Smnac39 gene and application thereof in increasing content of salvianolic acid in salvia miltiorrhiza

Abstract

The application provides a salvia miltiorrhiza transcription factor SmNAC39 gene and application thereof in increasing content of salvianolic acid in salvia miltiorrhiza, and belongs to the technical field of genetic engineering.The application independently studies the influence of SmNAC39 on the content of salvianolic acid in salvia miltiorrhiza, finds that SmNAC39 can directly and positively regulate the synthesis of salvianolic acid, and provides a new idea for increasing the content of salvianolic acid in salvia miltiorrhiza and a new path for solving the problem of tight supply of salvianolic acid.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology and relates to a SmNAC39 gene and its application in increasing the content of tanshinone in danshen. Background Technology

[0002] Danshen is a traditional and widely used Chinese medicinal herb, derived from the perennial herbaceous plant *Salvia miltiorrhiza* (of the Lamiaceae family). Salvia miltiorrhiza The dried root and rhizome of *Salvia miltiorrhiza* (Bunge). *Salvia miltiorrhiza* has the effects of promoting blood circulation and removing blood stasis, regulating menstruation and relieving pain, clearing the heart and relieving irritability, cooling the blood and reducing swelling. Modern medical research shows that *Salvia miltiorrhiza* also has the effects of lowering blood pressure, lowering blood lipids, anti-thrombosis, anti-hypoxia, anti-oxidation, improving microcirculation, and protecting the liver and brain. In my country, wild *Salvia miltiorrhiza* resources are scarce, and medicinal *Salvia miltiorrhiza* is mostly cultivated. Due to its long growth cycle (usually 2-3 years) and low efficiency of salvianolic acid accumulation, the market demand for *Salvia miltiorrhiza* falls short of supply.

[0003] NAC (NAM, ATAF1,2, and CUC2) transcription factors are one of the largest plant-specific transcription factor families. Studies have shown that NAC transcription factors play important roles in plant growth and development, stress response, and the synthesis of secondary metabolites. This invention utilizes metabolic engineering techniques to directionally regulate the expression levels of key transcription factors in *Salvia miltiorrhiza*, providing an effective genetic approach to improve its quality. Currently, no methods similar to those mentioned in this invention, involving overexpression, have been found. SmNAC39 Reports on gene-enhanced tanshinone production in Salvia miltiorrhiza. This invention provides an innovative technical solution to address the bottleneck in the supply of tanshinone raw materials, and has significant industrial application value for promoting the sustainable development of Salvia miltiorrhiza resources. Summary of the Invention

[0004] The purpose of this invention is to overcome the shortcomings of the prior art and provide a... SmNAC39 Genes and their application in increasing the content of tanshinone in danshen.

[0005] The objective of this invention can be achieved through the following technical solutions: In a first aspect, the present invention provides a tanshinone transcription factor SmNAC39, the nucleotide sequence of which is shown in SEQ ID NO. 1.

[0006] Secondly, the present invention provides a gene expression cassette comprising the SmNAC39.

[0007] Thirdly, the present invention provides a recombinant expression vector comprising the aforementioned SmNAC39.

[0008] Fourthly, the present invention provides a transgenic engineered bacterium containing the aforementioned recombinant expression vector.

[0009] Fifthly, the present invention provides an application of the tanshinone transcription factor SmNAC39, the gene expression cassette, the recombinant expression vector, or the transgenic engineered bacteria in increasing the content of tanshinone in tanshinone.

[0010] Furthermore, the SmNAC39 gene was overexpressed in Salvia miltiorrhiza.

[0011] Furthermore, hairy root culture was adopted.

[0012] Sixthly, the application of the aforementioned tanshinone transcription factor SmNAC39 in plant breeding, wherein the plant breeding involves selecting tanshinone varieties with increased tanshinone content.

[0013] Furthermore, the SmNAC39 is overexpressed in Danshen.

[0014] The beneficial effects of this invention are: (1) In this invention, it was found that after CMV infection of Salvia miltiorrhiza, the content of salvianolic acid in Salvia miltiorrhiza increased, and SmNAC39 The expression was downregulated, but subsequent independent studies on the effect of SmNAC39 on the content of salvianolic acid in tanshinone revealed that SmNAC39 can directly and positively regulate the synthesis of salvianolic acid.

[0015] (2) This study quantitatively detected the expression level of key enzyme genes in the salvianolic acid synthesis pathway in hairy roots overexpressed by SmNAC39, and deeply analyzed the regulatory mechanism of SmNAC39 in salvianolic acid biosynthesis, clarifying its key target and pathway, laying an important foundation for using genetic engineering technology to accurately increase salvianolic acid production.

[0016] (3) This invention proposes a method through overexpression SmNAC39 The method of increasing the content of salvianolic acid in Salvia miltiorrhiza by gene therapy resulted in a significant increase in the content of rosmarinic acid and salvianolic acid A in the transgenic hairy root system. The total salvianolic acid (TA) content was 1.24 times higher than that of the control group. This invention provides a technical strategy with application potential for the efficient production of salvianolic acid, which is of great significance for meeting market demand and promoting the large-scale preparation of salvianolic acid.

[0017] (4) This invention has successfully cultivated a new variety of Salvia miltiorrhiza with significantly increased content of salvianolic acid, which effectively reduces the cost of obtaining salvianolic acid and the production process is environmentally friendly. Attached Figure Description

[0018] Figure 1 A heatmap of transcriptome data for NAC-type transcription factors in Danshen (Salvia miltiorrhiza). Figure 2 for SmNAC39 Gene bioinformatics analysis; Figure 3 forSmNAC39 Subcellular localization analysis; Figure 4 The rooting process of the hairy roots of genetically modified Salvia miltiorrhiza; Figure 5 Positive identification of transgenic hairy roots; Figure 6 for SmNAC39 Quantitative analysis of gene expression in hairy roots; Figure 7 Quantitative analysis of key enzyme genes in the salvianolic acid pathway in transgenic positive hairy root systems; Figure 8 for SmNAC39 The activation effect of the protein on key enzyme target genes in the salvianolic acid pathway was verified and analyzed by Dual-LUC experiments. Figure 9 for SmNAC39 Detection of salvianolic acid content in the hairy roots of genetically modified Salvia miltiorrhiza. Detailed Implementation

[0019] The invention will be further illustrated below with specific implementation examples.

[0020] Example 1: Salvia miltiorrhiza SmNAC39 Acquisition of genes Based on transcriptome sequencing annotation and transcription factor prediction information, FPKM values ​​of SmNAC family transcription factor members were extracted from the CMV-infected *Salvia miltiorrhiza* transcriptome. These values ​​were then normalized using log2(FPKM+1) and an expression heatmap was plotted. Figure 1 As shown, SR_CK represents the healthy Salvia miltiorrhiza root group, and SR_CMV:CMV represents the diseased Salvia miltiorrhiza root group; L_CK represents the healthy Salvia miltiorrhiza leaf group, and L_CMV represents the CMV-infected Salvia miltiorrhiza leaf group; (*: represents P<0.05 compared with the control group, **: represents P<0.01 compared with the control group): 9 SmNAC transcription factors showed significant changes in FPKM values, among which... SMILT001768.1 That is SmNAC39 Its expression level was significantly downregulated after infection with CMV.

[0021] Retrieved from laboratory transcriptome databases SmNAC39 The CDS sequence was obtained, yielding a full-length 1026 bp sequence. SmNAC39 The gene sequence is shown in SEQ ID NO.1. Using MEGA 7.0 software, the transcribed protein sequences of identified Tanshinone NAC members were analyzed. SmNAC39 Phylogenetic analysis of transcribed protein sequences ( Figure 2 A). Using DNAMAN, a bioinformatics software, to... SmNAC39 Sequence alignment analysis was performed with 5 NAC transcription factors in Danshen (Salvia miltiorrhiza). Figure 2 B).

[0022] Example 2: Salvia miltiorrhiza SmNAC39 Construction and transformation of gene expression vectors in plants 2.1 Danshen overexpression vector pCAMBIA2306- SmNAC39- flag construction Based on the already cloned Salvia miltiorrhiza SmNAC39 Gene sequence was used to design primers for constructing a plant overexpression vector (sequences are shown in SEQ ID NO.2 and SEQ ID NO.3), and pCAMBIA2306- was constructed. SmNAC39 -flag vector, and pCAMBIA2306- SmNAC39 The -flag plasmid was transformed into Agrobacterium rhizogenes C58C1. Single colonies were picked for PCR verification. The results showed that it contained... SmNAC39 Plant overexpression vector 2306- SmNAC39 -flag has been successfully transformed into Agrobacterium rhizogenes C58C1 and can be used for subsequent genetic transformation and hair root infection experiments.

[0023] 2.2 Danshen RNAi vector pFGC5941- SmNAC39 Construction Based on the already cloned Salvia miltiorrhiza SmNAC39 Gene sequence was used to design primers for constructing plant RNAi vectors (sequences are shown in SEQ ID NO.4 and SEQ ID NO.5), and pFGC5941- was constructed. SmNAC39 The vector, and pFGC5941- SmNAC39 The plasmid was transformed into Agrobacterium rhizogenes C58C1. Single colonies were picked for PCR verification. The results showed that it contained... SmNAC39 The plant RNAi vector pFGC5941- SmNAC39 It has been successfully transformed into Agrobacterium rhizogenes C58C1 and can be used for subsequent genetic transformation and hair root infection experiments.

[0024] The specific primer design is as follows:

[0025] Example 3: Salvia miltiorrhiza SmNAC39 Subcellular localization analysis of genes 3.1 Salvia miltiorrhiza expression vector pHB- SmNAC39 -YFP construction Based on the already cloned Salvia miltiorrhiza SmNAC39 Gene sequence, primers for designing plant overexpression vectors (sequences shown in SEQ ID NO. 6 and SEQ ID NO. 7), and construction of pHB- SmNAC39 -YFP vector.

[0026] The specific primer design is as follows:

[0027] 3.2 pHB- SmNAC39- YFP vector transformed Agrobacterium tumefaciens GV3101 Take the pHB- obtained in Example 3.1 SmNAC39- YFP and the empty vector pHB-YFP plasmid were transformed into Agrobacterium tumefaciens GV3101, and single colonies were picked for PCR verification. The results showed that it contained... SmNAC39 plant overexpression vector pHB- SmNAC39- YFP has been successfully transformed into Agrobacterium tumefaciens GV3101.

[0028] 3.3 Transient expression in tobacco Using a sterile syringe, aspirate the pHB- carrier-containing sample constructed in step 2.1. SmNAC39- Agrobacterium tumefaciens GV3101 containing YFP and the empty vector pHB-YFP was used to transiently transform well-grown tobacco leaves. The leaves were first cultured in the dark for 24 hours, followed by 24 hours of light exposure. Subcellular localization was observed using a laser confocal microscope. Tobacco leaves were placed face down on a slide with distilled water, covered with a coverslip, and observed under a laser confocal microscope. The fluorescence of the empty vector pHB-YFP was found to be distributed in the cytoplasm and nucleus; while... SmNAC39 - The fluorescence of the YFP fusion protein is limited to the cell nucleus. YFP, yellow fluorescent protein; DAPI, blue fluorescent protein; BF, bright field; Merged, a merged image of yellow fluorescent protein and bright field; pHB- SmNAC39- Transient fluorescence expression of YFP, SmNAC39; fluorescence expression of pHB-YFP, empty vector. The results indicate that... SmNAC39 They are expressed in the cell nucleus, consistent with their function as transcription factors (see...). Figure 3 ).

[0029] Example 4 4.1 Obtaining monoclonal hairy roots based on genetic transformation Pre-culture of sterile Salvia miltiorrhiza seedlings: The explants of sterile Salvia miltiorrhiza seedlings were spread on 1 / 2 MS solid medium and incubated at 25°C in the dark for 48 h. Co-culture: The pre-cultured explants were mixed with C58C1 Agrobacterium rhizogenes for infection. The mixing time was 10 min. After that, the surface bacterial solution was blotted dry with sterile paper and placed on 1 / 2 MS solid medium. It was then incubated at 25°C in the dark for 48 h. Antibiotic reduction: Co-cultured explants were placed sequentially on 1 / 2 MS solid medium containing 300 mg / L Cb, 500 mg / L Cef, and 200 mg / L Cef, and antibiotics were reduced every two weeks until no antibiotics were present. Separate individual clones: Cut off individual hairy roots on antibiotic-free 1 / 2 MS solid medium and place them individually on 1 / 2 MS solid medium; Subculturing: A portion of the grown single clone is cut off for subculturing, eventually obtaining a stable root system (see...). Figure 4 ).

[0030] 4.2 Extraction of DNA from the hairy roots of Salvia miltiorrhiza Genomic DNA from the transgenic hairy roots obtained in section 4.1 was extracted using the CTAB method. For specific operating procedures, please refer to the CTAB operating instructions.

[0031] 4.3 Positive Identification of Transgenic Hairy Roots To identify overexpressing roots, simply design a downstream primer 2306-R containing the vector sequence and perform PCR positive identification with the upstream primer for SmNAC39 gene amplification (see results). Figure 5 A). Marker refers to the DNA molecular weight standard, also known as DNA marker. NC is the negative control, and PC is the positive control. Specific primer design: SmNAC39-F is the upstream primer for gene amplification, and 2306-R is the downstream primer, with sequences as shown in SEQ ID NO. 10 and SEQ ID NO. 11.

[0032] Identifying RNAi hairy root systems used the upstream sequence 5941-35S-F of the vector as the upstream primer and SmNAC39 -R was used as the downstream primer for PCR positive identification (results are shown in...). Figure 5 B). Specific primer design: 5941-35S-F is the upstream primer. SmNAC39 -R represents the downstream primer, with sequences such as SEQ ID NO. 12 and SEQ ID NO. 13.

[0033] All positive transgenic hairy roots and control hairy roots need to be identified using the rolB gene, with primers rolB-F and rolB-R, sequences shown in SEQ ID NO. 8 and SEQ ID NO. 9, to confirm that the Ri plasmid has indeed been integrated into the Danshen genome.

[0034] In this embodiment, the overexpressing root systems that showed positive results were selected. SmNAC39 -OE-04、 SmNAC39 -OE-28、 SmNAC39 -OE-36、 SmNAC39 -OE-42 and SmNAC39Five clones of -OE-45 with positive RNAi roots SmNAC39 -RNAi-04, SmNAC39 -RNAi-06, SmNAC39 -RNAi-24, SmNAC39 -RNAi-26 and SmNAC39 Five clones of RNAi-41 and the empty transgenic hairy root system of pCAMBIA2306 were used as controls.

[0035] The specific primer design is as follows:

[0036] Example 5: Quantitative PCR detection of related gene expression in the hairy roots of transgenic Salvia miltiorrhiza. 5.1 Shake-flask culture of hairy roots In Example 4, the positive hairy roots were selected for... SmNAC39 Quantitative analysis of gene expression levels is performed to screen for gene expression. Five overexpression-positive hairy roots and five RNAi-positive hairy roots were cultured in the dark (they were: SmNAC39 -OE-04、 SmNAC39 -OE-28、 SmNAC39 -OE-36、 SmNAC39 -OE-42、 SmNAC39 -OE-45 and SmNAC39 -RNAi-04, SmNAC39 -RNAi-06, SmNAC39 -RNAi-24, SmNAC39 -RNAi-26 and SmNAC39 (RNAi-41), hairy roots can be harvested after about 50 days. Take an appropriate amount of fresh hairy roots, blot off the surface moisture with absorbent paper, wrap them in aluminum foil, freeze them in liquid nitrogen, and store them at -80℃ for RNA extraction. The remaining hairy roots are dried and used for the extraction of salvianolic acid.

[0037] 5.2 RNA extraction and cDNA synthesis Total RNA was extracted and its purity and concentration were determined. It was then reverse transcribed into cDNA for quantitative PCR analysis. The reaction system used the Tiangen Polysaccharide and Polyphenol Plant Total RNA Extraction Kit, with SmActin as the internal control gene.

[0038] 5.3 Primer Design and Synthesis According to Danshen gene SmNAC39Primers were designed using Primer 5.0 software to detect the expression of related genes in the hairy roots of Salvia miltiorrhiza, and the coding sequences of the genes related to the biosynthesis of salvianolic acid were used. The Actin gene was used as an internal control.

[0039] The specific primer design is as follows:

[0040] 5.4 Quantitative PCR detection of hairy roots of transgenic Salvia miltiorrhiza Using the same amount of the first strand of cDNA as a template, quantitative PCR amplification was performed using the primers designed above (SEQ ID NO. 14-31). The reaction system is as follows:

[0041] result Figure 7 As shown, among the key enzyme genes in the pandanosine biosynthesis pathway that were detected, SmCYP98A14 and SmPAL1 The change in relative expression level was more prominent, followed by Sm4CL2 and SmC4H Specifically, in SmNAC39 RNAi strains SmCYP98A14 The relative expression level decreased significantly to 0.65 to 0.69 times that of the EV. SmNAC39 Conversely, the overexpression lines showed a significant increase in relative expression levels, ranging from 1.36 to 2.26 times that of EV. SmPAL1 Then in SmNAC39 The expression level increased significantly by 1.58 to 3.81 times in overexpression lines. Furthermore, Sm4CL2 exist SmNAC39 -RNAi-06, SmNAC39 -RNAi-26 and SmNAC39 The relative expression level of RNAi-41 in the strain decreased significantly to 0.16 to 0.60 times that of EV. SmC4H exist SmNAC39 -RNAi-04, SmNAC39 -RNAi-24, SmNAC39 The relative expression levels of RNAi-26 in the RNAi-26 strain decreased significantly to 0.43 to 0.34 times that of EV. SmNAC39 The relative expression level in the -OE-28 strain increased significantly to 1.42 times that of EV.

[0042] The above results indicate that SmNAC39 It may be promoted through some mechanism SmCYP98A14 , SmPAL1, Sm4CL2 and SmC4H The expression of these components promotes the synthesis of salvianolic acid compounds.

[0043] Example 6: Dual-luciferase assay verification SmNAC39Targets of transcription factors The promoter of the key enzyme gene for the biosynthesis of salvianolic acid was constructed into the pGreen II 0800 vector. The constructed vector was then transformed into Agrobacterium GV3101 (pSoup). pHB- SmNAC39 -YFP vector, and transformed into GV3101. Bacterial cultures with different promoters were then mixed with pH B- SmNAC39 YFP bacterial cultures were mixed in a 1:1 ratio, suspended in osmotic buffer, and OD values ​​were adjusted. 600 The concentration was 0.5-0.6, obtained from tobacco injection. Dual-LUC detection. SmNAC39 The activation effect of transcription factors on promoters. Results showed that: SmCYP98A14, Sm4CL2, SmTAT1 The promoter has a significant promoting effect (see Figure 8 ).

[0044] Example 7 Overexpression and RNAi SmNAC39 Detection of salvianolic acid content in transgenic hairy roots In this embodiment, the content of salvianolic acid in the hairy roots of transgenic Salvia miltiorrhiza was determined by HPLC, as follows: 7.1 Extraction of Tanshinone Dry the hairy root samples in an oven at 60 °C and grind them into powder. Accurately weigh 50 mg of sample powder into a 50 mL centrifuge tube. Add 10 mL of organic reagent extraction solution (ethanol:water = 4:1) to each tube and sonicate at room temperature for 0.5 h. Centrifuge at 8000 rpm for 20 min at room temperature. Collect the supernatant from each tube and rotary evaporate to dryness at 65 °C. Dissolve the residue in ultrapure water and transfer the solution to a new 2 mL EP tube. Centrifuge the sample in the 2 mL EP tube at 12000 rpm for 10 min at room temperature. Filter the sample through a 0.22 μm organic filter membrane using a 1 mL syringe, and collect the filtrate for analysis or later use.

[0045] 7.2 Preparation of Danshensu acid standard Accurately weigh the standard powders of rosmarinic acid (RA), salvianolic acid B (SAB), caffeic acid (CA), and salvianolic acid A (SAA), dissolve them separately in chromatographic grade methanol to obtain a stock solution of 2.5 mg / mL, take 100 μL of each and mix them to obtain a mixed standard with a final concentration of 0.625 mg / mL. Then, use chromatographic grade methanol to serially dilute the mixed standard to obtain 6 different concentrations for plotting a standard curve.

[0046] 7.3 Liquid Chromatographic Detection Conditions for Tanshinone Acids A C-18 reversed-phase silica gel column was used. The chromatographic conditions were: flow rate 1.0 mL / min, injection volume 10 μL, column temperature 35℃, detection wavelength 281 nm. Elution was performed with acetonitrile (B) and 0.03% trifluoroacetic acid aqueous solution (D), and the elution conditions were as follows:

[0047] In this invention, the contents of rosmarinic acid and salvianolic acid A were significantly increased in the overexpressed hairy root system. The total salvianolic acid (TA) content was 1.24 times higher than that of the control group (EV) (see...). Figure 9 ).exist SmNAC39 In the transgenic hairy root system, SmNAC39 -OE-04、 SmNAC39 -OE-28、 SmNAC39 -OE-36、 SmNAC39 -OE-42 and SmNAC39 The root systems of these five OE-45 lines are all overexpression lines, among which... SmNAC39 -OE-04 and SmNAC39 The content of salvianolic acid in the two roots of -OE-45 was most significantly increased, by approximately 1.24 times and 1.15 times, respectively; in particular, SmNAC39 -OE-36、 SmNAC39 The content of salvianolic acid A in the roots of the -OE-42 strain increased by approximately 2.91 times. In RNAi lines, SmNAC39 -RNAi-06, SmNAC39 -RNAi-24, SmNAC39 -RNAi-26 and SmNAC39 The content of salvianolic acid in the roots of all four RNAi-41 samples was downregulated.

[0048] This invention employs overexpression SmNAC39 Metabolic engineering strategies have yielded transgenic hairy root systems of Salvia miltiorrhiza that produce high levels of salvianolic acid, making it possible to commercialize salvianolic acid in large quantities and providing an important source to meet market demand for salvianolic acid.

[0049] The above description of the embodiments is provided to enable those skilled in the art to understand and use the invention. Those skilled in the art can readily make various modifications to these embodiments and apply the general principles described herein to other embodiments without inventive effort. Therefore, the present invention is not limited to the above embodiments, and any improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the invention should be within the protection scope of the present invention.

[0050] Artificial sequence SEQ ID NO.1: ATGTCTGAAGACATGAATCTGTCCGTGAATGGCAACTCCAAGGTTCCTCC CGGCTTCCGCTTCCACCCACCGAGGAGGAGCTCCTCCATTACTACCTCC GCAAGAAAGTCGCCGCTGAGAAAATCGACCTCGACGTCATCCGCGACGTC GACCTCAACAAACTCGAGCCATGGGAGATTCAAGAGAAGTGCAAGATAGG GTCGACGCCGCAGAACGACTGGTACTTCTTCAGCCACAAGGACAAGAAGT ACCCGACGGGGACGCGGACGAACCGCGCCACGGCCGCCGGATTCTGGAAG GCGACGGGGCGCGACAAGGTCATCCACAGCAACTTCCGCCGCATCGGAAT GCGGAAGACTCTCGTCTTCTACCGCGGGAGAGCCCCTCACGGCCAGAAAT CCGACTGGATCATGCACGAGTATAGGCTCGACGACAACACGCCTCTCGAC TCCACTATCAACAATGTTTCCGGCGACACGGGCCCGGAGGAAGGGTGGGT GGTGTGCCGCGTATTCAAGAAGAAGAACTACCACAAGGCGTTAGAAAGCC CTCTCGCATCATCCGCCTCAATCCTCCCACGAAACGACGGCGTTCTGGAT CAACTACTCATGTACATGGGGAGATCCAGCTCCTGCAAGCAGGAATCCGA TCCCGCCATGCACTTCCCCTCTCATTCCGCCGCGGCCTTCCTGCACCTCC CCGACCTCCAAAGCCCCACCATCAACGACGATTGCGGCTTCAAGACACCT TCGAATGAGCTCATCACGCACGAAATGGGAACGACGTCGTCCGACTGGGT GACGCTAGACCGCCTCGTGGCGTCGCAGCTCAACGGCCAGCCTCCCAAAC ACTTCTCTGGCGCCGACGACGACTTCCCCTTCTCGTTCGATCACGACGAT CAGGTACAGCAATTGATGAACATGAATAATTCGGATAGGGGTAATGAGAC GGATCTGTGGAGCTTCGGTAGATCGTCGTCGTTGTCGTCGTCGTCGTCGG ACCCACTGTGCCACTTGTCTGTGTAA SEQ ID NO.2: ACGAGCTCGGTACCCGGGGATCC ATGTCTGAAGACATGAATCTGTCC SEQ ID NO.3: AGGGCGAATTGGTCGACTCTAGA CACAGACAAGTGGCACAGT SEQ ID NO.4: TTACATTTACAATTACCATGG CGGAATGCGGAAGACTCTCG SEQ ID NO.5: TTAAATCATCGATTGGGCGCGCC TCTTGAATACGCGGCACACC SEQ ID NO.6: CTCTCTCTCAAGCTTGGATCC ATGTCTGAAGACATGAATCTGTCC SEQ ID NO.7: GCCCTTGCTCACCATACTAGT CACAGACAAGTGGCACAGT SEQ ID NO.8: GCTCTTGCAGTGCTAGATTT SEQ ID NO.9: GAAGGTGCAAGCTACCTCTC SEQ ID NO.10: ATGTCTGAAGACATGAATCTGTCC SEQ ID NO.11: ACGTTGTCGAAACCGATGATAC SEQ ID NO.12: GAGACTTTTCAACAAAGGATAATTTCGG SEQ ID NO.13: CACAGACAAGTGGCACAGT SEQ ID NO.14: CGGAATGCGGAAGACTCTCG SEQ ID NO.15: TCTTGAATACGCGGCACACC SEQ ID NO.16: AGCACCGAGCAGCATGAAGATT SEQ ID NO.17: AGCAAAGCAGCGAACGAAGAGT SEQ ID NO.18: GATAGCGGAGTGCAGGTCGTAC SEQ ID NO.19: CGAACTAGCAGATTGGCAGAGG SEQ ID NO.20: CAACTGCTGGTCTTCCACAAAC SEQ ID NO.21: GCGAGCCAAAACGGACA SEQ ID NO.22: CCAGGAGTCCAAATAACAGAGCCG SEQ ID NO.23: GCCACCAAGCGTTCACCAAGAT SEQ ID NO.24: TGACTCCAGAAACAACCCACATT SEQ ID NO.25: CCCAGACGACCCTCCACAAG SEQ ID NO.26: ATTCGCATTCGCATTTCTCGG SEQ ID NO.27: GCGGCGTAGTGCTTCACCTTT SEQ ID NO.28: CGAGATCGCCTACTCCAAGTTCAAG SEQ ID NO.29: AGATGGCGTTACCGAAGTATCCCTG SEQ ID NO.30: GGTCTGTACCGTCGTCCTCTTCTCC SEQ ID NO.31: ACAAGGCTGGTATTTGGGAAAAGGT。

Claims

1. A tanshinone transcription factor SmNAC39, characterized in that, The nucleotide sequence of the SmNAC39 encoding gene is shown in SEQ ID NO.

1.

2. A gene expression cassette, characterized in that, It includes the SmNAC39 as described in claim 1.

3. A recombinant expression vector, characterized in that, It includes the SmNAC39 as described in claim 1.

4. A genetically engineered bacterium, characterized in that, It includes the recombinant expression vector as described in claim 3.

5. The application of the tanshinone transcription factor SmNAC39 of claim 1, the gene expression cassette of claim 2, the recombinant expression vector of claim 3, or the transgenic engineered bacteria of claim 4 in increasing the content of tanshinone in tanshinone.

6. The application according to claim 5, characterized in that, The SmNAC39 gene was overexpressed in Danshen.

7. The application according to claim 5, characterized in that, Hairy root culture was used.

8. The application of the Tanshinone transcription factor SmNAC39 as described in claim 1 in plant breeding, characterized in that, The plant breeding involves selecting and breeding *Salvia miltiorrhiza* varieties with increased *tanshinone* content.

9. The application according to claim 8, characterized in that, The SmNAC39 is overexpressed in Danshen.

Images