising an expression cassette to the object, wherein the expression cassette expresses a CRISPR component that downregulates MMP-9 by CRISPR knockout and / or CRISPR knockdown.

[0040] In some embodiments, downregulating the MMP-9 level and / or activity in the subject includes administering an effective amount of an inverse dominant-negative mutant of MMP-9 to the subject and / or an expression vector expressing the inverse dominant-negative mutant of MMP-9.

[0041] In some embodiments, the small molecule MMP-9 inhibitor is selected from metformin, doxycycline, inclocycline and minocycline, or their salts or solvates.

[0042] In some embodiments, the protein MMP-9 inhibitor is an anti-MMP-9 antibody or its antigen-binding fragment.

[0043] In some embodiments, the anti-MMP-9 antibody or its antigen-binding fragment includes heavy chain complementarity-determining region 1 (CDR1) listed in SEQ ID NO: 3, heavy chain CDR2 listed in SEQ ID NO: 4, heavy chain CDR4 listed in SEQ ID NO: 5, light chain CDR1 listed in SEQ ID NO: 6, light chain CDR2 listed in SEQ ID NO: 7, and light chain CDR3 listed in SEQ ID NO: 8.

[0044] In some embodiments, the anti-MMP-9 antibody or its antigen-binding fragment includes heavy chain CDR1 listed in SEQ ID NO: 15, heavy chain CDR2 listed in SEQ ID NO: 16, heavy chain CDR4 listed in SEQ ID NO: 17, light chain CDR1 listed in SEQ ID NO: 18, light chain CDR2 listed in SEQ ID NO: 19, and light chain CDR3 listed in SEQ ID NO: 20.

[0045] In some embodiments, the anti-MMP-9 antibody or its antigen-binding fragment includes heavy chain CDR1 listed in SEQ ID NO: 35, heavy chain CDR2 listed in SEQ ID NO: 36, heavy chain CDR4 listed in SEQ ID NO: 37, light chain CDR1 listed in SEQ ID NO: 38, light chain CDR2 listed in SEQ ID NO: 39, and light chain CDR3 listed in SEQ ID NO: 40.

[0046] In some embodiments, the anti-MMP-9 antibody or its antigen-binding fragment includes light chain CDR1 listed in SEQ ID NO: 45, light chain CDR2 listed in SEQ ID NO: 46, and light chain CDR3 listed in SEQ ID NO: 47.

[0047] In some embodiments, the anti-MMP-9 antibody or its antigen-binding fragment includes the heavy chain variable region listed in SEQ ID NO: 9 and the light chain variable region listed in SEQ ID NO: 10.

[0048] In some embodiments, the anti-MMP-9 antibody or its antigen-binding fragment includes a heavy chain variable region selected from SEQ ID NO: 21, 23, 25, 27 and 29 and a light chain variable region selected from SEQ ID NO: 22, 24, 26, 28 and 30.

[0049] In some embodiments, the anti-MMP-9 antibody or its antigen-binding fragment includes the heavy chain variable region listed in SEQ ID NO: 21 and the light chain variable region listed in SEQ ID NO: 22.

[0050] In some embodiments, the anti-MMP-9 antibody or its antigen-binding fragment includes the heavy chain variable region listed in SEQ ID NO: 27 and the light chain variable region listed in SEQ ID NO: 30.

[0051] In some embodiments, the anti-MMP-9 antibody or its antigen-binding fragment includes the heavy chain variable region listed in SEQ ID NO: 41 and the light chain variable region listed in SEQ ID NO: 42.

[0052] In some embodiments, the anti-MMP-9 antibody or its antigen-binding fragment includes the light chain variable region listed in SEQ ID NO: 48.

[0053] In some embodiments, the non-FOP HO is caused by bone trauma or injury, severe burns, stroke, head trauma, paralysis, orthopedic procedures, hip replacement, severe crush injury, blast wound, warwound, severe civilian trauma, poliomyelitis, tetanus, syringomyelia, myelodysplastic syndrome, multiple sclerosis (MS), carbon monoxide poisoning, or spinal tumors.

[0054] In some implementations, the object is a person.

[0055] Used for the treatment, improvement, and / or prevention of progressive ossifying fibrous dysplasia (FOP) or non-FOP heterotopic ossification. (HO) set In some aspects, the present invention relates to kits for treating, improving, and / or preventing progressive ossifying fibrous dysplasia (FOP) or non-FOP heterotopic ossification (HO) in subjects in need.

[0056] In some embodiments, the kit includes a compound for downregulating the level and / or activity of matrix metalloproteinase 9 (MMP-9) in the subject; and instructions for administering an effective amount of the compound to the subject.

[0057] In some embodiments, the compound includes a small molecule MMP-9 inhibitor.

[0058] In some embodiments, the compound includes a protein MMP-9 inhibitor.

[0059] In some embodiments, the compound comprises a nucleic acid that downregulates MMP-9 via RNA interference (and / or an expression vector expressing the nucleic acid).

[0060] In some embodiments, the compound includes a ribozyme that downregulates MMP-9 (and / or a vector expressing the ribozyme).

[0061] In some embodiments, the compound includes an expression vector containing an expression cassette, wherein the expression cassette expresses a CRISPR component of MMP-9 downregulated by CRISPR knockout and / or CRISPR knockdown.

[0062] In some embodiments, the compound comprises a trans-dominant negative mutant protein of MMP-9 and / or an expression vector expressing the trans-dominant negative mutant protein of MMP-9.

[0063] In some embodiments, the kit is used to treat, improve, and / or prevent FOP, and the subject has a mutated ACVR1 gene.

[0064] In some embodiments, the mutated ACVR1 gene encodes an active ACVR1 polypeptide.

[0065] In some embodiments, the ACVR1 peptide includes at least one mutation selected from L196P, P197-F198 del ins L, R202I, R206H, Q207E, F246Y, R258S, R258G, G325A, G328E, G328W, G328R, G356D, R375P, and K400E.

[0066] In some embodiments, the kit is used to treat, improve, and / or prevent non-FOP HO, where the HO is caused by bone trauma or injury, severe burns, stroke, head trauma, paralysis, orthopedic procedures, hip replacement, severe crush injury, blast injury, war injury, severe civilian trauma, poliomyelitis, tetanus, syringomyelia, myelodysplastic syndrome, multiple sclerosis (MS), carbon monoxide poisoning, or spinal tumors.

[0067] In some embodiments, the small molecule MMP-9 inhibitor is selected from metformin, doxycycline, inclocycline, and minocycline.

[0068] In some embodiments, the protein MMP-9 inhibitor is an anti-MMP-9 antibody or its antigen-binding fragment.

[0069] In some embodiments, the anti-MMP-9 antibody or its antigen-binding fragment includes heavy chain complementarity-determining region 1 (CDR1) listed in SEQ ID NO: 3, heavy chain CDR2 listed in SEQ ID NO: 4, heavy chain CDR4 listed in SEQ ID NO: 5, light chain CDR1 listed in SEQ ID NO: 6, light chain CDR2 listed in SEQ ID NO: 7, and light chain CDR3 listed in SEQ ID NO: 8.

[0070] In some embodiments, the anti-MMP-9 antibody or its antigen-binding fragment includes heavy chain CDR1 listed in SEQ ID NO: 15, heavy chain CDR2 listed in SEQ ID NO: 16, heavy chain CDR4 listed in SEQ ID NO: 17, light chain CDR1 listed in SEQ ID NO: 18, light chain CDR2 listed in SEQ ID NO: 19, and light chain CDR3 listed in SEQ ID NO: 20.

[0071] In some embodiments, the anti-MMP-9 antibody or its antigen-binding fragment includes heavy chain CDR1 listed in SEQ ID NO: 35, heavy chain CDR2 listed in SEQ ID NO: 36, heavy chain CDR4 listed in SEQ ID NO: 37, light chain CDR1 listed in SEQ ID NO: 38, light chain CDR2 listed in SEQ ID NO: 39, and light chain CDR3 listed in SEQ ID NO: 40.

[0072] In some embodiments, the anti-MMP-9 antibody or its antigen-binding fragment includes light chain CDR1 listed in SEQ ID NO: 45, light chain CDR2 listed in SEQ ID NO: 46, and light chain CDR3 listed in SEQ ID NO: 47.

[0073] In some embodiments, the anti-MMP-9 antibody or its antigen-binding fragment includes the heavy chain variable region listed in SEQ ID NO: 9 and the light chain variable region listed in SEQ ID NO: 10.

[0074] In some embodiments, the anti-MMP-9 antibody or its antigen-binding fragment includes a heavy chain variable region selected from SEQ ID NO: 21, 23, 25, 27 and 29 and a light chain variable region selected from SEQ ID NO: 22, 24, 26, 28 and 30.

[0075] In some embodiments, the anti-MMP-9 antibody or its antigen-binding fragment includes the heavy chain variable region listed in SEQ ID NO: 21 and the light chain variable region listed in SEQ ID NO: 22.

[0076] In some embodiments, the anti-MMP-9 antibody or its antigen-binding fragment includes the heavy chain variable region listed in SEQ ID NO: 27 and the light chain variable region listed in SEQ ID NO: 30.

[0077] In some embodiments, the anti-MMP-9 antibody or its antigen-binding fragment includes the heavy chain variable region listed in SEQ ID NO: 41 and the light chain variable region listed in SEQ ID NO: 42.

[0078] In some embodiments, the anti-MMP-9 antibody or its antigen-binding fragment includes the light chain variable region listed in SEQ ID NO: 48.

[0079] In some embodiments, the specification also includes instructions for surgically removing ossified tissue from the object.

[0080] In some embodiments, the specification also includes instructions for performing the surgical removal after the level or activity of MMP-9 in the object has been downregulated.

[0081] In some implementations, the object is a person. Attached Figure Description

[0082] The following detailed description of exemplary embodiments will be better understood when read in conjunction with the accompanying drawings. For illustrative purposes, non-limiting embodiments are shown in the drawings. However, it should be understood that this specification is not limited to the precise arrangement and means of the embodiments shown in the drawings.

[0083] Figures 1A-1D Characterization of FOP in patients-R according to some implementation methods. Figure 1A Photograph of toe deformity (arrow). Figure 1B : Radiographic image of the foot. The arrow points to the deformed big toe, which lacks an interphalangeal joint. Figure 1C Scout image from a low-dose whole-body CT scan, showing typical HO deficiency in someone with FOP. The arrow indicates a small area of ​​HO associated with the lumbar spine. Figure 1D Electrophoretic pattern showing a typical ACVR1 mutation (617G>A) in patient-R. Figure 1CThe sequences shown are CAGTGGCTCRCCAGATTACACT (SEQ ID NO: 1, R=G and A) and CAGTGGCTCGCCAGATTACACT (SEQ ID NO: 2). Figures 2A-2D Some results of MMP-9 assays in control, FOP patients, and patient-R patients are shown according to some implementation methods. Figure 2A Box-whisker plots of total MMP-9 (Myriad RBM assay) in unaffected controls (n=39) and FOP patients (n=38). Figure 2B Box-whisker diagrams of FOP patients (n=38) and patients-R (n=2). Figure 2C Gelatin zymography revealed that MMP-9 activity was lower in the cell culture supernatant of PBMCs (cultured with TNF-α for 72 h) compared with patients-R, controls, and FOP patients (n=3). Figure 2D Quantification of gelatin in G by enzyme spectrum method. Figures 2A-2B The Mann-Whitney test was used. Figure 2D Tukey's multiple comparison test was used. **p<0.01, *p<0.05, ns - no significant difference.

[0084] Figures 3A-3B The MMP-9 variant in patient-R is shown according to some implementation methods. Figure 3A : A schematic diagram of the MMP-9 protein, indicating the positions of the A20V and D165N SNPs that lead to the amino acid residue changes. Figure 3B PCR amplicon sequences confirmed the presence of A20V and D165N SNPs in patient-R.

[0085] Figures 4A-4C This illustrates the structural basis for the loss of function of the secreted MMP-9 proenzyme according to some embodiments. Figure 4A Overlays of five high-resolution structures from the PDB show that short (1.8 Å) ion pairs / H bonds with optimal geometry are invariant, i.e., not a crystal artifact. Figure 4B : Blocking the catalytic binding of Zn via cysteine ​​linkage 2+ The inhibitory α-helix predomain of the active site of an ion requires cleavage by a neighboring ion pair. Figure 4C Four side chains extend outward from the folded core at the C-terminus of the protein to the zymogen cleavage site, indicating a potential role in substrate binding of plasminogen (i.e., the activating protease).

[0086] Figure 5This indicates that, according to some implementation methods, minocycline treatment 14 days after injury induced by cardiotoxin reduces HO in FOP mouse models. Untreated (left panel) and minocycline-treated (right panel) Acvr1 Q207D / + Microscopic CT images of mice. Ectopic bone (arrows) was quantified (n=6). Unpaired t-test was used. ***p<0.001.

[0087] Figure 6 This indicates that, according to some implementation methods, in Acvr1 Q207D / + Minocycline reduced organic toxicity (HO) in mice at doses as low as 5 mg / kg. The study compared untreated (control) mice with mice treated with different concentrations (100 mg / kg to 1 mg / kg) of minocycline. Acvr1 Q207D / + Quantification of ectopic bone in mice. Minocycline at doses ranging from 100 mg / kg to 5 mg / kg effectively reduced... Acvr1 Q207D / + HO in mice. Data shown: mean ± SEM; one-way ANOVA; ***p<0.001, **p<0.01, *p<0.05.

[0088] Figures 7A-7B This indicates that, according to some implementation methods, treatment with an anti-MMP-9 monoclonal antibody 14 days after injury caused by cardiotoxin reduces HO in FOP mouse models. Figure 7A : Acvr1 ARC-R206H / + Microscopic CT images; untreated (n=18) (left image) and treated with anti-MMP-9 monoclonal antibody (n=16) (right image). CreERT2 - / + Mice. Quantification of ectopic bone (arrow). Figure 7B Untreated (left image) and treated with anti-MMP-9 antibody (left image) Acvr1 Q207D / + Microscopic CT images of mice. Ectopic bone (arrows) was quantified (n=8). Unpaired t-tests were used. ****p<0.0001, ***p<0.01.

[0089] Figures 8A-8C Some results of the analysis of MMP-9 and activating protein A in THP-1 cells (wild-type, A20V, and D165N) according to some embodiments are shown. Cell culture supernatant was obtained from M1-like and M2a-like macrophages 48 hours after polarization of wild-type, A20V, and D165N M0 macrophages. Figure 8A Gelatin zymography of active MMP-9. Figure 8B Quantification of gelatin in component A using zymography. A two-factor Anova algorithm was employed. Figure 8C ELISA for the activation of protein A in cell culture supernatant from M1-like and M2a-like macrophages. (Compared to MMP-9) WT In comparison, MMP-9 A20V and MMP-9 D165N Significantly reduced the level of activating protein A in the supernatant. Data shown: mean ± SEM; ****p<0.0001, **p<0.01, *p<0.05.

[0090] Figure 9 This diagram illustrates a hypothetical schema of MMP-9 activity in FOP heterotopic ossification according to some implementations. V-shape = primary category; arrow = activation; arrowhead = activating complex; blunt red line = inhibition; MMP-9 (green) = target; FAP = fibro-adipogenic progenitor cells; HO FOP =Heterotopic ossification in FOP.

[0091] Figure 10 This indicates that minocycline reduces activator protein A according to some embodiments. ELISA was used to measure activator protein A in the cell culture supernatant of THP-1 derived M1-like macrophages. THP-1 M0-derived macrophages were treated daily with minocycline during polarization into M1-like macrophages. Activator protein A in the cell culture supernatant was measured by ELISA at 48 hours. A one-way ANOVA was used. Data shown are mean ± / +SEM; ****p<0.0001, ***p<0.01, **p<0.01, *p<0.05.

[0092] Figure 11 According to some embodiments, the amino acid and DNA sequences of the heavy and light chains of a non-restrictive mouse MMP9 antibody. Figure 11 According to some embodiments, a non-restrictive variable domain sequence of a mouse IgG1 chain (SEQ ID NO: 57) and a DNA molecule encoding the variable domain (SEQ ID NO: 58). Figure 12 According to some embodiments, a non-restrictive variable domain sequence of the mouse κ chain (SEQ ID NO: 59) and a DNA molecule encoding the variable domain (SEQ ID NO: 60). Figure 13The amino acid sequences of the heavy and light chains of a non-restricted humanized MMP9 antibody according to some embodiments are depicted (the sequences shown in the figure are SEQ ID NO: 56 (light chain) and SEQ ID NO: 55 (heavy chain)). Detailed Implementation

[0093] The following disclosure provides several different embodiments or examples for implementing various features of the provided subject matter. Specific examples of components and arrangements are described below to simplify this disclosure. Of course, these are merely examples and are not intended to be limiting. For example, in the following description, forming a first feature on or over a second feature may include embodiments where the first and second features are in direct contact, and may also include embodiments where additional features are formed between the first and second features such that the first and second features do not need to be in direct contact. Furthermore, reference numerals and / or letters may be repeated in various examples. Such repetition is for simplicity and clarity and does not in itself determine the relationship between the various embodiments and / or configurations discussed.

[0094] Heterozygous missense mutations in activator protein A receptor type I—a type I receptor for bone morphogenetic protein (BMP)—have been found in all sporadic or familial individuals with progressive ossifying fibrous dysplasia (FOP). ACVR1 mutations result in the loss of ACVR1 autoinhibition and make it susceptible to dysregulated BMP pathway signaling. Activator protein A—a member of the transforming growth factor-β (TGF-β) molecular family—antagonizes BMP signaling in the wild-type (WT) ACVR1 background—specifically enhancing BMP pathway signaling in cells carrying the ACVR1R206H mutation and driving ectopic bone formation in FOP.

[0095] The study described herein (“this study”) identified a specific patient with progressive fibrous ossifying dysplasia (FOP) who possessed a typical R206H mutation in the Acvr1 BMP receptor. Despite this patient’s congenital FOP features, postnatal FOP characteristics were minimal. This study found that this patient exhibited significantly repressive inflammatory biomarkers and that the patient’s MMP-9 gene showed compound heterozygosity (one allele of the MMP-9 gene had a polymorphism leading to an A20V mutation in the expressed peptide, while the other allele had a polymorphism leading to a D165N mutation). Using protein structure modeling, this study predicted that the compound heterozygosity of MMP-9 found in this patient would lead to reduced MMP-9 levels and activity. This study also found that MMP-9 is expressed in early lesion tissues of FOP subjects. Using several mouse FOP models, this study found that in response to damage in these mouse FOP models, reducing MMP-9 levels and / or activity through genetic deletion (including partial deletion) of MMP-9, administration of non-restricted examples of anti-MMP-9 monoclonal antibodies, or administration of non-restricted small molecule inhibitors of MMP-9 all resulted in reduced levels of ectopic ossification (bone formation).

[0096] Therefore, in some aspects, the present invention relates to methods for treating, improving and / or preventing progressive ossifying fibrous dysplasia (FOP) in patients in need.

[0097] In some aspects, the present invention relates to kits for treating, improving and / or preventing FOP in subjects in need.

[0098] It should be noted that this invention is not limited to the treatment and prevention of heterotopic ossification (HO) in cases of free ossification (FOP). Transgenic mice with the R206H or Q207D mutation in the Acvr1 gene are widely recognized in the art as animal models for general HO studies (see, for example, Meyers et al., JBMR Plus . 2019 Apr; 3(4): e10172). The fact that the methods and kits described in this paper can be used to prevent or reduce HO in these animal models suggests that these methods and kits are suitable for treating general HO, such as HO caused by bone trauma or injury, severe burns, stroke, head trauma, paralysis, orthopedic procedures, hip replacement, severe crush injuries, blast injuries (such as those caused by improvised explosive devices), war injuries, severe civilian trauma, poliomyelitis, tetanus, syringomyelia, myelodysplastic syndrome, multiple sclerosis (MS), carbon monoxide poisoning, or spinal tumors.

[0099] Therefore, in some aspects, the present invention relates to methods for treating, improving and / or preventing heterotopic ossification (HO) in subjects in need.

[0100] In some aspects, the present invention relates to kits for treating, improving and / or preventing heterotopic ossification (HO) in subjects in need.

[0101] definition As used herein, each of the following terms has its associated meaning within this section. Unless otherwise defined, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains. Generally, the nomenclature and laboratory procedures used herein in animal pharmacology, pharmaceutical science, peptide chemistry, and organic chemistry are those well-known and commonly used in the art. It should be understood that the order of steps or the sequence of actions performed is not important, as long as the teaching remains operational. The use of any section headings is for the purpose of aiding in reading this document and should not be construed as limiting; information relating to a section heading may appear within or outside that particular section. All publications, patents, and patent documents mentioned in this document are incorporated herein by reference in their entirety as if individually incorporated.

[0102] In this application, when an element or component is described as being included in and / or selected from the list of described elements or components, it should be understood that the element or component can be any one of the described elements or components, and can be a group consisting of two or more of the described elements or components.

[0103] In the methods described herein, actions can be performed in any order unless the timing or sequence of operations is explicitly stated. Furthermore, unless explicitly stated in the claims that the actions are performed separately, they can be performed simultaneously. For example, the claimed action of making X and the claimed action of making Y can be performed simultaneously within a single operation, and the resulting process will fall within the literal scope of the claimed process.

[0104] In this document, unless the context clearly specifies otherwise, the terms “a,” “an,” or “the” are used to include one or more. Unless otherwise indicated, the term “or” is used to refer to a non-exclusive “or.” The expression “at least one of A and B” or “at least one of A or B” has the same meaning as “A, B, or A and B.”

[0105] When it comes to measurable values ​​such as quantity or duration, the term “about” as used herein means to cover a variation of ±20% or ±10% from a specified value, in some embodiments ±5%, in some embodiments ±1%, and in some embodiments ±0.1%, as such variation is appropriate for performing the disclosed method.

[0106] As used herein, the term "pharmaceutically acceptable salt" refers to a salt of an applied compound prepared from pharmaceutically acceptable, non-toxic acids and bases, including inorganic acids, inorganic bases, organic acids, inorganic bases, solvates, hydrates or inclusion complexes thereof.

[0107] As used herein, a “drugally effective amount,” “therapeutically effective amount,” or “effective amount” of a compound is an amount of the compound sufficient to provide a beneficial effect to a subject to which the compound is administered.

[0108] As used in this article, the terms "prevent" or "prevention" mean the absence of a disorder or disease in the absence of either, or the prevention of further development of a disorder or disease in the absence of either. Also considered is an individual's ability to prevent some or all of the symptoms associated with the disorder or disease.

[0109] Non-restrictive abbreviations used in this article: FOP: Progressive ossifying fibrous dysplasia. HO: Heterotopic ossification. PBMC: Peripheral blood mononuclear cells. SNP: Single nucleotide polymorphism.

[0110] Methods for treating, improving, and / or preventing progressive ossifying fibrous dysplasia This study identified a patient with progressive fibrous ossifying dysplasia (FOP) possessing a classic R206H mutation in the Acvr1 BMP receptor. Despite the patient's congenital FOP characteristics, postnatal FOP features were minimal. This study found that the patient exhibited significantly suppressed inflammatory biomarkers and compound heterozygosity in the MMP-9 gene (one allele of the MMP-9 gene had a polymorphism leading to A20V, while the other allele had a polymorphism leading to D165N). Using protein structure modeling, this study predicted that the compound heterozygosity of MMP-9 found in this patient would lead to reduced MMP-9 levels and activity. This study also found that MMP-9 is expressed in early lesion tissues of FOP patients. Using several mouse FOP models as non-restrictive examples, this study found that in response to soft tissue injury, reducing MMP-9 levels and / or activity through genetic deletion (including partial deletion), administration of non-restrictive MMP-9 monoclonal antibodies, or administration of non-restrictive small molecule inhibitors of MMP-9 all resulted in reduced levels of ectopic ossification (bone formation).

[0111] Therefore, in some aspects, the present invention relates to methods for treating, improving, and / or preventing progressive ossifying fibrous dysplasia (FOP) in a subject. In some embodiments, the method includes administering a compound to the subject that downregulates the level and / or activity of MMP-9 in the subject.

[0112] This study found that inhibiting MMP-9 significantly reduced the level of ectopic ossification in an Acvr1 BMP receptor Q270D mutant animal model. Since the Q270D mutation does not lead to spontaneous ectopic ossification but only to ossification in response to injury and produces a very stable post-traumatic ossification, the Q270D model is considered an ossification model. Therefore, in some aspects, the present invention relates to methods for treating, improving, and / or preventing ectopic ossification in subjects in need. In some embodiments, the method includes administering a compound to the subject that downregulates the level and / or activity of MMP-9 in the subject.

[0113] In some embodiments, a bone marrow transplant is used to treat the subject, replacing some of the subject's hematopoietic stem cells with hematopoietic stem cells having reduced MMP-9 levels and / or activity. Those skilled in the art will understand that while MMP-9 is expressed in a variety of tissues, it is strongly expressed in bone marrow and lymphoid tissues. As described elsewhere herein, this study found that partially reducing MMP-9 expression by deleting only one MMP-9 allele is sufficient to combat soft tissue injury-induced heterotopic ossification in FOP model animals. Therefore, in some embodiments, only partially reducing and / or eliminating MMP-9 expression and / or activity in the bone marrow is sufficient to mimic the partial reduction in MMP-9 expression in FOP model mice. In some embodiments, the bone marrow stem cells used for transplantation are genetically engineered to reduce MMP-9 levels and / or activity. Genetic engineering of hematopoietic stem cells in the bone marrow is exemplified by, for example, Daniel-Moreno et al. (…). Bone Marrow Transplantation As described in Volume 54, pp. 1940-1950 (2019). In some embodiments, the bone marrow for transplantation comes from a donor with an MMP-9 polymorphism that reduces MMP-9 levels and / or activity (such as the MMP-9 polymorphism found in patient-R as described herein).

[0114] In some embodiments, the object has a mutated ACVR1 gene. In some embodiments, the mutated ACVR1 gene encodes a polypeptide constituting an active ACVR1 peptide. In other embodiments, the mutated ACVR1 gene, relative to the wild-type gene, includes a mutation (e.g., one or more point mutations, deletions, and / or insertions) in the nucleic acid sequence of the ACVR1 gene encoding the ACVR1 peptide. In some embodiments, the ACVR1 peptide includes a mutation. In some embodiments, relative to the wild-type peptide, the ACVR1 peptide includes one or more amino acid substitutions, deletions, and / or insertions. In some embodiments, relative to the wild-type ACVR1 peptide, the ACVR1 peptide includes one or more amino acid substitutions, deletions, and / or insertions, wherein the wild-type ACVR1 peptide includes the amino acid sequence listed in SEQ ID NO: 54. The ACVR1 peptide is disclosed in Genbank accession number NP_001104537 (incorporated herein by reference in its entirety). In some embodiments, the ACVR1 polypeptide includes one or more mutations at amino acid residues L196, P197, F198, R202, R206, Q207, F246, R258, G325, G328, G356, R375, or K400. In some embodiments, relative to the wild-type ACVR1 polypeptide including the sequence listed in SEQ ID NO: 54, the ACVR1 polypeptide includes one or more mutations at amino acid residues L196, P197, F198, R202, R206, Q207, F246, R258, G325, G328, G356, R375, or K400. In some embodiments, the ACVR1 peptide includes one or more mutations selected from L196P, P197-F198 del ins L, R202I, R206H, Q207E, F246Y, R258S, R258G, G325A, G328E, G328W, G328R, G356D, R375P, and K400E, where del represents deletion and ins represents insertion. In some embodiments, the ACVR1 polypeptide includes one or more mutations selected from L196P, P197-F198 del ins L, R202I, R206H, Q207E, F246Y, R258S, R258G, G325A, G328E, G328W, G328R, G356D, R375P, and K400E, where del represents deletion and ins represents insertion, relative to the wild-type ACVR1 polypeptide including the sequence listed in SEQ ID NO: 54. Bone Volume 109, April 2018, pp. 232-240) and Mukaddam et al. ( Genetics of Fibrodysplasia Ossificans ProgressivaThis is also described in (eLS, Vol 2:1-8, 2021), and these references are incorporated into this paper in their entirety by reference.

[0115] In some embodiments, the method further includes surgically removing ossified tissue from the subject. In some embodiments, surgical removal of ossified tissue is performed after the level or activity of MMP-9 in the subject has been downregulated.

[0116] In some implementations, the object is a mammal. In other implementations, the object is a human.

[0117] Small molecule inhibitors of MMP-9 In some embodiments, compounds that downregulate MMP-9 levels and / or activity include small molecule inhibitors of MMP-9.

[0118] As used herein, the term "small molecule" means a molecule with a molecular weight of about 2000 Daltons or less, such as about 1800 Daltons or less, about 1600 Daltons or less, about 1400 Daltons or less, about 1200 Daltons or less, about 1000 Daltons or less, or about 900 Daltons or less. Non-limiting examples of small molecules that inhibit MMP-9 include actinonin, ageladine A trifluoroacetate (TFA), apigenin-7-glucuronide, ARP 100, astragaloside IV, BR351, chlorhexidine dihydrochloride, cipemastat, CMC2.24, CP-471474, CP-54439, cyclic CTTHWGFTLC, cyclic CTTHWGFTLC TFA, and FSL-1. TFA, Ginkgolide C, Ilomastat (also known as GM6001), JNJ0966, Luteolin 7-O-glucuronide, Marimastat, MMP-2 / MMP-9 Inhibitor I, MMP-2 / MMP-9 Inhibitor II, MMP3 Inhibitor I, MMP-9-IN-1, MMP-9 Inhibitor I, MMP-9 Inhibitor II, MMP-9 / MMP-13 Inhibitor I, MMP Inhibitor II, MMP-13-IN-3, MMPI-1154, Monoside, ND-336, NNGH, (R)-ND-336, PF-00356231 Hydrochloride, PD-166793, Prinomastat, Prinomastat Hydrochloride, Tanshinone A, S 3304, SB-3CT, SM-7368, tanomastat, tetracycline derivatives (such as doxycycline, inclocycline, and minocycline), UK 356618, UK-370106, XL-784, etc. MMP-9 inhibitors are used in, for example, Fields... Cells It is described in . 2019 Sep; 8(9): 984).

[0119] In some embodiments, small molecule inhibitors of MMP-9 include selective MMP-9 small molecule inhibitors. As used herein, the term "selective MMP-9 inhibitor" refers to an inhibitor of MMP-9 with an IC50 value of 1,000 mg / L. 50 Equal to or higher than IC50 for any other matrix metalloproteinase 50 Small molecule compounds, such as IC50 compared to any other matrix metalloproteinases 500.1 or more, 0.2 or more, 0.3 or more, 0.5 or more, 0.8 or more, or 1.0 or more. Non-limiting examples of selective MMP-9 small molecule inhibitors include apigenin-7-glucuronide, FGAGLDD, FSL-1 TFA, ginkgolide C, isoliquiritin apioside, JNJ0966, luteolin-7-O-glucuronide, MMP-9-IN-1, (R)-ND-336, SM-7368, FGAGLDD TFA, etc.

[0120] In some embodiments, small molecule inhibitors of MMP-9 include compounds used in the medical field for purposes other than inhibiting MMP-9 and are known to be generally safe. Non-limiting examples of such compounds include tetracyclines, such as doxycycline, inclocycline, and minocycline. Examples of tetracyclines capable of inhibiting MMP-9 include, for example, those by Griffin et al. (…). Am J Physiol Cell Physiol As described in (2010 Sep; 299(3): C539-C548), the entire contents of which are incorporated herein by reference.

[0121] In some implementations, small molecule inhibitors of MMP-9 include metformin. Metformin has been shown to be both an indirect and direct inhibitor of MMP-9 (see, e.g., Hwang et al., Br J Pharmacol . 2010 Jul; 160(5): 1195-1211 and Chen et al., J Cardiovasc Dev Dis . 2023 Jan 30;10(2):54.doi: 10.3390 / jcdd10020054).

[0122] MMP-9 protein inhibitors In some embodiments, compounds that downregulate MMP-9 levels and / or activity include protein inhibitors of MMP-9.

[0123] In some embodiments, MMP-9 protein inhibitors comprise anti-MMP-9 antibodies or antigen-binding fragments thereof. Examples of anti-MMP-9 antibodies include Santa Cruz Biotechnology's anti-Ac-MMP-9 antibody (4A3), anti-MMP-9 antibody (E-11), anti-MMP-9 antibody (2C3), and anti-MMP-9 antibody (6-6B); Invitrogen's MMP9 monoclonal antibody (5G3), recombinant rabbit MMP9 monoclonal antibody (JA80-73), and MMP9 monoclonal antibody (5C3); and so on.

[0124] MMP9 antibodies are disclosed in, for example, WO 2013 / 130078 A1, WO 2013 / 130905 A1 and U.S. Patent No. 9,732,156, each of which is incorporated herein by reference in its entirety.

[0125] In some embodiments, the MMP9 antibody includes heavy chain CDR1, heavy chain CDR2, heavy chain CDR3, light chain CDR1, light chain CDR2, and light chain CDR3, wherein each of the heavy chain CDR1, heavy chain CDR2, heavy chain CDR3, light chain CDR1, light chain CDR2, and light chain CDR3 has approximately 80% or more, approximately 85% or more, approximately 90% or more, approximately 92% or more, approximately 95% or more, approximately 98% or more, approximately 99% or more, or 100% identity with the heavy chain CDR1, heavy chain CDR2, heavy chain CDR3, light chain CDR1, light chain CDR2, and light chain CDR3 listed in Table 1. Table 1 In some embodiments, the MMP9 antibody includes a heavy chain variable region and a light chain variable region, the heavy chain variable region and the light chain variable region having approximately 80% or more identity, approximately 85% or more identity, approximately 90% or more identity, approximately 92% or more identity, approximately 95% or more identity, approximately 98% or more identity, approximately 99% or more identity, or 100% identity with the heavy chain variable regions and light chain variable regions listed in Table 2, respectively. Table 2 In some embodiments, the MMP 9 antibody comprises a heavy chain and a light chain, the heavy chain and light chain comprising approximately 80% or more, approximately 85% or more, approximately 90% or more, approximately 92% or more, approximately 95% or more, approximately 98% or more, approximately 99% or more, or 100% identity with the heavy chains and light chains listed in Table 3, respectively. Table 3 In other embodiments, the MMP 9 antibody comprises the amino acid sequences listed in Table 3, provided that the antibody does not include a signal peptide.

[0126] In another embodiment, the MMP9 antibody includes heavy chain CDR1, heavy chain CDR2, heavy chain CDR3, light chain CDR1, light chain CDR2, and light chain CDR3 listed in Table 1, wherein the antibody includes an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of the sequences listed in Tables 2 and 3.

[0127] In another embodiment, the MMP9 antibody includes heavy chain CDR1, heavy chain CDR2, heavy chain CDR3, light chain CDR1, light chain CDR2, and light chain CDR3 listed in Table 1, wherein the antibody includes an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of the sequences listed in Table 3, provided that the antibody does not include a signal peptide.

[0128] In some embodiments, the MMP 9 antibody comprises a heavy chain encoded by a DNA sequence and a light chain encoded by a DNA sequence, the heavy chain DNA sequence and the light chain DNA sequence comprising approximately 80% or more, approximately 85% or more, approximately 90% or more, approximately 92% or more, approximately 95% or more, approximately 98% or more, approximately 99% or more, or 100% identity with the heavy chain DNA sequences and light chain DNA sequences listed in Table 4, respectively. Table 4 In some embodiments, the MMP9 antibody includes heavy chain CDR1, heavy chain CDR2, heavy chain CDR3, light chain CDR1, light chain CDR2, and light chain CDR3, wherein each of the heavy chain CDR1, heavy chain CDR2, heavy chain CDR3, light chain CDR1, light chain CDR2, and light chain CDR3 has approximately 80% or more, approximately 85% or more, approximately 90% or more, approximately 92% or more, approximately 95% or more, approximately 98% or more, approximately 99% or more, or 100% identity with the heavy chain CDR1, heavy chain CDR2, heavy chain CDR3, light chain CDR1, light chain CDR2, and light chain CDR3 listed in Table 5. Table 5 In some embodiments, the MMP9 antibody includes a heavy chain variable region and a light chain variable region, the heavy chain variable region and the light chain variable region having approximately 80% or more identity, approximately 85% or more identity, approximately 90% or more identity, approximately 92% or more identity, approximately 95% or more identity, approximately 98% or more identity, approximately 99% or more identity, or 100% identity with the heavy chain variable regions and light chain variable regions listed in Table 6, respectively. Table 6 In some implementations, the MMP 9 antibody comprises the heavy and light chains listed in Table 7: Table 7 In other embodiments, the MMP 9 antibody includes the amino acid sequences listed in Table 7, provided that the antibody does not include a signal peptide.

[0129] In another embodiment, the MMP9 antibody includes heavy chain CDR1, heavy chain CDR2, heavy chain CDR3, light chain CDR1, light chain CDR2, and light chain CDR3 listed in Table 5, wherein the antibody includes an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of the sequences listed in Tables 6 and 7.

[0130] In another embodiment, the MMP9 antibody includes heavy chain CDR1, heavy chain CDR2, heavy chain CDR3, light chain CDR1, light chain CDR2, and light chain CDR3 listed in Table 5, wherein the antibody includes an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of the sequences listed in Table 7, provided that the antibody does not include a signal peptide.

[0131] In some implementations, the MMP9 antibody includes the heavy chain variable region and the light chain variable region listed in Table 8: Table 8 In some embodiments, the MMP 9 antibody comprises a heavy chain and a light chain, the heavy chain and light chain comprising approximately 80% or more, approximately 85% or more, approximately 90% or more, approximately 92% or more, approximately 95% or more, approximately 98% or more, approximately 99% or more, or 100% identity with the heavy chains and light chains listed in Table 9, respectively. Table 9 In other embodiments, the MMP 9 antibody includes the amino acid sequences listed in Table 9, provided that the antibody does not include a signal peptide.

[0132] In another embodiment, the MMP9 antibody comprises an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any of the sequences listed in Tables 8 and 9.

[0133] In another embodiment, the MMP9 antibody comprises an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any of the sequences listed in Table 9, provided that the antibody does not include a signal peptide.

[0134] In some embodiments, the MMP9 antibody includes heavy chain CDR1, heavy chain CDR2, heavy chain CDR3, light chain CDR1, light chain CDR2, and light chain CDR3, wherein each of the heavy chain CDR1, heavy chain CDR2, heavy chain CDR3, light chain CDR1, light chain CDR2, and light chain CDR3 has approximately 80% or more, approximately 85% or more, approximately 90% or more, approximately 92% or more, approximately 95% or more, approximately 98% or more, approximately 99% or more, or 100% identity with the heavy chain CDR1, heavy chain CDR2, heavy chain CDR3, light chain CDR1, light chain CDR2, and light chain CDR3 listed in Table 10. Table 10 In some embodiments, the MMP9 antibody includes a heavy chain variable region and a light chain variable region, the heavy chain variable region and the light chain variable region having approximately 80% or more identity, approximately 85% or more identity, approximately 90% or more identity, approximately 92% or more identity, approximately 95% or more identity, approximately 98% or more identity, approximately 99% or more identity, or 100% identity with the heavy chain variable regions and light chain variable regions listed in Table 11, respectively. Table 11 In some embodiments, the MMP 9 antibody comprises a heavy chain and a light chain, the heavy chain and light chain comprising approximately 80% or more, approximately 85% or more, approximately 90% or more, approximately 92% or more, approximately 95% or more, approximately 98% or more, approximately 99% or more, or 100% identity with the heavy chains and light chains listed in Table 12, respectively. Table 12 In other embodiments, the MMP 9 antibody includes the amino acid sequences listed in Table 12, provided that the antibody does not include a signal peptide.

[0135] In another embodiment, the MMP9 antibody includes heavy chain CDR1, heavy chain CDR2, heavy chain CDR3, light chain CDR1, light chain CDR2, and light chain CDR3 listed in Table 10, wherein the antibody includes an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of the sequences listed in Tables 11 and 12.

[0136] In another embodiment, the MMP9 antibody comprises heavy chain CDR1, heavy chain CDR2, heavy chain CDR3, light chain CDR1, light chain CDR2, and light chain CDR3 listed in Table 10, wherein the antibody comprises at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical amino acid sequences to any one of the sequences listed in Table 12, provided that the antibody does not include a signal peptide. In some embodiments, the MMP9 antibody comprises only the light chain.

[0137] In some embodiments, the MMP9 antibody includes light chain CDR1, light chain CDR2, and light chain CDR3, wherein light chain CDR1, light chain CDR2, and light chain CDR3 respectively have approximately 80% or more, approximately 85% or more, approximately 90% or more, approximately 92% or more, approximately 95% or more, approximately 98% or more, approximately 99% or more, or 100% identity with the light chain CDR1, light chain CDR2, and light chain CDR3 listed in Table 13. Table 13 In some embodiments, the MMP9 antibody includes a light chain variable region having approximately 80% or more identity, approximately 85% or more identity, approximately 90% or more identity, approximately 92% or more identity, approximately 95% or more identity, approximately 98% or more identity, approximately 99% or more identity, or 100% identity with the light chain variable regions listed in Table 14. Table 14 In some embodiments, the MMP 9 antibody comprises a light chain having approximately 80% or more identity, approximately 85% or more identity, approximately 90% or more identity, approximately 92% or more identity, approximately 95% or more identity, approximately 98% or more identity, approximately 99% or more identity, or 100% identity with the light chains listed in Table 15. Table 15 In other embodiments, the MMP 9 antibody includes the amino acid sequences listed in Table 15, provided that the antibody does not include a signal peptide.

[0138] In another embodiment, the MMP9 antibody includes heavy chain CDR1, heavy chain CDR2, heavy chain CDR3, light chain CDR1, light chain CDR2, and light chain CDR3 listed in Table 13, wherein the antibody includes an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of the sequences listed in Tables 14 and 15.

[0139] In another embodiment, the MMP9 antibody includes heavy chain CDR1, heavy chain CDR2, heavy chain CDR3, light chain CDR1, light chain CDR2, and light chain CDR3 listed in Table 13, wherein the antibody includes an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of the sequences listed in Table 15, provided that the antibody does not include a signal peptide.

[0140] In some embodiments, the CDR sequence, heavy / light chain variable region sequence, and / or heavy / light chain sequence are similar to, but not identical to, the sequences described above (i.e., not sharing 100% sequence identity). In some embodiments, the sequence identity of the CDR sequence, heavy / light chain variable region sequence, and / or heavy / light chain sequence of the MMP9 antibody described herein is about 80% or higher than those described above, such as about 85% or higher, about 90% or higher, about 95% or higher, about 98% or higher, or about 99% or higher.

[0141] In other embodiments, the MMP9 antibody includes a CDR comprising: a CDR sequence listed in any one of Tables 1, 5, and 10; or a CDR sequence listed in any one of Tables 1, 5, and 10 containing one or more (e.g., one, two, three, four, five, or more) substitutions, insertions, deletions, and / or additions (and combinations thereof) compared to the CDR sequences listed in any one of Tables 1, 5, and 10, wherein the MMP9 antibody is capable of binding to MMP9.

[0142] In some embodiments, the MMP9 antibody includes variants of the antibodies described above, such as recombinant antibodies, multispecific antibodies (including bispecific antibodies), human antibodies, humanized antibodies, chimeric antibodies, synthetic antibodies, tetramer antibodies comprising two heavy chain and two light chain molecules, antibody light chain monomers, antibody heavy chain monomers, antibody light chain dimers, antibody heavy chain dimers, antibody light chain-antibody heavy chain pairs, intrabodies, conjugated antibodies, single-domain antibodies, monovalent antibodies, single-chain antibodies or single-chain Fv (scFv), nanobodies, intracellular antibodies, intrabodies, camelized antibodies, camelid antibodies, IgNAR antibodies, affybodies, Fab fragments, F(ab') fragments, F(ab)2, disulfide-linked Fv (sdFv), anti-idiotypic (anti-Id) antibodies (including, for example, anti-anti-Id antibodies), and antigen-binding fragments of any of the above antibodies. Furthermore, the sequence of the MMP9 antibody in this article can be engineered to any type (e.g., IgG, IgE, IgM, IgD, IgA, or IgY), any class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, or IgA2), or any subclass (e.g., IgG2a or IgG2b).

[0143] In some embodiments, protein inhibitors of MMP-9 include non-antibody protein or peptide inhibitors of MMP-9. Non-limiting examples of non-antibody protein or peptide inhibitors of MMP-9 include proteins from the tissue inhibitors of metalloproteinases (TIMP) family, such as TIMP-1, TIMP-3, etc., FFAGLDD peptide, FFAGLDD TFA, cyclic CTTHWGFTLC, cyclic CTTHWGFTLC TFA, etc.

[0144] RNA interference nucleic acids and their expression vectors for downregulating MMP-9 In some embodiments, compounds that downregulate MMP-9 levels and / or activity include nucleic acids that downregulate MMP-9 levels via RNA interference and / or expression vectors expressing those nucleic acids.

[0145] In some embodiments, the nucleic acid that downregulates MMP-9 levels via RNA interference comprises isolated nucleic acids. In other embodiments, the regulator is an RNAi molecule (such as, but not limited to, siRNA and / or shRNA and / or miRNA) or an antisense molecule that inhibits MMP-9 expression and / or activity. In still other embodiments, the nucleic acid includes a promoter / regulatory sequence such that the nucleic acid is preferably capable of directing the expression of the nucleic acid. Therefore, this specification provides expression vectors and methods for introducing exogenous DNA into cells and simultaneously expressing the exogenous DNA in the cells, such as those described, for example, in Sambrook et al. (2012, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York) and in Ausubel et al. (1997, Current Protocols in Molecular Biology, John Wiley & Sons, New York) and elsewhere herein.

[0146] In some implementations, siRNA is used to reduce MMP-9 levels. RNA interference (RNAi) is a phenomenon that introduces double-stranded RNA (dsRNA) into various organisms and cell types, leading to the degradation of complementary mRNA. In cells, long dsRNA is cleaved into short interfering RNAs, or siRNAs, of 21–25 nucleotides by ribonucleases called cleavage enzymes. The siRNA then assembles with protein components to form an RNA-induced silencing complex (RISC), which unfolds in the process. The activated RISC then binds to the complementary transcript via a base-pairing interaction between the antisense strand of the siRNA and the mRNA. The bound mRNA is cleaved, and the sequence-specific degradation of the mRNA results in gene silencing. See, for example, U.S. Patent No. 6,506,559; Fire et al. ,1998, Nature 391(19):306-311;Timmons et al. , 1998, Nature 395:854;Montgomery et al., 1998, TIG 14 (7):255-258; Engelke, Ed., RNA Interference (RNAi) Nuts & Bolts of RNAi Technology, DNA Press, Eagleville, PA (2003); and Hannon, Ed., RNAi A Guide to Gene Silencing, Cold Spring Harbor Laboratory Press, ColdSpring Harbor, NY (2003). Soutschek et al. (2004, Nature 432:173-178) describes the chemical modification of siRNA that facilitates intravenous systemic delivery. Optimization of siRNA involves considerations of total G / C content, terminal C / T content, Tm, and nucleotide content at the 3' overhang. See, for example, Schwartz. et al. , 2003, Cell, 115:199-208 and Khvorova et al. , 2003, Cell 115:209-216. Therefore, this specification also includes methods for reducing MMP-9 levels using RNAi technology.

[0147] In some embodiments, this specification provides a vector comprising siRNA or antisense polynucleotide. In other embodiments, siRNA or antisense polynucleotide inhibits MMP-9 expression. The incorporation of the desired polynucleotide into the vector and the choice of vector are well known in the art.

[0148] In some embodiments, the expression vector described herein encodes a short hairpin RNA (shRNA) inhibitor. ShRNA inhibitors are well-known in the art and target specific mRNAs, thereby reducing the expression of the target. In some embodiments, the encoded shRNA is expressed by a cell and then processed into siRNA. For example, in some cases, the cell possesses a natural enzyme (e.g., a cleavage enzyme) that cleaves the shRNA to form siRNA.

[0149] siRNA, shRNA, or antisense polynucleotides can be cloned into various types of vectors described elsewhere in this document. For the expression of siRNA or antisense polynucleotides, at least one module in each promoter functions to locate the initiation site of RNA synthesis.

[0150] To assess the expression of siRNA, shRNA, or antisense polynucleotides, the expression vector to be introduced into cells may also contain a selectable marker gene or a reporter gene, or both, to facilitate the identification and selection of expressing cells from a cell population attempting transfection or infection using a viral vector. In some embodiments, the selectable marker may be carried on a separate DNA fragment and used in a co-transfection procedure. Both the selectable marker and the reporter gene may be side-linked with appropriate regulatory sequences to achieve expression in host cells. Useful selectable markers are known in the art and include, for example, antibiotic resistance genes, such as neomycin resistance.

[0151] After generating siRNA polynucleotides, those skilled in the art will understand that siRNA polynucleotides possess certain properties that can be modified to improve siRNA as a therapeutic compound. Therefore, in some embodiments, siRNA polynucleotides are further designed to resist degradation by modifying them to include thiophosphates or other bonds, methylphosphonates, sulfones, sulfates, ketones, dithiophosphates, aminophosphates, phosphates, etc. (see, for example, Agrwal). et al. , 1987, Tetrahedron Lett. 28:3539-3542; Stec et al. , 1985 Tetrahedron Lett. 26:2191-2194; Moody et al. , 1989 Nucleic Acids Res. 12:4769-4782; Eckstein, 1989 Trends Biol. Sci. 14:97-100; Stein, In: Oligodeoxynucleotides. Antisense Inhibitors ofGene Expression, Cohen, ed., Macmillan Press, London, pp. 97-117 (1989)).

[0152] Any polynucleotide can be further modified to increase its in vivo stability. Possible modifications include, but are not limited to, adding side sequences at the 5' and / or 3' ends; using thiophosphate or 2' O-methyl groups in the main chain instead of phosphodiester bonds; and / or including non-traditional bases such as inosine, queosine, and huastin, as well as other modifications such as acetyl-methyl-, thio-, and adenine, cytidine, guanine, thymine, and uridine.

[0153] In some implementations, the antisense nucleic acid sequence expressed by the plasmid vector is used to suppress MMP-9 protein expression. The antisense expression vector is used to transfect mammalian cells or mammals themselves, thereby leading to a decrease in endogenous expression of MMP-9.

[0154] Antisense molecules and their use in suppressing gene expression are well known in the art (see, for example, Cohen, 1989, In: Oligodeoxyribonucleotides, Antisense Inhibitors of Gene Expression, CRCPress). An antisense nucleic acid is a DNA or RNA molecule that is complementary to at least a portion of a specific mRNA molecule, as the term is defined elsewhere herein (Weintraub, 1990, Scientific American 262:40). In the cell, antisense nucleic acids hybridize with their corresponding mRNA to form a double-stranded molecule, thereby suppressing gene translation.

[0155] The use of antisense methods to suppress gene translation is known in the art and is described, for example, in Marcus-Sakura (1988, Anal. Biochem. 172:289). As taught in Inoue, 1993, U.S. Patent No. 5,190,931, such antisense molecules can be delivered to cells via genetic expression using DNA encoding antisense molecules.

[0156] Optionally, the antisense molecules described herein can be synthesized and then provided to cells. Antisense oligomers of about 10 to about 30, and more preferably about 15 nucleotides, can be used because they are readily synthesized and introduced into target cells. Synthetic antisense molecules considered in this specification include oligonucleotide derivatives known in the art that exhibit enhanced biological activity compared to unmodified oligonucleotides (see U.S. Patent No. 5,023,243).

[0157] Downregulating MMP-9 ribozymes and their expression vectors In some embodiments, compounds that downregulate MMP-9 levels and / or activity include ribozymes that downregulate MMP-9 and / or vectors expressing those ribozymes.

[0158] Ribozymes are used to inhibit the expression of the MMP-9 protein. Ribozymes for inhibiting the expression of target molecules can be designed by incorporating a target sequence into a basic ribozyme structure that is complementary to, for example, an mRNA sequence encoding MMP-9. Ribozymes are antisense RNAs whose catalytic sites specifically cleave complementary RNA. Therefore, a ribozyme having a sequence complementary to the MMP-9 mRNA sequence can downregulate MMP-9 expression by reducing the level of MMP-9 mRNA. Ribozymes targeting MMP-9 can be synthesized using commercially available reagents (Applied Biosystems, Inc., Foster City, CA) or can be genetically expressed via DNA encoding them. In some embodiments, the DNA encoding the ribozyme is incorporated into a vector described elsewhere herein.

[0159] Compounds that downregulate MMP-9 using CRISPR knockout / knockdown and other knockout / knockdown techniques In some embodiments, compounds that downregulate MMP-9 levels and / or activity include compounds that downregulate MMP-9 via CRISPR knockout / knockdown and other knockout / knockdown techniques. In some embodiments, compounds include expression vectors comprising expression cassettes that express CRISPR components that downregulate MMP-9 via CRISPR knockout or CRISPR knockdown.

[0160] In some implementations, compounds that downregulate the activity or level of MMP-9 include the CRISPR / Cas9 system for knocking out MMP-9.

[0161] The CRISPR / Cas9 system is an readily available and highly efficient system for inducing targeted gene alterations. Cas9 protein target recognition requires a "seed" sequence within the guide RNA (gRNA) and a conserved dinucleotide protospacer adjacent motif (PAM) upstream of the gRNA-binding region. The CRISPR / Cas9 system can then be engineered by redesigning the gRNA to cleave virtually any DNA sequence in cell lines (such as 293T cells), primary cells, and CAR T cells. The CRISPR / Cas9 system can simultaneously target multiple genomic loci by co-expressing a single Cas9 protein with two or more gRNAs, making it uniquely suited for multiplex gene editing or synergistic activation of target genes.

[0162] The Cas9 protein and guide RNA form a complex that recognizes and cleaves target sequences. Cas9 consists of six domains: REC I, REC II, a bridge helix, PAM interaction, HNH, and RuvC. The REC I domain binds to the guide RNA, while the bridge helix binds to the target DNA. The HNH and RuvC domains are nuclease domains. The guide RNA is engineered to have a 5' end complementary to the target DNA sequence. When the guide RNA binds to the Cas9 protein, a conformational change occurs, activating the protein. Once activated, Cas9 searches for target DNA by binding to a sequence that matches its protospacer neighboring motif (PAM) sequence. A PAM is a two- or three-nucleotide sequence located one nucleotide downstream of a region complementary to the guide RNA. In a non-restrictive example, the PAM sequence is 5'-NGG-3'. When the Cas9 protein finds its target sequence via the appropriate PAM, it melts the bases upstream of the PAM and pairs them with the complementary region on the guide RNA. Then, the RuvC and HNH nuclease domains cleave the target DNA after the third nucleotide base upstream of PAM.

[0163] U.S. Patent Application Publication No. US2014 / 0068797 describes a non-limiting example of a CRISPR / Cas system for inhibiting gene expression, namely CRISPRi. CRISPRi induces permanent gene disruption by using an RNA-guided Cas9 endonuclease to introduce DNA double-strand breaks, thereby triggering a biased error repair pathway, leading to frameshift mutations. Catalytically dead Cas9 lacks endonuclease activity. When co-expressed with guide RNA, it generates a DNA recognition complex that specifically interferes with transcriptional elongation, RNA polymerase binding, or transcription factor binding. This CRISPRi system efficiently inhibits the expression of the targeted gene.

[0164] CRISPR / Cas gene disruption occurs when a target gene-specific guide nucleic acid sequence and a Cas endonuclease are introduced into the cell and form a complex that enables the Cas endonuclease to introduce double-strand breaks at the target gene. In some embodiments, the CRISPR / Cas system includes an expression vector, such as, but not limited to, the pAd5F35-CRISPR vector. In other embodiments, the Cas expression vector induces the expression of the Cas9 endonuclease. Other endonucleases may also be used, including but not limited to T7, Cas3, Cas8a, Cas8b, Cas10d, Cse1, Csy1, Csn2, Cas4, Cas10, Csm2, Cmr5, Fok1, other nucleases known in the art, and any combination thereof.

[0165] In some embodiments, the inducible Cas expression vector includes an agent that exposes cells to an inducible promoter that activates the Cas expression vector. In such embodiments, the Cas expression vector includes an inducible promoter, such as a promoter that can be induced by exposure to an antibiotic (e.g., by tetracycline or a tetracycline derivative, such as doxycycline). However, it should be understood that other inducible promoters may be used. The inducer can be a selective condition leading to the induction of the inducible promoter (e.g., exposure to an agent, such as an antibiotic). This results in the expression of the Cas expression vector.

[0166] In some embodiments, guide RNA (one or more) and Cas9 can be delivered to cells as a ribonucleoprotein (RNP) complex. RNPs consist of purified Cas9 protein complexed with gRNA and are known in the art to be efficiently delivered to a variety of cell types—including but not limited to neurons, stem cells, and immune cells (Addgene, Cambridge, MA, Mirus Bio LLC, Madison, WI).

[0167] The guide RNA is specific to a region of genomic interest and targets that region to induce a Cas endonuclease-induced double-strand break. The target sequence of the guide RNA sequence may be within a gene locus or within a non-coding region of the genome. In some embodiments, the guide nucleic acid sequence is at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 or more nucleotides in length.

[0168] Guide RNA (gRNA), also known as "short guide RNA" or "sgRNA," provides both target specificity and scaffold / binding capability for the Cas9 nuclease. gRNA can be a synthetic RNA composed of a target sequence and a scaffold sequence derived from endogenous bacterial crRNA and tracrRNA. In genome engineering experiments, gRNA is used to target Cas9 to specific genomic loci. Guide RNAs can be designed using standard tools well-known in the art.

[0169] In the context of CRISPR complex formation, the term "target sequence" refers to a sequence to which the guide sequence is designed to have some complementarity, where hybridization between the target and guide sequences promotes CRISPR complex formation. Perfect complementarity is not required as long as sufficient complementarity is sufficient to induce hybridization and promote CRISPR complex formation. The target sequence can include any polynucleotide, such as DNA or RNA polynucleotides. In some embodiments, the target sequence is located in the cell nucleus or cytoplasm. In other embodiments, the target sequence can be located within organelles (e.g., mitochondria or the nucleus) of eukaryotic cells. Typically, in the context of an endogenous CRISPR system, the formation of the CRISPR complex (including the guide sequence that hybridizes with the target sequence and is complexed with one or more Cas proteins) results in the cleavage of one or both strands of the target sequence in or near it (e.g., within about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, or more base pairs). Similar to the target sequence, perfect complementarity is believed to be unnecessary as long as this is sufficient to function.

[0170] In some embodiments, one or more vectors driving the expression of one or more elements of the CRISPR system are introduced into a host cell, such that the expression of these elements of the CRISPR system guides the formation of the CRISPR complex at one or more target sites. For example, the Cas enzyme, the guide sequence linked to the tracr chaperone sequence, and the tracr sequence may each be operatively linked to a separate regulatory element on a separate vector. Alternatively, two or more elements expressed by the same or different regulatory elements may be combined in a single vector, wherein one or more additional vectors provide any components of the CRISPR system not included in the first vector. The CRISPR system elements combined in the single vector may be arranged in any suitable orientation, such as one element being located at 5' ("upstream") or 3' ("downstream") relative to the second element. The coding sequence of one element may be located on the same or opposite strand of the coding sequence of the second element and oriented in the same or opposite directions. In some implementations, a single promoter drives the expression of a transcript encoding a CRISPR enzyme, as well as one or more of a guide sequence, a tracr chaperone sequence (optionally operably linked to the guide sequence), and a tracr sequence embedded in one or more intron sequences (e.g., each in a different intron, two or more in at least one intron, or all in a single intron).

[0171] In some embodiments, the CRISPR enzyme is part of a fusion protein comprising one or more heterologous protein domains (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more domains in addition to the CRISPR enzyme). The CRISPR enzyme fusion protein may include any additional protein sequence, and optionally a linker sequence between any two domains. Examples of protein domains that can be fused with a CRISPR enzyme, without limitation, include epitope tags, reporter gene sequences, and protein domains having one or more of the following activities: methyltransferase activity, demethyltransferase activity, transcriptional activation activity, transcriptional repression activity, transcription release factor activity, histone modification activity, RNA cleavage activity, and nucleic acid binding activity. Additional domains that may form part of a fusion protein comprising a CRISPR enzyme are described in U.S. Patent Application Publication No. US20110059502 (which is incorporated herein by reference). In some embodiments, the tagged CRISPR enzyme is used to identify the location of a target sequence.

[0172] Conventional virus-based and non-virus-based gene transfer methods can be used to introduce nucleic acids into mammalian and non-mammal cells or target tissues. Such methods can be used to administer nucleic acids encoding components of the CRISPR system to cells in culture or in a host organism. Non-viral vector delivery systems include DNA plasmids, RNA (e.g., transcripts of the vectors described herein), naked nucleic acids, and nucleic acids complexed with a delivery medium such as liposomes. Viral vector delivery systems include DNA viruses and RNA viruses that, upon delivery to cells, possess an appendage-type or integrated genome (Anderson, 1992, Science 256:808-813; and Yu, et al. , 1994, Gene Therapy 1:13-26).

[0173] In some embodiments, CRISPR / Cas is derived from the type II CRISPR / Cas system. In other embodiments, the CRISPR / Cas system is derived from the Cas9 protein. The Cas9 protein may be derived from Streptococcus pyogenes, Streptococcus thermophilus, or other species.

[0174] Typically, Cas proteins include at least one RNA recognition and / or RNA binding domain. The RNA recognition and / or RNA binding domain interacts with a guide RNA. Cas proteins may also include nuclease domains (i.e., DNase or RNase domains), DNA-binding domains, helicase domains, RNase domains, protein-protein interaction domains, dimerization domains, and other domains. Cas proteins can be modified to increase nucleic acid binding affinity and / or specificity, alter enzymatic activity, and / or change other properties of the protein. In some embodiments, the Cas-like protein of the fusion protein may be derived from a wild-type Cas9 protein or a fragment thereof. In other embodiments, Cas may be derived from a modified Cas9 protein. For example, the amino acid sequence of the Cas9 protein may be modified to alter one or more properties of the protein (e.g., nuclease activity, affinity, stability, etc.). Optionally, domains of the Cas9 protein that do not participate in RNA-guided cleavage may be removed from the Cas9 protein, such that the modified Cas9 protein is smaller than the wild-type Cas9 protein. Typically, Cas9 proteins include at least two nuclease (i.e., DNase) domains. For example, the Cas9 protein may include a RuvC-like nuclease domain and an HNH-like nuclease domain. The RuvC and HNH domains work together to cleave single strands, thereby creating double-strand breaks in DNA (Ji Jinek, et al. (2012, Science, 337:816-821). In some embodiments, the Cas9-derived protein may be modified to contain only one functional nuclease domain (RuvC-like or HNH-like nuclease domain). For example, the Cas9-derived protein may be modified such that one of the nuclease domains is deleted or mutated, rendering it nonfunctional (i.e., nuclease activity is absent). In some embodiments where one of the nuclease domains is inactive, the Cas9-derived protein is able to introduce a nick into double-stranded nucleic acid (this protein is called a "nickase"), but does not cleave double-stranded DNA. In any of the above embodiments, any or all of the nuclease domains may be inactivated using known methods (such as site-directed mutagenesis, PCR-mediated mutagenesis, and total gene synthesis) and other methods known in the art, by one or more deletion mutations, insertion mutations, and / or substitution mutations.

[0175] In one non-limiting embodiment, the vector drives the expression of the CRISPR system. The art is rich with suitable vectors useful in this specification. Vectors to be used are adapted for replication and, optionally, integration in eukaryotic cells. Typical vectors contain transcription and translation terminators, initiation sequences, and promoters that can be used to regulate the expression of the desired nucleic acid sequence. The vectors of this specification can also be used in standard nucleic acid gene delivery protocols. Methods of gene delivery are known in the art (US Patent Nos. 5,399,346, 5,580,859, and 5,589,466, which are incorporated herein by reference in their entirety).

[0176] In addition, vectors can also be provided to cells in the form of viral vectors. Viral vector technology is well known in the art and is described, for example, in Sambrook et al. (4th edition, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York, 2012) and other virology and molecular biology manuals. Viruses that can be used as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpesviruses, Sindbis viruses, gamma retroviruses, and lentiviruses. Typically, a suitable vector contains a source that has replication function in at least one organism, a promoter sequence, a convenient restriction endonuclease site, and one or more selection markers (e.g., WO01 / 96584; WO 01 / 29058; and U.S. Patent No. 6,326,193).

[0177] In some implementations, compounds that downregulate the activity or expression level of MMP-9 include nucleic acids that downregulate the expression level of MMP-9 via CRISPR knockdown. CRISPR knockdown includes, but is not limited to, CRISPRCas13 knockdown. (See, for example, Mendez-Mancilla et al., Cell Chemical Biology 29, 1-7, July 27, 2021, and Kusawah et al., Dev Cell. 2020 Sep 28;54(6):805-817, the entire contents of which are incorporated herein by reference).

[0178] In some embodiments, the invention includes any other methods for achieving gene knockdown and / or editing that result in the deletion and / or inactivation of MMP-9, such as, but not limited to, those described in WO 2018 / 236840 (which is incorporated herein by reference in its entirety).

[0179] Compounds that downregulate MMP-9 through inactivation and / or chelation In some embodiments, the compound that downregulates the activity or expression level of MMP-9 includes a protein that downregulates the activity of MMP-9 by inactivating and / or chelating MMP-9. In some embodiments, the compound includes a nucleic acid that expresses a protein that downregulates the activity of MMP-9 by inactivating and / or chelating MMP-9. In some embodiments, the compound includes an expression vector that expresses a protein that downregulates the activity of MMP-9 by inactivating and / or chelating MMP-9 (see the “Vectors” section for a non-limiting description of the vector).

[0180] In some embodiments, the compound that downregulates the expression level of MMP-9 is a trans-dominant negative mutant of MMP-9 and / or a nucleic acid or vector expressing a trans-dominant negative mutant of MMP-9.

[0181] In some embodiments, the terms "treatment" or "treating" include applying or administering a therapeutic agent, such as a compound useful in this disclosure (alone or in combination with another agent), to a patient, or applying or administering a therapeutic agent to an isolated tissue or cell line from a patient (e.g., for diagnostic or in vitro application), who suffers from a disease or disorder and / or symptoms of a disease or disorder, with the aim of curing, restoring, alleviating, resolving, altering, remedying, improving, or influencing the disease or disorder and / or symptoms of the disease or disorder. Such treatments can be specifically tailored or modified based on knowledge derived from the field of pharmacogenomics.

[0182] As used in this article, "progressive ossifying fibrous dysplasia" or "FOP" refers to a genetic disorder of congenital skeletal malformation and progressive heterotopic ossification (HO).

[0183] In some implementations, as used herein, "heterotopic ossification" or "HO" refers to the formation of extraosseous bone within muscles and soft tissues. HO is a postnatal characteristic of febrile osteoporosis (FOP) and a common post-traumatic event in non-FOP patients. Details of heterotopic ossification can be found, for example, in Meyers et al. (…). JBMR Plus 2019, 3: e10172) and Dey et al. ( Transl Res It is described in August 2017; 186: 95-111.

[0184] In some implementations, when used herein in conjunction with FOP, the term "acute attack" refers to the inflammatory soft tissue swelling experienced by most patients with FOP, which may begin in childhood and progress throughout life. Acute attacks include unpredictable episodes of soft tissue swelling, pain, reduced movement, and / or stiffness. These acute attacks often lead to additional bone formation, but not always. Details of acute attacks in FOP can be found, for example, in Pignolo et al. (…). J Bone Miner Res It is described in 2016 Mar;31(3):650-6).

[0185] Methods for treating, improving, and / or preventing non-FOP heterotopic ossification This study found that downregulating MMP9 levels and / or activity reduced ectopic bone formation in transgenic mice carrying the R206H or Q207D mutation in the Acvr1 gene. These transgenic mice are widely recognized in the art as animal models for general ectopic ossification (HO) studies. This is especially true for Q207D transgenic mice, as this mutation does not lead to spontaneous ectopic ossification but only to HO in response to injury and produces very stable post-traumatic HO. Therefore, the methods described in this paper are also applicable to non-FOP HO.

[0186] Therefore, in some aspects, the present invention relates to methods for treating, improving and / or preventing non-FOP heterotopic ossification (HO) in subjects in need.

[0187] In some embodiments, the method includes administering a compound to the subject that downregulates the level and / or activity of MMP-9 in the subject.

[0188] In some embodiments, the compounds that downregulate MMP-9 levels and / or activity are the same as or similar to those described elsewhere herein, such as in the section “Methods for treating, improving and / or preventing progressive ossifying fibrous dysplasia”.

[0189] In some implementations, non-FOP HO is caused by bone trauma or injury, severe burns, stroke, head trauma, paralysis, orthopedic procedures, hip replacement, severe crush injury, blast injury (such as blast injury caused by improvised explosive devices), war wounds, severe civilian trauma, poliomyelitis, tetanus, syringomyelia, myelodysplastic syndrome, multiple sclerosis (MS), carbon monoxide poisoning, or spinal tumors.

[0190] A kit for the treatment, improvement, and / or prevention of progressive ossifying fibrous dysplasia and / or non-FOP heterotopic ossification. Group or composition In some aspects, the present invention relates to kits for treating, improving and / or preventing progressive ossifying fibrous dysplasia (FOP) in subjects in need, or for treating, improving and / or preventing non-FOP HO.

[0191] In some aspects, the present invention relates to kits for treating, improving, and / or preventing heterotopic ossification in subjects in need.

[0192] In some embodiments, the kit includes a compound that downregulates MMP-9 levels and / or activity in a subject; and a manual instructing the subject to administer an effective amount of the compound. In some embodiments, the compound that downregulates MMP-9 levels and / or activity in a subject is the same as or similar to the compound described elsewhere herein, such as in the section “Methods for Treating, Improving and / or Preventing Progressive Ossifying Fibrodysplasia”.

[0193] In some aspects, the present invention relates to compositions, such as pharmaceutical compositions, for treating, improving and / or preventing progressive ossifying fibrous dysplasia (FOP) in subjects of need or for treating, improving and / or preventing non-FOP HO.

[0194] In some embodiments, the composition includes a compound that downregulates MMP-9 levels and / or activity in the target, and a pharmaceutically acceptable carrier. In some embodiments, the compound that downregulates MMP-9 levels and / or activity in the target is the same as or similar to compounds described elsewhere herein, such as in the section “Methods for Treating, Improving and / or Preventing Progressive Fibrosoid Dysplasia of Ossification”. Pharmaceutically acceptable carriers are described elsewhere herein.

[0195] carrier Vectors can increase the stability of nucleic acids, make delivery easier, or allow nucleic acids or their protein products to be expressed in cells.

[0196] Therefore, in some implementations, protein inhibitors or nucleic acids that downregulate the activity or expression level of MMP-9 are incorporated into the vector.

[0197] In some embodiments, this specification relates to vectors, including nucleic acid sequences or constructs of this specification. The choice of vector will depend on the host cell in which the vector will subsequently be introduced. In some embodiments, the vector of this specification is an expression vector. Suitable host cells include a variety of prokaryotic and eukaryotic host cells. In some embodiments, the expression vector is selected from viral vectors, bacterial vectors, and mammalian cell vectors. Systems based on prokaryotic and / or eukaryotic vectors can be used in this specification to produce polynucleotides or their homologous polypeptides. Many such systems are widely available on the market.

[0198] In some embodiments, the vector is a viral vector. Viral vector technology is well known in the art and is described, for example, in handbooks of virology and molecular biology. Viruses that can be used as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpesviruses, and lentiviruses. Typically, a suitable vector contains a source that has replication function in at least one organism, a promoter sequence, a convenient restriction endonuclease site, and one or more selection markers (see, for example, WO 01 / 96584; WO 01 / 29058; and U.S. Patent No. 6,326,193).

[0199] In some embodiments, the viral vector is a suitable adeno-associated virus (AAV), such as the AAV1-AAV8 family of adeno-associated viruses. In some embodiments, the viral vector is a human-infectable viral vector. A desired nucleic acid sequence (such as the nucleic acid that downregulates MMP-9 as described above) may be inserted between inverted terminal repeat (ITR) sequences in the AAV. In various embodiments, the viral vector is AAV2 or AAV8. The promoter may be a thyroxine-binding globulin (TBG) promoter. In various embodiments, the promoter is a human promoter sequence capable of achieving the desired nucleic acid expression in bone marrow, lymphoid tissue, connective tissue, kidney, bladder, and other tissues in which MMP-9 is expressed. In some embodiments, the promoter is a neuron-selective promoter or a neuron-specific promoter. The AAV may be a recombinant AAV, wherein the capsid is derived from one AAV serotype and the ITR is derived from another AAV serotype. In various embodiments, the AAV capsid is selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, and AAV8 capsids. In various embodiments, the ITR in the AAV is at least one ITR selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, and AAV8 ITRs. In various embodiments, this specification considers AAV8 viral vectors (recombinant or non-recombinant) comprising the desired nucleic acid expression sequence and at least one promoter sequence, which, upon administration to a subject, induces a systemic elevation of the desired nucleic acid expression. In some embodiments, the viral vector is a recombinant or non-recombinant AAV2 or AAV5 comprising any of the desired nucleic acid expression sequences described herein.

[0200] In some embodiments, the vector incorporating the nucleic acid sequence is a plasmid that may or may not be integrated into the genome of the host cell when introduced into the cell. Illustrative, non-limiting examples of vectors into which nucleotide sequences or gene constructs of this specification may be inserted include tet-on inducible vectors for expression in eukaryotic cells.

[0201] The carrier can be obtained by conventional methods known to those skilled in the art (Sambrook) et al. (2012). In some embodiments, the vector is a vector for transforming animal cells.

[0202] In some embodiments, the recombinant expression vector may also contain a nucleic acid molecule encoding a peptide or peptide mimic inhibitor as described herein, as elsewhere herein.

[0203] Promoters can be promoters naturally associated with a gene or polynucleotide sequence, obtained by isolating a 5' non-coding sequence located upstream of a coding region and / or exon. Such promoters may be referred to as "endogenous." Similarly, enhancers can be enhancers naturally associated with a polynucleotide sequence, located downstream or upstream of that sequence. Optionally, certain advantages can be obtained by placing the coding polynucleotide segment under the control of a recombinant or heterologous promoter, which is a promoter that is not normally associated with a polynucleotide sequence in its natural environment. Recombinant or heterologous enhancers also refer to enhancers that are not normally associated with a polynucleotide sequence in their natural environment. Such promoters or enhancers may include promoters or enhancers of other genes, as well as promoters or enhancers isolated from any other prokaryotic, viral, or eukaryotic cells, and promoters or enhancers that are not "naturally present," i.e., containing different elements of different transcriptional regulatory regions, and / or mutations that alter expression. In addition to synthesizing nucleic acid sequences that produce promoters and enhancers, recombinant cloning and / or nucleic acid amplification techniques, including PCR, may be used. TM The compositions described herein generate sequences (US Patent 4,683,202, US Patent 5,928,906). Furthermore, it is also considered that control sequences that direct sequence transcription and / or expression within non-nuclear organelles (such as mitochondria, chloroplasts, etc.) may also be used.

[0204] The key will be the use of promoters and / or enhancers that effectively guide the expression of DNA fragments in selected cell types, organelles, and organisms. Those skilled in molecular biology are generally familiar with how to use combinations of promoters, enhancers, and cell types for protein expression. The promoters used can be constitutive, tissue-specific, inducible, and / or useful for guiding high-level expression of introduced DNA fragments under appropriate conditions, such as in the large-scale production of recombinant proteins and / or peptides. Promoters can be heterologous or endogenous.

[0205] Recombinant expression vectors may also contain selection marker genes that facilitate selection of transformed or transfected host cells. Suitable selection marker genes are genes encoding proteins (such as G418 and hygromycin) that confer resistance to certain drugs, β-galactosidase, chloramphenicol acetyltransferase, firefly luciferase, or immunoglobulins or portions thereof (such as the Fc portion of immunoglobulins, preferably IgG). The selection marker can be introduced into a vector separate from the nucleic acid of interest.

[0206] Combination therapy In some embodiments, methods for treating, improving, and / or preventing diseases and / or disorders as conceived herein include administering to a subject an effective amount of at least one compound and / or composition conceived in this disclosure.

[0207] In some embodiments, the subject is further administered at least one additional agent for treating, improving, and / or preventing the disease and / or disorder considered herein. In other embodiments, the compound and at least one additional agent are co-administered to the subject. In still other embodiments, the compound and at least one additional agent are co-formulated.

[0208] The compounds contemplated in this disclosure are intended for use in combination with one or more other compounds. These other compounds may include the compounds of this disclosure and / or at least one other agent for treating neurodegenerative conditions, and / or at least one other agent for treating one or more diseases or disorders contemplated herein.

[0209] The synergistic effect can be calculated, for example, using appropriate methods such as Sigmoid-E. max The equations mentioned above include the concentration-response curve (Holford & Scheiner, 1981, Clin. Pharmacokinet. 6:429-453), the Loewe Additivity equation (Loewe & Muischnek, 1926, Arch. Exp. Pathol Pharmacol. 114:313-326), and the intermediate-effect equation (Chou & Talalay, 1984, Adv. Enzyme Regul. 22:27-55). Each of these equations can be applied to experimental data to generate corresponding graphs to help evaluate the effects of drug combinations. The corresponding graphs associated with the equations mentioned above are concentration-response curves, equivalence line plots, and combination index curves.

[0210] Application / Dosage / Formulation Administration regimens may affect the composition of the effective dose. The therapeutic formulation may be administered to the subject before or after the onset of the disease and / or disorder considered herein. Furthermore, several separate doses and alternating doses may be administered daily or sequentially, or the dose may be administered via continuous infusion or bolus injection. Additionally, the dosage of the therapeutic formulation considered in this disclosure may be increased or decreased proportionally according to indications of the urgency of the treatment or prevention situation.

[0211] The compositions considered in this disclosure can be administered to a patient, preferably a mammal, more preferably a human, using known procedures, at doses and for periods of time that are effective in treating the disease and / or disorder considered herein. The effective amount of the therapeutic compound necessary to achieve a therapeutic effect may vary depending on factors such as the state of the disease or disorder in the patient; the patient's age, sex, and weight; and the ability of the therapeutic compound considered in this disclosure to treat the disease and / or disorder considered herein in the patient. Dosing regimens can be adjusted to provide an optimal therapeutic response. For example, several separate doses may be administered daily, or the dose may be reduced proportionally, as indicated by the urgency of the treatment condition. A non-limiting example of the effective dose range of the therapeutic compounds considered in this disclosure is from about 1 mg / kg to 5,000 mg / kg body weight per day. Those skilled in the art will be able to investigate the relevant factors and determine the effective amount of the therapeutic compound without excessive experimentation.

[0212] The actual dosage level of the active ingredient in the pharmaceutical composition considered in this disclosure can be changed to obtain an amount of active ingredient that effectively achieves the desired therapeutic response for a particular patient, composition, and manner of administration, while being non-toxic to the patient.

[0213] Specifically, the selected dosage level depends on a variety of factors, including the activity of the particular compound used, the time of administration, the rate of excretion of the compound, the duration of treatment, other drugs, compounds or materials used in combination with the compound, the age, sex, weight, condition, general health status and medical history of the patient being treated, and similar factors known in the medical field.

[0214] A physician, such as a doctor or veterinarian, with ordinary skills in the art can readily determine and prescribe the required effective amount of the pharmaceutical composition. For example, a physician or veterinarian may begin with a dose of a compound contemplated in this disclosure in the pharmaceutical composition at a level below the required level to achieve the desired therapeutic effect and gradually increase the dose until the desired effect is achieved.

[0215] In specific embodiments, formulation of compounds in unitary dosage form is particularly advantageous for ease of administration and uniformity of dosage. As used herein, unitary dosage form refers to physically discrete units suitable as unitary dosages for a patient to be treated; each unit contains a predetermined amount of therapeutic compound, which is calculated to combine with a desired pharmaceutical agent to produce the desired therapeutic effect. The unitary dosage form considered in this disclosure is determined by and directly depends on: (a) the unique characteristics of the therapeutic compound and the specific therapeutic effect to be achieved, and (b) the inherent limitations of the field of compounding / formulating such therapeutic compounds for the treatment of the diseases and / or disorders considered herein.

[0216] In some embodiments, the compositions of this disclosure are formulated using one or more pharmaceutically acceptable excipients or carriers. In some embodiments, the pharmaceutical compositions of this disclosure comprise a therapeutically effective amount of the compound of this disclosure and a pharmaceutically acceptable carrier.

[0217] The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), suitable mixtures thereof, and vegetable oils. The desired particle size can be maintained in the dispersed state, for example, by using coatings such as lecithin, and suitable flowability can be maintained by using surfactants. Prevention of microbial activity can be achieved by various antibacterial and antifungal agents (e.g., parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, etc.). In many cases, it is preferable to include an isotonic agent in the composition, such as sugar, sodium chloride, or polyols (e.g., mannitol and sorbitol). The absorption of the injectable composition can be prolonged by including an absorption-delaying agent (e.g., aluminum monostearate or gelatin).

[0218] In some embodiments, the compositions of this disclosure are administered to a patient at a dosage ranging from 1 to 5 or more times daily. In another embodiment, the compositions of this disclosure are administered to a patient at a dosage range including, but not limited to, once daily, once every two days, once every three days, once weekly, and once every two weeks. It will be apparent to those skilled in the art that the frequency of administration of the various combinations of this disclosure varies from individual to individual, depending on many factors, including but not limited to age, the disease or disorder to be treated, sex, overall health, and other factors. Therefore, this disclosure should not be construed as limiting to any particular dosage regimen, and the precise dosage and composition to be administered to any patient shall be determined by the attending physician taking into account all other factors of the patient.

[0219] The range of compounds of this disclosure for administration can be from about 1 µg to about 10,000 mg, from about 20 µg to about 9,500 mg, from about 40 µg to about 9,000 mg, from about 75 µg to about 8,500 mg, from about 150 µg to about 7,500 mg, from about 200 µg to about 7,000 mg, from about 3050 µg to about 6,000 mg, from about 500 µg to about 5,000 mg, from about 750 µg to about 4,000 mg, from about 1 mg to about 3,000 mg, from about 10 mg to about 2,500 mg, from about 20 mg to about 2,000 mg, from about 25 mg to about 1,500 mg, from about 30 mg to about 1,000 mg, from about 40 mg to about 900 mg, from about 50 mg to about 800 mg, from about 60 mg to about 750 mg, from about 70 mg to about 600 mg, from about 80 mg to about 500 mg. mg and any and all of their complete and partial increments.

[0220] In some embodiments, the dosage of the compound disclosed herein is from about 1 mg to about 2,500 mg. 。 In some embodiments, the amount of the disclosed compound used in the compositions described herein is less than about 10,000 mg, or less than about 8,000 mg, or less than about 6,000 mg, or less than about 5,000 mg, or less than about 3,000 mg, or less than about 2,000 mg, or less than about 1,000 mg, or less than about 500 mg, or less than about 200 mg, or less than about 50 mg. Similarly, in some embodiments, the dosage of the second compound as described herein is less than about 1,000 mg, or less than about 800 mg, or less than about 600 mg, or less than about 500 mg, or less than about 400 mg, or less than about 300 mg, or less than about 200 mg, or less than about 100 mg, or less than about 50 mg, or less than about 40 mg, or less than about 30 mg, or less than about 25 mg, or less than about 20 mg, or less than about 15 mg, or less than about 10 mg, or less than about 5 mg, or less than about 2 mg, or less than about 1 mg, or less than about 0.5 mg, and any and all of its complete and partial increments.

[0221] In some embodiments, this disclosure relates to packaged pharmaceutical compositions comprising a container holding a therapeutically effective amount of the compound of this disclosure, alone or in combination with a second pharmaceutical agent; and instructions for using the compound to treat, prevent, or reduce one or more symptoms of a neurodegenerative condition in a patient.

[0222] The formulation may be used in combination with conventional excipients, i.e., pharmaceutically acceptable organic or inorganic carriers suitable for intracranial, intrathecal, oral, parenteral, nasal, intravenous, subcutaneous, enteric, or any other suitable mode of administration known in the art. The pharmaceutical preparation may be sterilized and, if desired, mixed with adjuvants (e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts affecting osmotic pressure buffers, colorants, fragrances and / or aromatic substances, etc.). It may also be combined with other active agents (e.g., other analgesics) if necessary.

[0223] Routes of administration for any of the compositions disclosed herein include oral, nasal, rectal, vaginal, parenteral, sublingual, sublingual, or topical. The compounds used in this disclosure may be formulated for administration via any suitable route, such as oral or parenteral, for example, transdermal, transmucosal (e.g., sublingual, lingual, sublingual, urethral, ​​vaginal (e.g., vaginal and perivallary), nasal (internal) and rectal, intrabladder, intrapulmonary, intraduodenal, intragastric, intrathecal, intrasheathal, subcutaneous, intramuscular, intradermal, intraarterial, intravenous, intrabronchial, inhalation, and topical application.

[0224] Suitable compositions and dosage forms include, for example, tablets, capsules, pouches, pills, gel caps, troches, dispersants, suspensions, solutions, syrups, granules, beads, transdermal patches, gels, powders, pellets, magmas, lozenges, creams, pastes, plasters, lotions, discs, suppositories, liquid sprays for nasal or oral administration, dry powder or nebulized formulations for inhalation, and compositions and formulations for intravesical administration. It should be understood that these formulations and compositions used in this disclosure are not limited to the specific formulations and compositions described herein.

[0225] Oral administration For oral administration, tablets, dragees, liquids, drops, suppositories, capsules, sac tablets, and sac-like tablets are particularly suitable. Compositions intended for oral use can be prepared according to any method known in the art, and such compositions may contain one or more agents selected from inert, pharmaceutically non-toxic excipients suitable for the manufacture of tablets. Such excipients include, for example, inert diluents such as lactose; granulating and disintegrants such as corn starch; binders such as starch; and lubricants such as magnesium stearate. Tablets may be uncoated or they may be coated using known techniques to improve appearance or delay the release of the active ingredient. Oral formulations may also be presented as hard gelatin capsules in which the active ingredient is mixed with an inert diluent.

[0226] For oral administration, the compounds disclosed herein may be in the form of tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binders (e.g., polyvinylpyrrolidone, hydroxypropyl cellulose, or hydroxypropyl methylcellulose); fillers (e.g., corn starch, lactose, microcrystalline cellulose, or calcium phosphate); lubricants (e.g., magnesium stearate, talc, or silica); disintegrants (e.g., sodium glycolate starch); or wetting agents (e.g., sodium dodecyl sulfate). If desired, tablets may be coated using suitable methods and coating materials such as the OPADRY™ film coating system available from Colorcon, West Point, Pa. (e.g., OPADRY™ OY, OYC, organic enteric OY-P, aqueous enteric OY-A, OY-PM, and OPADRY™ White, 32K18400). Liquid formulations for oral administration may be in the form of solutions, syrups, or suspensions. Liquid formulations can be prepared by conventional means using pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol syrup, methylcellulose, or hydrogenated edible fats); emulsifiers (e.g., lecithin or gum arabic); non-aqueous mediators (e.g., almond oil, oily esters, or ethanol); and preservatives (e.g., methylparaben, propylparaben, or sorbic acid).

[0227] This disclosure also includes multilayer tablets comprising a layer providing delayed release of one or more compounds of this disclosure, and other layers providing immediate release of another drug. Using a wax / pH-sensitive polymer mixture, a gastric-insoluble composition is obtained—in which the active ingredient is encapsulated, ensuring its delayed release.

[0228] External application For parenteral administration, the compounds of this disclosure may be formulated for injection or infusion, for example, intravenous, intramuscular, or subcutaneous injection or infusion, or for pellet-dose administration and / or continuous infusion. Suspensions, solutions, or emulsions in oily or aqueous media may be used, optionally containing other formulations (such as suspending agents, stabilizers, and / or dispersants).

[0229] Other forms of application Further dosage forms disclosed herein include those described in U.S. Patent Nos. 6,340,475; 6,488,962; 6,451,808; 5,972,389; 5,582,837; and 5,007,790. Further dosage forms disclosed herein also include those described in U.S. Patent Application Nos. 20030147952; 20030104062; 20030104053; 20030044466; 20030039688; and 20020051820. Other dosage forms disclosed herein include those described in PCT application numbers WO 03 / 35041; WO 03 / 35040; WO 03 / 35029; WO 03 / 35177; WO 03 / 35039; WO 02 / 96404; WO 02 / 32416; WO 01 / 97783; WO 01 / 56544; WO 01 / 32217; WO 98 / 55107; WO 98 / 11879; WO 97 / 47285; WO 93 / 18755; and WO 90 / 11757.

[0230] Controlled-release formulations and drug delivery systems In some embodiments, the formulations disclosed herein may be, but are not limited to, short-term, rapid-offset, and controlled, such as sustained-release, delayed-release, and pulsatile-release formulations.

[0231] The term sustained release, when used in its conventional sense, refers to a pharmaceutical preparation that provides a gradual release of the drug over an extended period of time, although not necessarily, but which results in a substantially constant blood level of the drug over that extended period. This period can be as long as one month or longer, and should be a longer release time than the same amount administered by bolus injection.

[0232] For sustained release, the compound can be formulated with a suitable polymer or hydrophobic material that provides sustained release properties. Thus, the compound used with the methods of this disclosure can be administered in particulate form, for example by injection, or in wafers or discs by implantation.

[0233] In some embodiments of this disclosure, a sustained-release formulation is used to administer the compounds of this disclosure to a patient, either alone or in combination with another agent.

[0234] When used in its conventional sense here, the term delayed release refers to a pharmaceutical preparation that provides the initial release of the drug after a certain delay following drug administration, although not mandatory, but may include a delay of about 10 minutes to about 12 hours.

[0235] When used in its conventional sense in this article, the term pulse release refers to a pharmaceutical preparation that delivers the drug in a manner that produces a pulsed plasma distribution of the drug after administration.

[0236] The term "immediate release" is used in its conventional sense here to refer to a pharmaceutical preparation that provides the release of the drug immediately after administration.

[0237] As used herein, "short term" means any time period following drug administration, up to and including approximately 8 hours, 7 hours, 6 hours, 5 hours, 4 hours, 3 hours, 2 hours, 1 hour, 40 minutes, 20 minutes, or 10 minutes after drug administration, and any or all of their complete or partial increments.

[0238] As used herein, rapid failure refers to any time period following drug administration, up to and including approximately 8 hours, approximately 7 hours, approximately 6 hours, approximately 5 hours, approximately 4 hours, approximately 3 hours, approximately 2 hours, approximately 1 hour, approximately 40 minutes, approximately 20 minutes, or approximately 10 minutes, and any and all of their full or partial increments.

[0239] Dosage The therapeutically effective amount or dosage of the compounds disclosed herein depends on the patient's age, sex, weight, current medical condition, and the progression of neurodegenerative disease in the patient being treated. A skilled technician can determine the appropriate dosage based on these and other factors.

[0240] Suitable doses of the compounds disclosed herein can range from about 0.01 mg to about 5000 mg per day, such as about 0.1 mg to about 1000 mg per day, such as about 1 mg to about 500 mg per day, such as about 5 mg to about 250 mg per day. The dose can be administered as a single dose or multiple doses, such as one to four or more times per day. When multiple doses are used, the amounts of each dose can be the same or can be different. For example, a 1 mg daily dose can be administered as two 0.5 mg doses, with an interval of about 12 hours between doses.

[0241] It should be understood that, in non-limiting examples, the amount of compound administered daily may be given once daily, every other day, every 2 days, every 3 days, every 4 days, or every 5 days. For example, when administered every other day, a daily dose of 5 mg may begin on Monday, followed by the first subsequent daily dose of 5 mg on Wednesday, the second subsequent daily dose of 5 mg on Friday, and so on.

[0242] If the patient's condition does improve, the physician may optionally continue administration of the modifiers disclosed herein; alternatively, the dosage of the administered medication may be temporarily reduced or suspended for a period of time (i.e., a "medication holiday"). The length of the medication holiday may optionally vary between 2 days and 1 year, and by way of example only, includes 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 10 days, 12 days, 15 days, 20 days, 28 days, 35 days, 50 days, 70 days, 100 days, 120 days, 150 days, 180 days, 200 days, 250 days, 280 days, 300 days, 320 days, 350 days, or 365 days. Dosage reductions during a drug holiday range from 10% to 100%, and are for illustrative purposes only, including 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%.

[0243] Once the patient's condition improves, a maintenance dose may be administered if necessary. Subsequently, in response to the patient's condition, the dosage or frequency of administration, or both, may be reduced to maintain the level of improved disease. In some implementations, the patient requires long-term intermittent treatment when symptoms and / or infection recur.

[0244] The compounds used in the methods of this disclosure may be formulated into unit dosage forms. The term "unit dosage form" refers to a physically discrete unit suitable as a unit dose for a patient receiving treatment, wherein each unit contains a predetermined amount of active material calculated to produce the desired therapeutic effect, optionally associated with a suitable drug carrier. Unit dosage forms may be used for a single daily dose or for multiple daily doses (e.g., about 1 to 4 or more times per day). When using multiple daily doses, the unit dosage forms for each dose may be the same or may be different.

[0245] Optionally, the toxicity and therapeutic efficacy of such treatment regimens may be determined in cell cultures or laboratory animals, including but not limited to determining the LD50. 50 (The dose that is lethal to 50% of the population) and ED 50 (The dose effective for 50% of the population). The dose ratio between toxicity and therapeutic effect is the therapeutic index, expressed as LD50. 50 With ED 50 The ratio between them. Capsid assembly modulators exhibiting a high therapeutic index are preferred. Data obtained from cell culture assays and animal studies are optionally used to determine dosage ranges for human use. The dosage of such capsid assembly modulators is preferably within the circulating concentration range, which includes the ED50 with minimal toxicity. 50 The dosage may vary within this range, depending on the dosage form and route of administration.

[0246] Those skilled in the art will recognize or be able to determine many equivalents of the specific procedures, implementations, claims, and examples described herein using only conventional experiments. Such equivalents are considered to be within the scope of this disclosure and are covered by the appended claims. For example, it should be understood that modifications to the determination and / or reaction conditions utilizing alternatives known in the art and using only conventional experiments are within the scope of this application.

[0247] It should be understood that throughout all sections of this document that provide values ​​and ranges, all values ​​and ranges covered by these values ​​and ranges are meant to be covered within the scope of this disclosure. Furthermore, this application also considers all values ​​falling within these ranges, as well as the upper or lower limits of the ranges of values.

[0248] Example This specification is further described in detail with reference to the following experimental examples. These examples are provided for illustrative purposes only and are not intended to be limiting unless otherwise specified. Therefore, this specification should not in any way be construed as limited to the following examples, but should be construed as covering any and all variations that become apparent from the teachings provided herein.

[0249] Example 1: MMP-9 deficiency confers resilience in progressive ossifying fibrous dysplasia Single-case studies of exceptional disease resilience can provide therapeutic insights for conditions where no definitive treatment exists. A healthy 35-year-old male (Patient-R) with classic pathogenic ACVR1... R206H A variant and typical example of progressive ossifying fibrous dysplasia (FOP) congenital big toe deformity, characterized by extremely poor postnatal heterotopic ossification (HO) and near-normal mobility. Patient-R was hypothesized to have a postnatal inflammatory triggering defect for HO. Plasma biomarker surveys revealed a reduction in total matrix metalloproteinase-9 (MMP-9) compared to healthy controls or quiescent FOP individuals. Genomic DNA exome sequencing and family studies revealed that patient-R is a complex heterozygous for MMP-9 (A20V; D165N). D165N Structural analysis of the variants predicted decreased MMP-9 secretion and activity, which was confirmed by ELISA and gelatin zymography. Furthermore, compared to the wild-type MMP-9 control, patients-R showed significantly less of the activating protein A—an essential ligand for HO in FOP—pro-inflammatory macrophages. Importantly, in multiple FOP mouse models, inhibition of MMP-9 by genetic, biological, or pharmacological means eliminated trauma-induced HO and led to regeneration of damaged skeletal muscle. The data in this paper demonstrate that MMP-9 provides a druggable node between inflammation and HO, plays a present role in the pathogenesis of FOP, and illustrates how a single resilient individual can reveal the molecular mechanisms of disease that lead to novel therapeutic strategies.

[0250] The progressive transformation of one tissue into another is a defining characteristic of progressive ossifying fibrous dysplasia (FOP; MIM#135100)—an extremely rare condition and one of the most disastrous forms of exoskeleton formation in humans. Individuals with FOP are born normal, but all typically affected individuals exhibit a characteristic big toe deformity. During the first decade of life, paroxysmal soft tissue swelling (or acute attacks) occurs in the neck and back, undergoing pathological transformation into mature ectopic bone via an intracartilaginous pathway. Minor trauma, such as intramuscular immunization, mandibular block anesthesia during dental work, muscle overuse, blunt muscle trauma, lumps, bruises, falls, or influenza-like viral illnesses, can trigger acute attacks of FOP, leading to progressive ectopic ossification (HO).

[0251] Most patients become immobile by age 30 and require lifelong assistance with daily living activities. The median estimated life expectancy is 56 years; death is often caused by complications of chest wall insufficiency syndrome. There is currently no definitive treatment for FOP, and the need for effective therapies remains urgent. Standardized care management currently focuses on symptomatic support.

[0252] A heterozygous, missense germline pathogenic variant of activator protein receptor type AI / activator protein-like kinase 2 (ACVR1 / ALK2)—a type I receptor for bone morphogenetic proteins (BMPs)—has been found in all sporadic or familial individuals. This pathogenic variant makes ACVR1 susceptible to dysregulated BMP pathway signaling. Importantly, activator protein A—a member of the transforming growth factor-β (TGF-β) molecular family—enhances the ability of ACVR1 carriers to... R206H BMP pathway signaling is transduced in mutant fibroblast adipocyte progenitors (FAPs) and drives ectopic bone formation in FOPs.

[0253] Pathogenic ACVR1 R206H Variants are necessary for the various developmental features of typical FOP, but may not be sufficient to induce most inflammatory acute attacks leading to disabling postnatal HO. Acute attacks of FOP strongly suggest underlying inflammatory triggers, and although global immunosuppression leads to reduced heterotopic ossification of FOP, it carries serious associated risks.

[0254] This study reports on a 35-year-old male (patient-R) with typical developmental features of FOP and classic pathogenic ACVR1. R206HVariants, but with extreme resilience to postnatal features of FOP, including disabling acute onset and severe progressive HO. The presence of typical developmental abnormalities in FOP and the anomalous poverty of postnatal HO point to the hypothesis that patients-R lack sufficient inflammatory triggers to initiate acute onset and subsequent HO. Biomarker analysis and genetic studies in patients-R and their family members revealed basal secretion and activity of matrix metalloproteinase-9 (MMP-9) and reduced complex heterozygosity of MMP-9. These observations prompted further investigation in a FOP mouse model, revealing that even partial inhibition of MMP-9 activity through genetic, pharmacological, or biological means strongly inhibits HO and uncovers unexpected molecular targets in FOP and potentially more common forms of HO.

[0255] Example 2: Case Report A 21-year-old asymptomatic male (Patient-R) presented to FOP Clinic. He was born at full term via cesarean section due to umbilical cord entanglement. Short, deformed big toe and thumb, lacking interphalangeal joints, were discovered early in life. He received routine childhood intramuscular immunizations without acute exacerbations. At age 4, he was bitten on the left thigh by a venomous Loxosceles spider. There was no skin necrosis, but a 5 mm nodule appeared in his left quadriceps muscle, which did not affect movement. He enjoyed an active childhood, playing soccer and baseball, without experiencing any acute exacerbations or loss of movement. After a fall, he fractured two teeth and underwent root canal surgery under local anesthesia without an acute exacerbation. He and his parents denied any history of short stature or lower extremity bowing during childhood. He had no hearing problems. He consistently performed well in school. He took a daily multivitamin but no medications or supplements. His diet was normal. There was no history of skeletal deformities or a family history of hominis (HO).

[0256] At age 20, a 2 cm nodule spontaneously grew on the right side of his neck. An excisional biopsy revealed a fibroproliferative lesion, and he was diagnosed with invasive fibromatosis. A non-restrictive band of hops (HO) grew at the surgical site. Clinical evaluation and radiographs of the foot revealed a deformity of the big toe, lacking an interphalangeal joint (…). Figure 1A-Figure 1B ).

[0257] Physical examination revealed that the patient was a 21-year-old healthy male, 183 cm tall and weighing 78 kg. He had no interphalangeal joints except for his thumb and big toe. Figure 1A-Figure 1BAside from bilateral proximal medial osteochondromas of the tibia and tibia, no other abnormalities were found. Except for slightly reduced range of motion in the cervical spine and chest wall, the range of motion in all other joints of his axial and appendicular bones was normal. He had a normal gait, no scoliosis, and was muscular. No dental abnormalities, alopecia, or cardiac findings were found. His Cumulative Analogue Joint Involvement Scale (CAJIS, a validated tool for assessing the disease burden of FOP) score was 2 / 30 (age-related range: 12–22; median: 18). Patient-R participated in a funded natural history study of patients with typical affected FOP, in which low-dose whole-body computed tomography (WBCT) was performed to assess the systemic load of HO. At age 28, the WBCT revealed a small number of asymptomatic HO in the lower lumbar spine. Figure 1C (arrow). The WBCT volume of the HO in patient-R was 47,000 mm. 3 And remained unchanged over three years of natural history studies (mean of 434,000 mm for 13 subjects aged 25-35). 3 Over the next seven years, despite some transient soft tissue swelling at the previous biopsy site, FOP did not progress, and there was no subsequent bone formation or loss of mobility. At the most recent examination, the patient was 35 years old, and CAJIS remained at 2 / 30. Genetic testing confirmed a typical heterozygous pathogenic FOP variant (ACVR1 c.617G>A; R206H). There was no evidence of homologous chimerism. Figure 1D The patient's asymptomatic parents had normal ACVR1 alleles.

[0258] Patient R's typical FOP is the mildest form reported to date in an age-matched patient. He had a mild post-traumatic acute exacerbation of FOP and had approximately 90% less ectopic bone compared to age-matched controls. The presence of typical developmental features of FOP ( Figures 1A-1C This indicates that FOP is active during embryogenesis. However, rare cases of FOP with postnatal inflammatory acute exacerbation and subsequent HO (hoarseness and irritation) show that its activity is well preserved in adulthood, suggesting that it may not have had sufficient inflammatory triggers to induce postnatal acute exacerbation and HO.

[0259] One objective of this study is to identify the factors contributing to resilience to postnatal acute exacerbations and hospice hood (HO) in these unique FOP individuals and to determine whether these factors are causally related to HO in a genetically precise mouse model of FOP. Identifying such resilience factors could reveal previously unknown protective mechanisms in FOP and herald new therapeutic strategies for limiting and treating this disabling condition.

[0260] Example 3: Method Institutional Review Committee All clinical assessments and imaging studies were performed as part of routine clinical care. The proposal to publish these observations was reviewed by the University of Pennsylvania Institutional Review Board and exempted from human subject studies.

[0261] Genotyping and exome sequencing PCR amplification using exon side-joining primers ACVR1 Genes undergo DNA sequence analysis to examine the genomic DNA in the peripheral blood of patients and their family members.

[0262] The significance of commercially performed exome sequencing of genomic DNA and detection reported here is unknown. MMP-9 Variant (VUS). MMP-9 The presence of variants was confirmed by PCR amplicon and DNA sequence analysis of the MMP-9 gene using the following primers: 59C>T 5'-GAGTCAGCACTTGCCTGTCA-3' (forward, SEQ ID NO: 50) and 5'-GATACGCCCATCACCACCAA-3' (reverse, SEQ ID NO: 51), and 493G>A 5'-CCTTCCTCTGGCTCTTACGC-3' (forward, SEQ ID NO: 52) and 5'-GGCAGGAGGGGCCGTATAA-3' (reverse, SEQ ID NO: 53). ACVR1 and MMP-9 The DNA sequence analysis was conducted by the DNA Sequencing Facility at the Perelman School of Medicine, University of Pennsylvania.

[0263] blood samples As part of a routine clinical nursing visit to the Department of Orthopedic Surgery at the Perelman School of Medicine, University of Pennsylvania, blood samples were collected from FOP patients, their family members (unaffected controls), and patients-R with informed consent. Blood samples from adults and children over two years of age were collected into 10 ml K2 EDTA tubes (BD, #366643), or blood samples from children under two years of age were collected into 4 ml K2 EDTA tubes (BD, #367861). Samples were kept at room temperature until processing was performed 2–24 hours later.

[0264] Human plasma and peripheral blood mononuclear cell (PBMC) preparations Undiluted blood was separated into layers in a 15 ml tube using Ficoll-Paque (GE Healthcare, #17-1440-02) and centrifuged at 400 xg for 30 min at room temperature (without braking). Plasma was collected from the top layer (leaving PBMCs, red blood cells, and Ficoll) and transferred to a new 15 ml tube. The plasma was centrifuged at 1400 xg for 10 min (with braking) to remove residual cells, and the supernatant was aliquoted into 1.5 ml cryovials. Samples were stored at -80°C.

[0265] After performing Ficoll-Paque separation as described above, carefully collect the mononuclear cell layer containing PBMCs and wash twice with PBS by centrifugation (300 xg for 5 min). Aliquot the PBMCs, freeze them, and store them in liquid nitrogen.

[0266] Plasma biomarker analysis Multiple Luminex analysis was performed by Myriad RBM according to Pignolo ( J Bone Miner Res The procedure was performed as described in (2022 Mar;37(3):475-483). In short, inflammatory plasma analytes were selected from 113 biomarkers, and patients-R were compared independently of the original analysis to a cohort of 11 other FOP patients who had a quiescent acute exacerbation state at the time of blood collection (defined as a quiescent state when the last acute exacerbation occurred more than 2 years prior to sample collection). This study compared 38 FOP patients and 39 controls with patients-R (obtained at two different follow-ups, one year apart).

[0267] mice Acvr1 Q207D / + The mice were a gift from Dr. Yuji Mishina (University of Michigan). They were used to induce ACVR1. Q207D Expression, then induction of HO, and delivery of AV-Cre (University of Pennsylvania Carrier Core Platform; 1 × 10⁻⁶) 11 One particle per mouse (50 μL of 10 μM cardiotoxin) was injected into mice aged 3-4 weeks. Acvr1 Q207D / + In the popliteal fossa of mice. All animal procedures were reviewed and approved by the Institutional Animal Care and Use Committee of the University of Pennsylvania.

[0268] Acvr1 ARC-R206H / + Mice used to Gt(ROSA26)Sor CreERT2 / CreERT2Mice (The Jackson Laboratory, #008463) were bred together to produce Acvr1 ARC-R206H / + ;Gt(ROSA26)Sor CreERT2 / + ( Acvr1 ARC-R206H / + CreERT2 - / + In mice, tamoxifen-induced systemic Acvr1 was produced through recombination with Cre recombinase. ARC-R206H Allele expression.

[0269] Within 2 weeks (starting from 4 weeks of age) Acvr1 ARC-R206H / + CreERT2 - / + Acvr1 was induced in mice by intraperitoneal injection of tamoxifen in corn oil (100 mg / kg body weight, 10 mg / ml reservoir, Sigma, St. Louis, MO, USA; #T5648) five times. ARC-R206H The expression was then induced by injecting 50 μL of 10 μM cardiotoxin from the Mozambican venomous cobra (Naja mossambica) (Sigma-Aldrich, St. Louis, MO, USA; #C9759) into the muscle.

[0270] CRISPR / Cas-9 MMP-9 gene editing Using gene editing to respectively MMP-9 59C>T and MMP-9 493G>A Inserted into human THP-1 cells. gRNA and dDNA were designed using TrueDesign Genome Editor (https: / / www.thermofisher.com / us / en / home / life-science / genome-editing / invitrogen-truedesign-genome-editor.html).

[0271] In short, the day before transfection, at 50 x 10 3 THP-1 cells were seeded in 24-well plates at 50 x 10⁵ cells / well according to ThermoFisher Scientific protocol. 3Transfection of THP-1 cells was performed using 2,000 ng TrueCut HiFi Cas9 protein (Invitrogen, #MPK5000), 12.0 pM guide RNA, and 18.0 pM donor DNA. Transfected THP-1 cells were expanded for 7 days, and single-cell clones were obtained by restriction dilution in 96-well plates. These clones were then selected using the following PCR primers. MMP-9 59C>T and MMP-9 493G>A Substitutions: 5'-GAGTCAGCACTTGCCTGTCA-3' (forward, SEQ ID NO: 50), 5'-GATACGCCCATCACCACCAA-3' (reverse, SEQ ID NO: 51), and 5'-CCTTCCTCTGGCTCTTACGC-3' (forward, SEQ ID NO: 52), 5'-GGCAGGAGGGGCCGTATAA-3' (reverse, SEQ ID NO: 53).

[0272] Cell culture Thaw the PBMCs, resuspend them in AIM-V medium (Gibco, #12055091), and incubate them in 24-well plates at 2.5 × 10⁻⁶. 6 Cells were seeded at a density of 100 cells / ml, with 20 ng / ml TNF-α added, and incubated at 37°C in a 5% CO2 atmosphere. At 72 hours, the cell culture supernatant was collected, centrifuged, aliquoted, and stored at -80°C. Human mononuclear cells derived from THP-1 patients with acute monocytic leukemia were obtained from ATCC (#TIB-202) and cultured in RPMI-1640 (Gibco, #11875085) with 10% FBS—including 50 µM 2-mercaptoethanol (Gibco, #21985023), 10 mM HEPES (Gibco, #15630080), 1 mM sodium pyruvate (Gibco, #11360070), and an antibiotic-antifungal agent (Gibco, #15240096). THP-1 cells were centrifuged and cultured in 24-well plates at 100 x 10⁻⁶ cells / well. 3Cells were transferred to AIM-V medium (Giboco, #31035025) and differentiated into M0 macrophages after incubation with 10 nM phorbol-12-tetradecanoate 13-acetate (PMA, Sigma, #P8139) for 72 h, followed by incubation in fresh AIM-V medium for 24 h. M0 macrophages were polarized into M1-like macrophages with 20 ng / ml IFN-γ (PeproTech, #300-02) and 10 pg / ml LPS (Sigma, #8630). M2a-like macrophages were obtained by incubation with 20 ng / ml IL-4 (PeproTech, #200-04) and 20 ng / ml IL-13 (PeproTech, #200-13) (Genin, 2015). Cell culture supernatant was collected at the time points shown in the figure, centrifuged, aliquoted, and stored at -80°C. Cells lysed with RIPA lysis and extraction buffer containing a 1x protease inhibitor mixture (ThermoFisher Scientific, Grand Island, NY, USA; #78429) (ThermoFisher Scientific, Grand Island, NY, USA; #89901) were collected together with the cell culture supernatant for analysis.

[0273] ELISA Total MMP9 protein (pre-MMP-9, active MMP-9, and TIMP complex MMP-9) in heparin-treated anemic platelet plasma was determined by sandwich ELISA (Mouse Total MMP-9 Quantikine ELISA Kit, MMPT90, R&D Systems, Minneapolis, MN, USA). Human activator protein A was measured using a human activator protein A ELISA kit (ThermoFisher Scientific, #EHACTIVINA), and mouse activator protein A was measured using a mouse activator protein A ELISA kit (ThermoFisher Scientific, #EM3RB). Protein levels in MMP-9 from cell culture supernatant and in control cell lysates for activator protein A were normalized.

[0274] Gelatin enzyme profile Using Novex Zymogram Plus Gels, gelatin zymography was performed on cell supernatant to measure active MMP9, following the manufacturer's instructions (Invitrogen, Carlsbad, CA, USA, ZY00100BOX). The gel was scanned, the image inverted, and density assay levels were determined using ImageJ software (https: / / imagej.nih.gov / ij / index.html). The generated curve produced peaks corresponding to each band. The amount of MMP-9 in the cell culture supernatant was normalized to the protein content in the cell lysate.

[0275] Microcomputed tomography Micro-computed tomography (μCT) was performed on the hind limbs of mice 14 days after injection of cardiotoxin or adenovirus-Cre / cardiotoxin to determine the volume of ectopic bone and obtain two-dimensional images of the medial sagittal plane of each limb. Scans were performed using a 55 kV source voltage, a 142 μA source current, and a 10.5 μm isotropic voxel size. Bone was distinguished from “non-bone” using an upper threshold of 1000 Hen units and a lower threshold of 150 Hen units.

[0276] Structural-functional analysis of MMP-9 variants Use the SignalP server (http: / / www.cbs.dtu.dk / services / SignalP / ) for MMP-9 A20V Variants were subjected to bioinformatics analysis. The high-resolution crystal structure of MMP-9 stored in the Protein Database (PDB) was viewed and superposed using the graphical program PyMOL.

[0277] Statistical analysis All experiments were performed at least three biological replicates, and sample sizes are shown in the figure description. Statistical analysis was performed using GraphPadPrism 8.0 software (San Diego, CA, USA). Unpaired comparisons were used when comparing two groups. t-test or t-test The Mann-Whitney test was used to analyze the data. When comparing more than two groups, one-way ANOVA combined with Tukey's multiple comparison test or two-way ANOVA was used. *P<0.05, **P<0.01, ***P<0.001, and ****P<0.0001 were considered significant. Data are expressed as mean ± standard error of the mean (SEM).

[0278] Example 4 Based on the index case presentation, Patient-R exhibited typical developmental features of FOP, but with postnatal HO deficiency. He possessed a typical pathogenic variant of FOP (ACVR1R206H) with no evidence of homologous chimerism. Early clues to his resilience were identified when this study compared 113 analytes from Patient-R with 11 other typical FOP adults who were also in a quiescent phase (at least two years without acute exacerbations) at the time of plasma sample collection.

[0279] Example 5: Compared with other FOP patients and controls, plasma MMP-9 levels were suppressed and the enzymatic activity of MMP-9 was reduced in patient-R. There was no statistically significant difference in MMP-9 levels between unaffected individuals (without FOP) and individuals with genetically confirmed typical FOP. Figure 2A However, compared with other patients with typical FOP, patient-R had a sharply lower MMP-9 level (mean 186 ± 15), at least three-quarters less than the concentration found in other FOP patients (mean 807 ± 103). Figure 2B Importantly, gelatin zymography revealed a statistically significant decrease in MMP-9 activity in the PBMC culture supernatant of patient-R compared to unaffected controls or other individuals with typical FOP. Figures 2C-2D ).

[0280] Example 6: Structural analysis predicts MMP-9 in patients-R D165N Reduced enzymatic activity Bioinformatics analysis using the SignalP server indicated that residue 20 of MMP-9 is expected to be included in a signal peptide cleavage motif that constitutes the N-terminus of the secreted polypeptide. However, MMP-9 A20V The secretion efficiency of the variant is unlikely to be compromised because the signal peptide cleavage is calculated to be comparable to that of the wild type.

[0281] In contrast, one set of calculation methods predicts MMP-9 D165N Variants are highly detrimental to the structure and function of MMP-9 and result in non-functional variants. MMP-9 D165N The variant corresponds to the zinc-binding region of the catalytic domain of MMP-9, and therefore its enzymatic activity may be defective.

[0282] Furthermore, examination of the three-dimensional structure of the MMP-9 preprotein revealed that Asp165 forms a robust ion pair with His118. Figures 4A-4C The asparagine side chain at residue 165 disrupts the bond (linkage)—a crucial structural element that may play multiple functional roles. In addition to the aforementioned enzymatic activity defects, MMP-9... D165NThe variant is expected to be highly unstable, which will reduce folding efficiency in the endoplasmic reticulum (the quality control site for the transport of secreted proteins that regulate proper folding). Furthermore, this ion pair stabilizes the loop located only a few residues at the C-terminus of the MMP-9 cleavage and activation site. Figures 4B-4C Therefore, MMP-9 D165N This ring of the protein may not adopt the optimal conformation for proteolysis by activating an enzyme, plasminogen.

[0283] Example 10: Minocycline blockade of MMP-9 in FOP mouse model led to a reduction in damage-induced HO. Treatment with a pharmacological inhibitor of MMP-9 (minocycline) Acvr1 Q207D / + Mice were treated twice daily for two weeks to assess and quantify HO levels after injury. Minocycline treatment resulted in a statistically significant decrease in HO levels in mice. Figure 5 ).exist Acvr1 Q207D / + Further testing in mice showed that minocycline could be administered at doses as low as 5 mg / kg while still eliminating HO formation. Figure 6 ).

[0284] Example 11: Blocking MMP-9 with MMP-9 monoclonal antibody in a FOP mouse model led to a reduction in damage-induced HO. Minocycline may have off-target effects; therefore, this study used a specific monoclonal antibody against MMP-9 and applied it to FOP. Acvr1 ARC-R206H / + CreERT2 - / + and Acvr1 Q207D / + Similar effects in reducing HO were demonstrated in mouse models. Figures 7A-7B ).

[0285] Example 12: MMP-9 variant in patient-R impairs the release of activating protein A from polarized M1-like macrophages. Activator protein A is a major driver of BMP pathway signaling leading to HO in FOP. Macrophages are a key inflammatory component and the primary source of both MMP-9 and activator protein A, with M1-like macrophages known to produce relatively more activator protein A than M2-like macrophages. Using CRISPR Cas9 MMP-9 gene editing, patient-R variants corresponding to MMP-9A20V and MMP-9 D165N, respectively, were generated, resulting in MMP-9... 59C>T Or MMP-9 493G>AInserted into human THP-1 cells. Gelatin zymography analysis of MMP-9 enzymatic activity revealed a statistically significant decrease in activity in the cell culture supernatant from D165N macrophages after polarization into M1-like and M2-like cells. Figures 8A-8B Compared with M1-like and M2-like wild-type macrophages, the level of activating protein A in the cell culture supernatant from A20V and D165N macrophages was significantly reduced. Figure 8C These results indicate that the MMP-9 variant in patient-R has an inhibitory effect on the secretion of activator protein A from M1-like macrophages. This inhibitory effect of MMP-9 downregulation on activator protein A secretion is further supported by the inactivation of MMP-9 by minocycline in THP-1-derived M1-like macrophages. Figure 10 ).

[0286] Example 13 This study demonstrates that MMP-9 plays a crucial role in the pathogenesis of febrile osteomyelitis (FOP) and illustrates how studies on individual resilient individuals can reveal novel disease mechanisms leading to new treatment strategies. The presence of typical FOP-related big toe deformity in patient-R, coupled with severe postnatal holopathic inflammatory response (HO), suggests that FOP is active during embryogenesis but relatively inactive postnatally, possibly due to a deficiency of HO's pro-inflammatory triggers. The finding of significantly reduced MMP-9 levels and activity in patient-R, along with notable genetic variants in MMP-9, raises concerns about MMP-9 as a presumed trigger for HO in FOP, a finding validated by in vivo functional studies in a FOP mouse model and detailed functional studies in human cells. In conclusion, these results support the role of MMP-9 in mediating HO in FOP by regulating the inflammatory response to tissue damage.

[0287] MMP-9 (or gelatinase B) belongs to a multigene family of more than 20 matrix metalloproteinases and is highly conserved throughout the animal kingdom. MMP-9 is expressed and secreted by neutrophils, mast cells, and macrophages. It regulates inflammatory cytokines (including IL-1β, TGF-β, and VEGF) and is regulated by inflammatory cytokines (including IL-1β, TGF-β, and VEGF) and modulates multiple immune regulatory pathways. It impairs neutrophil chemoattraction, lymphocyte infiltration, and monocyte differentiation, degrades and remodels the extracellular matrix, and coordinates the migration of stem cells and tissue progenitor cells in a series of physiological and pathological processes.

[0288] MMP-9 induces endochondral ossification during development and fracture healing, and is expressed at elevated levels in ischemic and hypoxic skeletal muscle—a phenomenon observed in early acute exacerbations of fracture-related osteoporosis (FOP). Although MMP-2 and MMP-9 share the same substrate in vitro, they are not redundant in vivo, and their individual roles in osteogenic processes are uniquely regulated. MMP-2 is specifically involved in intramembranous ossification, while MMP-9 is involved only in endochondral ossification—the latter specifically involved in osteogenic chondrogenesis (HO) in FOP. Furthermore, in the early stages of fracture repair, MMP-9 regulates chondrogenesis and osteoblast differentiation, a process histologically almost identical to HO in FOP.

[0289] Mouse and human studies have shown that MMP-9 is a predictive diagnostic biomarker for early holocclusion (HO), but its role in the pathogenesis of fungal oophoritis (FOP) has not been investigated (if any). Supporting data from the clinical, biochemical, and genetic manifestations of patients with recurrent HO and from FOP mice suggest that even with partially reduced MMP-9 levels, in the presence of typical ACVR1... R206H Mutations also provide protection against HO. Interestingly, haploid deficiency of MMP-9 in FOP mice also appears to offer protection against HO. This unexpected finding is consistent with early upregulation of MMP-9 expression in traumatic HO and suggests that basal levels of MMP-9 may be sufficient for normal skeletal development but not enough to drive the pathological process of HO in FOP. Observations in patients with R and in vivo studies in multiple FOP mouse models confirm this hypothesis and demonstrate that MMP-9 plays a crucial role in the pathogenesis of HO in FOP. In conclusion, these data support the hypothesis that pharmacologically reduced tissue levels of MMP-9 in FOP patients can protect against damage-induced HO.

[0290] Although MMP-9 was found in patient-R D165N The variant is rare and non-pathogenic in the general population, but it has been extensively studied. Importantly, MMP-9 D165N The variant's specific enzymatic activity (total activity / secreted protein content) was significantly lower than that of wild-type MMP-9, indicating that in addition to the reduction in secreted protein, amino acid substitutions also had a significant impact on the enzymatic activity of MMP-9. Consistent with this finding, MMP-9... D165N The variant is expected to have a protective effect in patients with aortic aneurysms and possibly other inflammatory dysregulations. The MMP-9 variant (D165N) detected in patient-R reveals the structural basis for the loss of function of secreted MMP-9 and is significant for the inhibition of HO in FOP. Figures 4A-4C ).

[0291] Supported by the fact that even heterozygous defects in MMP-9 in gene knockout models provide protection against HO, this study investigated the availability of approved drugs for therapeutically reducing MMP-9 levels, potentially for FOP patients who do not carry rare, hypomorphic variants of MMP-9 as found in patient-R. Focus was placed on tetracyclines, which, regardless of their antibiotic nature, are inhibitors of MMP-9 transcription, translation, secretion, and activation at sub-antimicrobial doses. Interestingly, tetracyclines confer multiple conditions that are pathogenic to MMP-9—including… Loxosceles Recovery from spider bite-induced skin necrosis, multiple sclerosis, atherosclerosis, myocardial infarction, thoracic and abdominal aortic aneurysms, glomerulonephritis, Duchenne muscular dystrophy, and ischemic skeletal muscle injury. Importantly, in a BMP implant model, inhibition of MMP-9 by doxycycline or anti-MMP-9 monoclonal antibodies improved muscle regeneration, and inhibition of MMP-9 by minocycline reduced HO.

[0292] Since tetracyclines may inhibit HO (homotrophic ovarian hyperplasia) through MMP-9 blockade alone, this study also investigated whether monoclonal antibodies that specifically block MMP-9 might be effective in reducing HO. This study demonstrates a proof-of-concept study showing that MMP-9-blocking monoclonal antibodies reduce HO in FOP (focal oophorectomy) mice.

[0293] The mechanism by which MMP-9 blockade confers resilience to HO (and possibly more common forms of HO) in FOP is likely multifactorial and complex. HO requires three fundamental elements in any environment: 1) an inductive signal, 2) receptive progenitor cells, and 3) a favorable microenvironment. MMP-9 likely plays a role in all three aspects of FOP.

[0294] Macrophage elimination eliminates hemolytic uremic (HO), and pro-inflammatory macrophages are potent sources of both MMP-9 and activator protein A (APA). Furthermore, APA is an essential ligand for HO in FOP and is rapidly upregulated by inflammatory macrophages and other activated immune cells, leading to the production of pro-inflammatory cytokines (such as TNFα, IL-1β, and IL-6) and mast cell recruitment, thereby triggering HO pathogenesis. Patient-R data indicate that MMP-9 stimulates APA secretion. MMP-9 secreted by pro-inflammatory macrophages degrades the perlecan (heparan sulfate proteoglycan) bound to APA, releasing it from the matrix in its active form and allowing it to bind to the mutant ACVR1 signaling complex expressed in FOP, signaling via the SMAD 1,5 complex. Importantly, TGF-β strongly induces APA production in fibroblasts of FOP patients. In summary, these data provide a plausible mechanism through which MMP-9 and TGF-β can paracrinely regulate activator protein A levels in FOP, thereby promoting HO. Notably, this study found that MMP-9 in patient-R... A20V and MMP-9 D165N Both variants produced significantly less activating protein A in inflammatory macrophages than MMP-9. WT Interestingly, minocycline targets both MMP-9 and activator protein A in inflammatory macrophages and may provide a beneficial and redundant HO (especially HO in FOP) protection mode.

[0295] In the compositional activity and engineering modification of FOP ACVR1 Q207D The fact that MMP-9 blockade resists HO formation in both alternative mouse models and BMP implant models suggests that reduction in activator protein A may not be the sole mechanism by which HO is suppressed by MMP-9 deficiency in FOP. Recent studies have shown that activator protein A may promote, but not drive, the development of acquired HO. Previous research has shown that activator protein A inhibition does not inhibit ACVR1. Q207D The presence of HO in mice suggests that MMP-9 inhibits HO through both ligand-independent and ligand-dependent mechanisms, even in FOP, and may be a therapeutic target for non-genetic forms of HO.

[0296] Inflammatory cell degradation of the extracellular matrix (ECM) also plays a crucial role in osteogenic processes. MMP-9 released by macrophages degrades various ECM proteins through proteolytic cleavage and increases the availability of numerous bioactive molecules. These bioactive molecules have profound implications for stem cells, which regulate key biological processes such as angiogenesis, fibrosis, chondrogenesis, and osteogenic processes—all essential for osteogenic osteogenic processes. Furthermore, in ACVR1…R206H / + Following muscle injury, the differences in ECM composition and collagen tissue affected by MMP-9 may affect ACVR1. R206H / + Cells can misunderstand ECM rigidity and promote HO.

[0297] Our data propose a hypothetical model in which MMP-9 plays a central role in the pathogenesis of HO in FOP ( Figure 11 This model posits that trauma-induced acute exacerbations of FOP are triggered by inflammation, which stimulates pro-inflammatory macrophages to secrete MMP-9 and increases the production of activating protein A. MMP-9 secreted and activated in the lesion microenvironment promotes the outflow of inflammatory cells from hypoxic capillaries, which further degrades the extracellular matrix, releases activating protein A and VEGF, recruits inflammatory-activated fibroblast adipocyte progenitors (FAPs) from the connective tissue stem cell microenvironment, and amplifies the downstream cascade of Smad1 / 5 signaling that leads to HO in FOP.

[0298] Our model does not rule out the possibility that MMP-9 secretion may also be amplified by connective tissue progenitor cells (such as FAP cells), thereby directly participating in extracellular matrix remodeling during skeletal muscle regeneration. However, the observations of bone marrow transplantation correcting the skeletal phenotype of MMP-9-deficient mice suggest that targeted in vitro gene knockout of MMP-9 in autologous hematopoietic stem cells could be an attractive therapeutic possibility to be explored in preclinical studies of FOP.

[0299] A key clinical question is: when does MMP-9 play a role in HO formation in FOP mice? Data from a genetically corrected FOP mouse model suggest that MMP-9 plays a role in HO very early, possibly within the first three days. While these data do not rule out the possibility that MMP-9 may also play a role in the later stages of HO in FOP, histological evidence clearly indicates a divergence between HO and regeneration processes up to day 5 post-injury in the genetically corrected FOP mouse model.

[0300] In summary, this study identified MMP-9 as a key regulator of HO in FOP and demonstrated how systematic studies of individual resilient individuals can reveal unexpected disease mechanisms that could lead to novel treatment strategies. These studies highlight important findings on the pathogenesis of HO in FOP—found to withstand pharmacological and / or biological testing in human clinical trials. Since HO is not limited to FOP, there is a potential opportunity to extend the findings of this paper to more common forms of HO.

[0301] List of implementation methods In some aspects, the present invention relates to the following non-limiting embodiments: Implementation Method 1: A method for treating, improving, and / or preventing progressive ossifying fibrous dysplasia (FOP) in subjects in need, the method comprising downregulating the level and / or activity of matrix metalloproteinase 9 (MMP-9) in the subjects.

[0302] Implementation Method 2: According to the method of Implementation Method 1, wherein downregulating the MMP-9 level and / or activity in the subject comprises administering to the subject an effective amount of: a small molecule MMP-9 inhibitor; a protein MMP-9 inhibitor; a nucleic acid that downregulates MMP-9 via RNA interference (and / or an expression vector expressing the nucleic acid); a ribozyme that downregulates MMP-9 (and / or a vector expressing the ribozyme); an expression vector comprising an expression cassette, wherein the expression cassette expresses a CRISPR component that downregulates MMP-9 via CRISPR knockout and / or CRISPR knockdown; and an expression vector of a trans-dominant negative mutant protein of MMP-9 and / or expressing the trans-dominant negative mutant protein of MMP-9.

[0303] Implementation Method 3: The method according to any one of Implementation Methods 1-2, wherein the object has a mutated ACVR1 gene.

[0304] Implementation Method 4: According to the method of Implementation Method 3, wherein the mutant ACVR1 gene encodes an active ACVR1 polypeptide.

[0305] Implementation Method 5: According to the method of Implementation Method 4, the ACVR1 polypeptide includes at least one mutation selected from L196P, P197-F198 del ins L, R202I, R206H, Q207E, F246Y, R258S, R258G, G325A, G328E, G328W, G328R, G356D, R375P and K400E.

[0306] Embodiment 6: The method according to any one of Embodiments 2-5, wherein the small molecule MMP-9 inhibitor is selected from metformin, doxycycline, inclocycline and minocycline, or their salts or solvates.

[0307] Implementation Method 7: The method according to any one of Implementation Methods 2-5, wherein the protein MMP-9 inhibitor is an anti-MMP-9 antibody or its antigen-binding fragment.

[0308] Implementation Method 8: According to the method of Implementation Method 7, wherein the anti-MMP-9 antibody or its antigen-binding fragment comprises at least one of the following: (a) The heavy chain complementarity determination region 1 (CDR1) listed in SEQ ID NO: 3, the heavy chain CDR2 listed in SEQ ID NO: 4, the heavy chain CDR4 listed in SEQ ID NO: 5, the light chain CDR1 listed in SEQ ID NO: 6, the light chain CDR2 listed in SEQ ID NO: 7, and the light chain CDR3 listed in SEQ ID NO: 8; (b) Heavy chain CDR1 listed in SEQ ID NO: 15, heavy chain CDR2 listed in SEQ ID NO: 16, heavy chain CDR4 listed in SEQ ID NO: 17, light chain CDR1 listed in SEQ ID NO: 18, light chain CDR2 listed in SEQ ID NO: 19 and light chain CDR3 listed in SEQ ID NO: 20; (c) Heavy chain CDR1 listed in SEQ ID NO: 35, heavy chain CDR2 listed in SEQ ID NO: 36, heavy chain CDR4 listed in SEQ ID NO: 37, light chain CDR1 listed in SEQ ID NO: 38, light chain CDR2 listed in SEQ ID NO: 39 and light chain CDR3 listed in SEQ ID NO: 40; (d) Light chain CDR1 listed in SEQ ID NO: 45, light chain CDR2 listed in SEQ ID NO: 46 and light chain CDR3 listed in SEQ ID NO: 47.

[0309] Embodiment 9: The method according to any one of Embodiments 7-8, wherein the anti-MMP-9 antibody or its antigen-binding fragment comprises at least one of the following: (a) The heavy chain variable region listed in SEQ ID NO: 9 and the light chain variable region listed in SEQ ID NO: 10; (b) Heavy chain variable regions selected from SEQ ID NO: 21, 23, 25, 27 and 29 and light chain variable regions selected from SEQ ID NO: 22, 24, 26, 28 and 30; (c) The heavy chain variable region listed in SEQ ID NO: 21 and the light chain variable region listed in SEQ ID NO: 22; (d) The heavy chain variable region listed in SEQ ID NO: 27 and the light chain variable region listed in SEQ ID NO: 30; (e) The heavy chain variable region listed in SEQ ID NO: 41 and the light chain variable region listed in SEQ ID NO: 42; (f) The light chain variable region listed in SEQ ID NO: 48.

[0310] Implementation 10: The method according to any one of Implementations 1-9 further includes surgically removing ossified tissue from the object.

[0311] Implementation 11: The method according to Implementation 10, wherein the step of surgical removal is performed after the MMP-9 level or activity in the subject has been downregulated.

[0312] Implementation method 12: The method according to any one of implementation methods 1-11, wherein the object is a person.

[0313] Implementation Method 13: A method for treating, improving, and / or preventing non-FOP heterotopic ossification (HO) in subjects in need, the method comprising downregulating the level and / or activity of matrix metalloproteinase 9 (MMP-9) in the subject.

[0314] Implementation Method 14: The method according to Implementation Method 13, wherein downregulating the MMP-9 level and / or activity in the subject comprises administering to the subject an effective amount of: a small molecule MMP-9 inhibitor; a protein MMP-9 inhibitor; a nucleic acid that downregulates MMP-9 via RNA interference (and / or an expression vector expressing the nucleic acid); a ribozyme that downregulates MMP-9 (and / or a vector expressing the ribozyme); an expression vector comprising an expression cassette, wherein the expression cassette expresses a CRISPR component that downregulates MMP-9 via CRISPR knockout and / or CRISPR knockdown; and an expression vector of a trans-dominant negative mutant protein of MMP-9 and / or expressing the trans-dominant negative mutant protein of MMP-9.

[0315] Implementation Method 15: The method according to Implementation Method 14, wherein the small molecule MMP-9 inhibitor is selected from metformin, doxycycline, inclocycline and minocycline, or their salts or solvates.

[0316] Implementation Method 16: The method according to Implementation Method 14, wherein the protein MMP-9 inhibitor is an anti-MMP-9 antibody or its antigen-binding fragment.

[0317] Implementation Method 17: The method according to Implementation Method 16, wherein the anti-MMP-9 antibody or its antigen-binding fragment comprises at least one of the following: (a) The heavy chain complementarity determination region 1 (CDR1) listed in SEQ ID NO: 3, the heavy chain CDR2 listed in SEQ ID NO: 4, the heavy chain CDR4 listed in SEQ ID NO: 5, the light chain CDR1 listed in SEQ ID NO: 6, the light chain CDR2 listed in SEQ ID NO: 7, and the light chain CDR3 listed in SEQ ID NO: 8; (b) Heavy chain CDR1 listed in SEQ ID NO: 15, heavy chain CDR2 listed in SEQ ID NO: 16, heavy chain CDR4 listed in SEQ ID NO: 17, light chain CDR1 listed in SEQ ID NO: 18, light chain CDR2 listed in SEQ ID NO: 19 and light chain CDR3 listed in SEQ ID NO: 20; (c) Heavy chain CDR1 listed in SEQ ID NO: 35, heavy chain CDR2 listed in SEQ ID NO: 36, heavy chain CDR4 listed in SEQ ID NO: 37, light chain CDR1 listed in SEQ ID NO: 38, light chain CDR2 listed in SEQ ID NO: 39 and light chain CDR3 listed in SEQ ID NO: 40; (d) Light chain CDR1 listed in SEQ ID NO: 45, light chain CDR2 listed in SEQ ID NO: 46 and light chain CDR3 listed in SEQ ID NO: 47.

[0318] Embodiment 18: The method according to any one of Embodiments 16-17, wherein the anti-MMP-9 antibody or its antigen-binding fragment comprises at least one of the following: (a) The heavy chain variable region listed in SEQ ID NO: 9 and the light chain variable region listed in SEQ ID NO: 10; (b) Heavy chain variable regions selected from SEQ ID NO: 21, 23, 25, 27 and 29 and light chain variable regions selected from SEQ ID NO: 22, 24, 26, 28 and 30; (c) The heavy chain variable region listed in SEQ ID NO: 21 and the light chain variable region listed in SEQ ID NO: 22; (d) The heavy chain variable region listed in SEQ ID NO: 27 and the light chain variable region listed in SEQ ID NO: 30; (e) The heavy chain variable region listed in SEQ ID NO: 41 and the light chain variable region listed in SEQ ID NO: 42; (f) The light chain variable region listed in SEQ ID NO: 48.

[0319] Implementation Method 19: The method according to any one of Implementation Methods 13-18, wherein the non-FOP HO is caused by bone trauma or injury, severe burns, stroke, head trauma, paralysis, orthopedic surgery, hip replacement, severe crush injury, blast injury, war injury, severe civilian trauma, poliomyelitis, tetanus, syringomyelia, myelodysplastic syndrome, multiple sclerosis (MS), carbon monoxide poisoning, or spinal tumor.

[0320] Implementation 20: The method according to any one of Implementations 13-20, wherein the object is a person.

[0321] Implementation Method 21: A kit for treating, improving, and / or preventing progressive ossifying fibrous dysplasia (FOP) or non-FOP heterotopic ossification (HO) in subjects in need, the kit comprising: a compound for downregulating the level and / or activity of matrix metalloproteinase 9 (MMP-9) in the subject; and instructions for administering an effective amount of the compound to the subject.

[0322] Embodiment 22: The kit according to Embodiment 21, wherein the compound comprises at least one selected from the following: a small molecule MMP-9 inhibitor; a protein MMP-9 inhibitor; a nucleic acid that downregulates MMP-9 via RNA interference (and / or an expression vector expressing the nucleic acid); a ribozyme that downregulates MMP-9 (and / or a vector expressing the ribozyme); an expression vector comprising an expression cassette, wherein the expression cassette expresses a CRISPR component that downregulates MMP-9 via CRISPR knockout and / or CRISPR knockdown; and an expression vector expressing a trans-dominant negative mutant protein of MMP-9 and / or the trans-dominant negative mutant protein of MMP-9.

[0323] Implementation 23: A kit according to any one of Implementations 21-22, wherein the kit is used to treat, improve and / or prevent FOP, and wherein the subject has a mutated ACVR1 gene.

[0324] Implementation Method 24: The kit according to Implementation Method 23, wherein the mutant ACVR1 gene encodes an active ACVR1 polypeptide.

[0325] Implementation Method 25: The kit according to Implementation Method 24, wherein the ACVR1 polypeptide includes at least one mutation selected from L196P, P197-F198 del ins L, R202I, R206H, Q207E, F246Y, R258S, R258G, G325A, G328E, G328W, G328R, G356D, R375P and K400E.

[0326] Implementation 26: A kit according to any one of Implementations 21-22, wherein the kit is used to treat, improve and / or prevent non-FOP HO, and wherein the HO is caused by bone trauma or injury, severe burns, stroke, head trauma, paralysis, orthopedic procedures, hip replacement, severe crush injury, blast injury, war injury, severe civilian trauma, poliomyelitis, tetanus, syringomyelia, myelodysplastic syndrome, multiple sclerosis (MS), carbon monoxide poisoning or spinal tumors.

[0327] Embodiment 27: The kit according to any one of Embodiments 22-26, wherein the small molecule MMP-9 inhibitor is selected from metformin, doxycycline, inclozolinone and minocycline.

[0328] Embodiment 28: The kit according to any one of Embodiments 22-26, wherein the protein MMP-9 inhibitor is an anti-MMP-9 antibody or its antigen-binding fragment.

[0329] Embodiment 29: The kit according to Embodiment 28, wherein the anti-MMP-9 antibody or its antigen-binding fragment comprises at least one of the following: (a) The heavy chain complementarity determination region 1 (CDR1) listed in SEQ ID NO: 3, the heavy chain CDR2 listed in SEQ ID NO: 4, the heavy chain CDR4 listed in SEQ ID NO: 5, the light chain CDR1 listed in SEQ ID NO: 6, the light chain CDR2 listed in SEQ ID NO: 7, and the light chain CDR3 listed in SEQ ID NO: 8; (b) Heavy chain CDR1 listed in SEQ ID NO: 15, heavy chain CDR2 listed in SEQ ID NO: 16, heavy chain CDR4 listed in SEQ ID NO: 17, light chain CDR1 listed in SEQ ID NO: 18, light chain CDR2 listed in SEQ ID NO: 19 and light chain CDR3 listed in SEQ ID NO: 20; (c) Heavy chain CDR1 listed in SEQ ID NO: 35, heavy chain CDR2 listed in SEQ ID NO: 36, heavy chain CDR4 listed in SEQ ID NO: 37, light chain CDR1 listed in SEQ ID NO: 38, light chain CDR2 listed in SEQ ID NO: 39 and light chain CDR3 listed in SEQ ID NO: 40; (d) Light chain CDR1 listed in SEQ ID NO: 45, light chain CDR2 listed in SEQ ID NO: 46 and light chain CDR3 listed in SEQ ID NO: 47.

[0330] Embodiment 30: The kit according to any one of Embodiments 28-29, wherein the anti-MMP-9 antibody or its antigen-binding fragment comprises at least one of the following: (a) The heavy chain variable region listed in SEQ ID NO: 9 and the light chain variable region listed in SEQ ID NO: 10; (b) Heavy chain variable regions selected from SEQ ID NO: 21, 23, 25, 27 and 29 and light chain variable regions selected from SEQ ID NO: 22, 24, 26, 28 and 30; (c) The heavy chain variable region listed in SEQ ID NO: 21 and the light chain variable region listed in SEQ ID NO: 22; (d) The heavy chain variable region listed in SEQ ID NO: 27 and the light chain variable region listed in SEQ ID NO: 30; (e) The heavy chain variable region listed in SEQ ID NO: 41 and the light chain variable region listed in SEQ ID NO: 42; (f) The light chain variable region listed in SEQ ID NO: 48.

[0331] Embodiment 31: The kit according to any one of Embodiments 22-30, wherein the instruction manual is also used for surgically removing ossified tissue from the object.

[0332] Implementation Method 32: The kit according to Implementation Method 31, wherein the instruction manual further includes instructions for performing the surgical removal after the level or activity of MMP-9 in the object is downregulated.

[0333] Implementation method 33: The kit according to any one of implementation methods 22-32, wherein the object is a person.

[0334] The foregoing overview of several embodiments enables those skilled in the art to better understand various aspects of this disclosure. Those skilled in the art will understand that they can readily use this disclosure as the basis for designing or modifying other processes and structures to achieve the same objectives and / or obtain the same advantages of the embodiments introduced herein. Those skilled in the art will also recognize that such equivalent constructions do not depart from the spirit and scope of this disclosure, and that various changes, substitutions, and modifications can be made herein without departing from the spirit and scope of this disclosure.

Claims

1. A method for treating, improving, and / or preventing progressive ossifying fibrous dysplasia (FOP) in subjects in need, the method comprising administering an effective amount of an anti-MMP-9 antibody or an antigen-binding fragment thereof to the subject, thereby downregulating the level and / or activity of matrix metalloproteinase 9 (MMP-9) in the subject.

2. The method according to claim 1, wherein the object has a mutated ACVR1 gene.

3. The method according to claim 2, wherein the mutant ACVR1 gene encodes a polypeptide that constitutes the active ACVR1 polypeptide.

4. The method of claim 3, wherein the ACVR1 polypeptide comprises at least one mutation selected from L196P, P197-F198 delins L, R202I, R206H, Q207E, F246Y, R258S, R258G, G325A, G328E, G328W, G328R, G356D, R375P, and K400E.

5. The method according to any one of claims 1-4, wherein the anti-MMP-9 antibody or its antigen-binding fragment comprises at least one of the following: (a) The heavy chain complementarity determination region 1 (CDR1) listed in SEQ ID NO: 3, the heavy chain CDR2 listed in SEQ ID NO: 4, the heavy chain CDR4 listed in SEQ ID NO: 5, the light chain CDR1 listed in SEQ ID NO: 6, the light chain CDR2 listed in SEQ ID NO: 7, and the light chain CDR3 listed in SEQ ID NO: 8; (b) Heavy chain CDR1 listed in SEQ ID NO: 15, heavy chain CDR2 listed in SEQ ID NO: 16, heavy chain CDR4 listed in SEQ ID NO: 17, light chain CDR1 listed in SEQ ID NO: 18, light chain CDR2 listed in SEQ ID NO: 19 and light chain CDR3 listed in SEQ ID NO: 20; (c) Heavy chain CDR1 listed in SEQ ID NO: 35, heavy chain CDR2 listed in SEQ ID NO: 36, heavy chain CDR4 listed in SEQ ID NO: 37, light chain CDR1 listed in SEQ ID NO: 38, light chain CDR2 listed in SEQ ID NO: 39 and light chain CDR3 listed in SEQ ID NO: 40; (d) Light chain CDR1 listed in SEQ ID NO: 45, light chain CDR2 listed in SEQ ID NO: 46 and light chain CDR3 listed in SEQ ID NO:

47.

6. The method according to any one of claims 1-4, wherein the anti-MMP-9 antibody or its antigen-binding fragment comprises at least one of the following: (a) The heavy chain variable region listed in SEQ ID NO: 9 and the light chain variable region listed in SEQ ID NO: 10; (b) Heavy chain variable regions selected from SEQ ID NO: 21, 23, 25, 27 and 29 and light chain variable regions selected from SEQ ID NO: 22, 24, 26, 28 and 30; (c) The heavy chain variable region listed in SEQ ID NO: 21 and the light chain variable region listed in SEQ ID NO: 22; (d) The heavy chain variable region listed in SEQ ID NO: 27 and the light chain variable region listed in SEQ ID NO: 30; (e) The heavy chain variable region listed in SEQ ID NO: 41 and the light chain variable region listed in SEQ ID NO: 42; (f) The light chain variable region listed in SEQ ID NO:

48.

7. The method according to any one of claims 1-6, further comprising surgically removing ossified tissue from the object.

8. The method of claim 7, wherein the step of surgical removal is performed after the MMP-9 level or activity in the subject has been downregulated.

9. The method according to any one of claims 1-8, wherein the object is a person.

10. A method for treating, improving, and / or preventing non-FOP heterotopic ossification (HO) in subjects in need, the method comprising administering an effective amount of an anti-MMP-9 antibody or an antigen-binding fragment thereof to the subject, thereby downregulating the level and / or activity of matrix metalloproteinase 9 (MMP-9) in the subject.

11. The method of claim 10, wherein the anti-MMP-9 antibody or its antigen-binding fragment comprises at least one of the following: (a) The heavy chain complementarity determination region 1 (CDR1) listed in SEQ ID NO: 3, the heavy chain CDR2 listed in SEQ ID NO: 4, the heavy chain CDR4 listed in SEQ ID NO: 5, the light chain CDR1 listed in SEQ ID NO: 6, the light chain CDR2 listed in SEQ ID NO: 7, and the light chain CDR3 listed in SEQ ID NO: 8; (b) Heavy chain CDR1 listed in SEQ ID NO: 15, heavy chain CDR2 listed in SEQ ID NO: 16, heavy chain CDR4 listed in SEQ ID NO: 17, light chain CDR1 listed in SEQ ID NO: 18, light chain CDR2 listed in SEQ ID NO: 19 and light chain CDR3 listed in SEQ ID NO: 20; (c) Heavy chain CDR1 listed in SEQ ID NO: 35, heavy chain CDR2 listed in SEQ ID NO: 36, heavy chain CDR4 listed in SEQ ID NO: 37, light chain CDR1 listed in SEQ ID NO: 38, light chain CDR2 listed in SEQ ID NO: 39 and light chain CDR3 listed in SEQ ID NO: 40; (d) Light chain CDR1 listed in SEQ ID NO: 45, light chain CDR2 listed in SEQ ID NO: 46 and light chain CDR3 listed in SEQ ID NO:

47.

12. The method of claim 10, wherein the anti-MMP-9 antibody or its antigen-binding fragment comprises at least one of the following: (a) The heavy chain variable region listed in SEQ ID NO: 9 and the light chain variable region listed in SEQ ID NO: 10; (b) Heavy chain variable regions selected from SEQ ID NO: 21, 23, 25, 27 and 29 and light chain variable regions selected from SEQ ID NO: 22, 24, 26, 28 and 30; (c) The heavy chain variable region listed in SEQ ID NO: 21 and the light chain variable region listed in SEQ ID NO: 22; (d) The heavy chain variable region listed in SEQ ID NO: 27 and the light chain variable region listed in SEQ ID NO: 30; (e) The heavy chain variable region listed in SEQ ID NO: 41 and the light chain variable region listed in SEQ ID NO: 42; (f) The light chain variable region listed in SEQ ID NO:

48.

13. The method according to any one of claims 10-12, wherein the non-FOP HO is caused by bone trauma or injury, severe burns, stroke, head trauma, paralysis, orthopedic surgery, hip replacement, severe crush injury, blast injury, war injury, severe civilian trauma, poliomyelitis, tetanus, syringomyelia, myelodysplastic syndrome, multiple sclerosis (MS), carbon monoxide poisoning, or spinal tumor.

14. The method according to any one of claims 10-13, wherein the object is a person.

15. A kit for treating, improving, and / or preventing progressive ossifying fibrous dysplasia (FOP) or non-FOP heterotopic ossification (HO) in subjects in need, said kit comprising: Anti-MMP-9 antibody or its antigen-binding fragment; and Instructions for use in administering an effective amount of the antibody or its antigen-binding fragment to the subject.

16. The kit of claim 15, wherein the kit is used to treat, improve and / or prevent FOP, and wherein the subject has a mutated ACVR1 gene.

17. The kit according to claim 16, wherein the mutant ACVR1 gene encodes an active ACVR1 polypeptide.

18. The kit of claim 17, wherein the ACVR1 polypeptide comprises at least one mutation selected from L196P, P197-F198 delins L, R202I, R206H, Q207E, F246Y, R258S, R258G, G325A, G328E, G328W, G328R, G356D, R375P, and K400E.

19. The kit according to any one of claims 15-18, wherein the kit is used to treat, improve and / or prevent non-FOP HO, and wherein the HO is caused by bone trauma or injury, severe burns, stroke, head trauma, paralysis, orthopedic procedures, hip replacement, severe crush injury, blast injury, war injury, severe civilian trauma, poliomyelitis, tetanus, syringomyelia, myelodysplastic syndrome, multiple sclerosis (MS), carbon monoxide poisoning or spinal tumors.

20. The kit according to any one of claims 15-19, wherein the anti-MMP-9 antibody or its antigen-binding fragment comprises at least one of the following: (a) The heavy chain complementarity determination region 1 (CDR1) listed in SEQ ID NO: 3, the heavy chain CDR2 listed in SEQ ID NO: 4, the heavy chain CDR4 listed in SEQ ID NO: 5, the light chain CDR1 listed in SEQ ID NO: 6, the light chain CDR2 listed in SEQ ID NO: 7, and the light chain CDR3 listed in SEQ ID NO: 8; (b) Heavy chain CDR1 listed in SEQ ID NO: 15, heavy chain CDR2 listed in SEQ ID NO: 16, heavy chain CDR4 listed in SEQ ID NO: 17, light chain CDR1 listed in SEQ ID NO: 18, light chain CDR2 listed in SEQ ID NO: 19 and light chain CDR3 listed in SEQ ID NO: 20; (c) Heavy chain CDR1 listed in SEQ ID NO: 35, heavy chain CDR2 listed in SEQ ID NO: 36, heavy chain CDR4 listed in SEQ ID NO: 37, light chain CDR1 listed in SEQ ID NO: 38, light chain CDR2 listed in SEQ ID NO: 39 and light chain CDR3 listed in SEQ ID NO: 40; (d) Light chain CDR1 listed in SEQ ID NO: 45, light chain CDR2 listed in SEQ ID NO: 46 and light chain CDR3 listed in SEQ ID NO:

47.

21. The kit according to any one of claims 15-19, wherein the anti-MMP-9 antibody or its antigen-binding fragment comprises at least one of the following: (a) The heavy chain variable region listed in SEQ ID NO: 9 and the light chain variable region listed in SEQ ID NO: 10; (b) Heavy chain variable regions selected from SEQ ID NO: 21, 23, 25, 27 and 29 and light chain variable regions selected from SEQ ID NO: 22, 24, 26, 28 and 30; (c) The heavy chain variable region listed in SEQ ID NO: 21 and the light chain variable region listed in SEQ ID NO: 22; (d) The heavy chain variable region listed in SEQ ID NO: 27 and the light chain variable region listed in SEQ ID NO: 30; (e) The heavy chain variable region listed in SEQ ID NO: 41 and the light chain variable region listed in SEQ ID NO: 42; (f) The light chain variable region listed in SEQ ID NO:

48.

22. The kit according to any one of claims 15-21, wherein the description is further used for surgically removing ossified tissue from the object.

23. The kit of claim 22, wherein the instructions further include instructions for performing the surgical removal after the level or activity of MMP-9 in the object has been downregulated.

24. The set according to any one of claims 15-23, wherein the object is a person.

Images