A zml ox3 gene mutant and a method for preparing corn resistant to ear rot
Editing the maize ZmLOX3 gene using the CRISPR/Cas9 system and introducing a gene mutant with a specific nucleotide sequence solved the problem of insufficient resistance of maize to Fusarium graminearum and Fusarium verticillatum ear rot, achieving a significant improvement in disease resistance and resource conservation.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
- Filing Date
- 2026-05-12
- Publication Date
- 2026-06-23
Smart Images

Figure CN122256383A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant molecular biology, and more particularly to a... ZmLOX3 Methods for preparing gene mutants and corn resistant to ear rot. Background Technology
[0002] Genome editing technology is a technique for targeted and precise modification of the genome, utilizing techniques such as zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and clustered regularly interspaced short palindromic repeats / CRISPR-associated nucleases (CRISPR / Cas). The CRISPR / Cas system is broadly classified into three types: Type I, Type II, and Type III. Type II systems are relatively simple, requiring only three components: Cas9 protein, tracrRNA, and crRNA. They are highly efficient and easy to operate, making them the most widely used genome editing system. The characteristic protein of Type II CRISPR / Cas systems is Cas9, which possesses two nuclease domains, RuvC and HNH. These domains are responsible for cleaving both strands of the target DNA, causing double-strand breaks. The HNH domain cleaves the DNA strand complementary to crRNA at a site 3 bp upstream of the prototype adjacent motif (PAM), while the RuvC domain cleaves the non-complementary strand at a site 3–8 bp upstream of the PAM. The Cas9 protein simultaneously processes crRNA and cleaves exogenous nucleic acids. crRNA binds to tracrRNA via base pairing to form a tracrRNA / crRNA complex. Researchers can use tracrRNA and crRNA as two guide RNAs (gRNAs) or fuse them together to form a single guide RNA (sgRNA). The sgRNA binds to the Cas9 endonuclease and guides Cas9 to the genome for cleavage at the target site. The CRISPR / Cas9 system induces double-strand breaks in the target gene DNA, activating intracellular DNA damage repair mechanisms and leading to deletions, knock-ins, and other mutations. Currently, the CRISPR / Cas9 system has been rapidly used in targeted genome editing research of various plants such as Arabidopsis thaliana, tobacco, sorghum, rice, wheat, and maize, and has achieved high induced mutation rates and genome-edited plants that can be stably inherited.
[0003] Ear rot in maize is one of the major diseases affecting maize growing regions worldwide. Caused by fungal infection, severe cases during harvest can lead to the entire ear becoming soft and rotten, resulting in a significant decrease in both yield and quality. Furthermore, the secondary metabolites secreted by the pathogen, such as deoxynivalenol (DON) and fumonisins (FUM), pose a significant threat to human and animal health. Symptoms vary to some extent depending on the specific pathogen. Ear rot caused by *Fusarium verticillatum* is characterized by a white mycelial layer covering the kernels. Simultaneously, the fumonisins (FUM) produced by *Fusarium verticillatum* are extremely harmful to humans and animals; for example, esophageal cancer in humans, pulmonary edema in pigs, and leukomalacia in equines are all closely related to this toxin. Ear rot caused by *Fusarium graminearum* mainly manifests as a pink or grayish-white mycelium covering the kernel surface. In severe cases, the ear and husk adhere together. *DON* produced by *Fusarium graminearum* has a significant impact on pigs, leading to reduced feed intake. Additionally, *DON* can cause headaches and dizziness in humans. The pathogen causing ear rot in maize mainly overwinters on maize seeds and diseased plant debris, serving as the primary source of infection. Different pathogens have different transmission routes. *Fusarium verticillatum* mainly spreads through rainwater, silks, and insect infestation; while *Fusarium graminearum* mainly spreads through silks and insect infestation. Additionally, the pathogen can also invade through the maize roots and spread to the ear via the stalk. Ear rot in maize can occur from the seedling stage to maturity and harvest, but the peak incidence is from silking to 21 days after silking. In production, corn ear rot primarily damages the ears, typically starting from the top. Infected kernels become dull, wrinkled, and underdeveloped, while the cob softens and rots, severely impacting mechanized harvesting and consequently reducing yield and quality. The incidence of corn ear rot in general fields is 5%–10%, but can reach 40%–50% in severe years, and over 50% in highly susceptible varieties. Therefore, controlling the occurrence and damage of corn ear rot is of great importance. Corn ear rot often occurs in the later stages of corn growth, making field control difficult. Therefore, planting disease-resistant varieties is key to controlling this disease at its source. Developing disease-resistant varieties through traditional breeding is time-consuming, labor-intensive, and wasteful of resources. However, combining gene editing technology with disease-resistant corn planting can significantly shorten the breeding cycle and save considerable resources, gradually becoming a new method in modern breeding.
[0004] In recent years, researchers have conducted gene mining and other studies on maize ear rot. For example, some studies have identified quantitative trait loci associated with maize ear rot resistance and fumonisin accumulation through QTL mapping, and analyzed candidate genes within these regions, including members of the lipoxygenase gene family. Among these, CN113980919A discloses a complete knockout... ZmLOX3Genes increase maize's resistance to ear rot caused by *Fusarium verticillatum*, but make it susceptible to grain rot caused by *Aspergillus flavus*. Due to differences in resistance genes among different maize plants, resistance to ear rot caused by different strains varies significantly. For example, some maize varieties can synthesize enzymes to degrade DON toxin (e.g., through glycosylation), thus mitigating the toxicity of *Fusarium graminearum*, but their degradation mechanisms for fumonisin (produced by *Fusarium verticillatum*) differ, resulting in a lack of effective mitigation of *Fusarium verticillatum* toxicity.
[0005] Therefore, there is an urgent need in this field to discover a... ZmLOX3 Gene mutants exhibit significantly enhanced resistance to ear rot caused by Fusarium graminearum and Fusarium verticillatum. Summary of the Invention
[0006] This invention, through the ZmLOX3 Extensive screening and verification of gene mutants revealed those with the characteristics shown in SEQ ID No. 1. ZmLOX3 The genetically modified maize exhibits significantly enhanced resistance to ear rot caused by *Fusarium graminearum* and *Fusarium verticillatum*, thereby strengthening maize's resistance to ear rot and enabling the creation of new maize germplasm resistant to ear rot. Based on this, the following technical solution is proposed.
[0007] In a first aspect, the present invention provides a ZmLOX3 Gene mutants having the nucleotide sequence shown in SEQ ID No. 1.
[0008] SEQ ID No. 1: In a second aspect, the present invention provides biological materials containing the said gene mutant or its encoded protein.
[0009] In some embodiments, the biological material is recombinant DNA, expression cassette, transposon, plasmid vector, viral vector, engineered bacteria, or corn cells or tissues.
[0010] Thirdly, the present invention provides a corn resistant to ear rot, which contains the gene mutant shown in SEQ ID No. 1 or its encoded protein.
[0011] The genetically modified corn exhibits resistance to ear rot caused by both Fusarium graminearum and Fusarium verticillatum.
[0012] The ear rot-resistant maize of the present invention does not limit the structural composition and complete genomic information of the intact plant. Therefore, its modified genes or proteins and target traits are applicable to numerous plant populations or individual plants. However, these plant populations or individual plants, apart from the aforementioned limited genes or encoded proteins, do not share the same or highly similar genetic background. Therefore, the ear rot-resistant maize of the present invention or its propagation material will not possess consistency and stability in major traits. Thus, the protected subject matter of the ear rot-resistant maize of the present invention does not fall within the scope of plant varieties.
[0013] Fourthly, the present invention provides the use of the said gene mutant or the said biological material in at least one of the following aspects: (1) Create new maize varieties resistant to ear rot; (2) Improvement of maize varieties resistant to ear rot; (3) Improve corn yield and / or quality; (4) Improve maize's resistance to ear rot caused by Fusarium graminearum and / or Fusarium verticillatum; (5) Improve maize’s resistance to Fusarium graminearum and / or Fusarium verticillatum.
[0014] Fifthly, the present invention provides a method for preparing corn resistant to ear rot or a method for improving corn ear rot resistance, comprising: having the aforementioned gene mutant or its encoded protein in the corn genome.
[0015] In some implementations, genetic engineering techniques are used to introduce the aforementioned gene mutant or its encoded protein into the maize genome.
[0016] In some implementations, the genetic engineering techniques include CRISPR-Cas system editing technology, zinc finger nuclease system editing technology, or TALEN system editing technology.
[0017] Preferably, the genetic engineering method employs CRISPR-Cas system editing technology, and the sgRNA sequence is shown in SEQ ID No. 2.
[0018] SEQ ID No.2: GATCATCGACGGGCTGACGG Preferably, the method involves introducing a gene-editing vector into maize to affect the maize's... ZmLOX3 Genes were edited to give the maize genome the gene mutant shown in SEQ ID No. 1 or its encoded protein.
[0019] Preferably, the gene editing vector contains the Cas9 gene and gRNA.
[0020] Preferably, the gene editing vector further contains at least one of a promoter (e.g., a strong constitutive promoter), a nuclear localization signal, a transcription terminator, a prokaryotic origin of replication, and an Agrobacterium replication origin.
[0021] Preferably, the promoter includes an RNA polymerase III promoter for driving gRNA.
[0022] Preferably, the gene editing vector uses the Ubi promoter to drive the Cas9 gene.
[0023] Preferably, the gene editing vector structure is as follows: Figure 1 As shown in A in the diagram.
[0024] Preferably, the gene editing vector further contains a T-DNA boundary sequence.
[0025] Preferably, the gene editing vector further contains a selection marker.
[0026] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention provides ZmLOX3 The gene mutant, containing which maize exhibits significantly enhanced resistance to ear rot caused by *Fusarium graminearum* and *Fusarium verticillatum*. Therefore, the present invention... ZmLOX3 Gene mutants can be used to enhance maize's resistance to ear rot and to create new maize germplasm resistant to ear rot, showing broad application prospects. Attached Figure Description
[0027] Figure 1 These are the results of gene editing vector construction and mutant plant identification; where A is a schematic diagram of the gene editing vector; B is a schematic diagram of the gene editing target; and C is the results of mutant plant identification.
[0028] Figure 2The results are the identification of maize ear rot resistance; (a) shows the typical field incidence of Fusarium ear rot (FER) and the average number of infected grains in FER; (b) shows the typical field incidence of Fusarium ear rot (GER) and the average number of infected grains in GER. Detailed Implementation
[0029] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of this invention, not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.
[0030] In the embodiments provided in this specification, unless specific techniques or conditions are specified, the techniques or conditions described in the literature in this field, or the product instructions, shall be followed. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased from legitimate channels.
[0031] This invention relates to molecular biology experiments. Unless otherwise specified, reference can be made to the book *Molecular Cloning* (J. Sambrook, E.F. Fritsch, and T. Maniatis, Science Press, 1994). This book and its subsequent editions are the most commonly used and guiding reference books for those skilled in the art when performing experiments related to molecular biology. In addition, depending on the experimental purpose, those skilled in the art complete the corresponding experiments under the guidance of the operating manuals accompanying various commercial reagent kits or entrust them to specialized companies, such as primer synthesis and gene sequencing.
[0032] In the examples described below, the genetic transformation recipient was the maize inbred line KN5585. The gene editing vector was CPB-Cas9. pEASY®-BluntSimple Cloning Vector and Escherichia coli strain Trans1-T1 were purchased from Beijing TransGen Biotech Co., Ltd. Hind III restriction endonuclease (NEB), KOD Plus, and KOD FX high-fidelity PCR amplification enzyme were purchased from Beijing Bailinke Biotechnology Co., Ltd., Beijing Liuhetong Trade Co., Ltd., and other companies.
[0033] Example 1 This embodiment provides a method for preparing corn resistant to ear rot, the steps of which are as follows: (1) A CRISPR / Cas9 knockout vector was constructed and introduced into BMEHA105 Agrobacterium competent cells (Beijing Bomeide Gene Technology Co., Ltd., catalog number: BC303-01) to obtain recombinant Agrobacterium. The CRISPR / Cas9 knockout vector is as follows: Figure 1 As shown in A in the diagram. The maize endogenous U6-2 promoter is used to initiate sgRNA expression. Reference genome sequence B73_RefGen_v4 is also mentioned. Zm00001d033623 Genes (also known as genes) ZmLOX3 gRNAs were designed, and their sequences are shown in SEQ ID No. 2. The gRNA sequences were verified by Sanger sequencing in the KN5585 receptor. Specifically, the sequences of CaMV PolyA (SEQ ID No. 3), Bar (SEQ ID No. 4), CaMV 35S (SEQ ID No. 5), NOS (SEQ ID No. 6), NLS (SEQ ID No. 7), Cas9 (SEQ ID No. 8), SV40 NLS (SEQ ID No. 9), Ubi (SEQ ID No. 10), 3896 promoter (SEQ ID No. 11), DsRed2 (SEQ ID No. 12), and U6-2 (SEQ ID No. 13) were used.
[0034] SEQ ID No. 3: TTTCCCATAATAATGTGTGAGTAGTTCCCAGATAAGGGAATTAGGGTTTCCTATAGGGTTTCGCTCATGTGTTGAGCATATAAGAAACCCTTAGTATGTATTTGTATTTGTAAAATACTTCTATCAATAAAATTTCTAATTCCTAAAACCAAAATCCAGTACTAAAATCCAGATC SEQ ID No.4: ATGAGCCCAGAACGACGCCCGGCCGACATCCGCCGTGCCACCGAGGCGGACATGCCGGCGGTCTGCACCATCGTCAACCACTACATCGAGACAAGCACGGTCAACTTCCGTACCGAGCCGCAGGAACCGCAGGAGTGGACGGACGACCTCGTCCGTCTGCGGGAGCGCTATCCCTGGCTCGTCGCCGAGGTGGACGGCGAGGTCGCCGGCATCGCCTACGCGGGCCCCTGGAAGGCACGCAACGCCTACGACTGGACGGCCGAGTCGACCGTGTACGTCTCCCCCCGCCACCAGCGGACGGGACTGGGCTCCACGCTCTACACCCACCTGCTGAAGTCCCTGGAGGCACAGGGCTTCAAGAGCGTGGTCGCTGTCATCGGGCTGCCCAACGACCCGAGCGTGCGCATGCACGAGGCGCTCGGATATGCCCCCCGCGGCATGCTGCGGGCGGCCGGCTTCAAGCACGGGAACTGGCATGACGTGGGTTTCTGGCAGCTGGACTTCAGCCTGCCGGTACCGCCCCGTCCGGTCCTGCCCGTCACCGAGATTTGA SEQ ID No.5: TCAGCGTGTCCTCTCCAAATGAAATGAACTTCCTTATATAGAGGAAGGGTCTTGCGAAGGATAGTGGGATTGTGCGTCATCCCTTACGTCAGTGGAGATATCACATCAATCCACTTGCTTTGAAGACGTGGTTGGAACGTCTTCTTTTTCCACGATGCTCCTCGTGGGTGGGGGTCCATCTTTGGGACCACTGTCGGCAGAGGCATCTTGAACGATAGCCTTTCCTTTATCGCAATGATGGCATTTGTAGGTGCCACCTTCCTTTTCTACTGTCCTTTTGATGAAGTGACAGATAGCTGGGCAATGGAATCCGAGGAGGTTTCCCGATATTACCCTTTGTTGAAAAGTCTCAATAGCCCTTTGGTCTTCTGAGACTGTATCTTTGATATTCTTGGAGTAGACGAGAGTGTCGTGCTCCACCATGTTCACATCAATCCACTTGCTTTGAAGACGTGGTTGGAACGTCTTCTTTTTCCACGATGCTCCTCGTGGGTGGGGGTCCATCTTTGGGACCACTGTCGGCAGAGGCATCTTGAACGATAGCCTTTCCTTTATCGCAATGATGGCATTTGTAGGTGCCACCTTCCTTTTCTACTGTCCTTTTGATGAAGTGACAGATAGCTGGGCAATGGAATCCGAGGAGGTTTCCCGATATTACCCTTTGTTGAAAAGTCTCA SEQ ID No.6: GATCGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTTGCCGGTCTTGCGATGATTATCATATAATTTCTGTTGAATTACGTTAAGCATGTAATAATTAACATGTAATGCATGACGTTATTTATGAGATGGGTTTTTATGATTAGAGTCCCGCAATTATACATTTAATACGCGATAGAAAACAAAATATAGCGCGCAAACTAGGATAAATTATCGCGCGCGGTGTCATCTATGTTACTAGATC SEQ ID No.7: CTTTTTCTTTTTTGCCTGGCCGGCCTTTTTCGTGGCCGCCGGCCTTTT SEQ ID No.8: SEQ ID No.9: GACCTTCCGCTTCTTCTTTGG SEQ ID No.10: SEQ ID No.11: SEQ ID No.12: ATGGCCTCCTCCGAGAACGTCATCACCGAGTTCATGCGCTTCAAGGTGCGCATGGAGGGCACCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCCACAACACCGTGAAGCTGAAGGTGACCAAGGGCGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCCCAGTTCCAGTACGGCTCCAAGGTGTACGTGAAGCACCCCGCCGACATCCCCGACTACAAGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGCGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCTGCTTCATCTACAAGGTGAAGTTCATCGGCGTGAACTTCCCCTCCGACGGCCCCGTGATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCACCGAGCGCCTGTACCCCCGCGACGGCGTGCTGAAGGGCGAGACCCACAAGGCCCTGAAGCTGAAGGACGGCGGCCACTACCTGGTGGAGTTCAAGTCCATCTACATGGCCAAGAAGCCCGTGCAGCTGCCCGGCTACTACTACGTGGACGCCAAGCTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAGCAGTACGAGCGCACCGAGGGCCGCCACCACCTGTTCCTGTAG SEQ ID No.13: AATTGGCCCTTACAAAATAGCTAGACGTGCAGGTGGCTGGATGTGCGCTCCCTGAATATCAACTTGTGTCTCCTCCGATTCAGTCCGCAGATGAAACTTGGTAATAACTGCAGCTGATCCGTCGTCATTCATGCTATGCAGGGGATTCGATCTTCAGCATGTGCAGTGCAGGCAACAACAATCTACGTTGTCTGGGC TTGCGATAGGTACACGACCACGAGGGAAGGCAACGCGTGATGTATGGGCCGCGCCTAAGCATCCAGCCCACGCGGGCGTGCGCGTCGTCGCTACGGCTTGCGGGGGAAGGGATCAAGGGACGAACCGAGAACTAGTACCAGACCGGCCAGCGAGCATTGCAGACACCGGCTTATAAGTTCAGCTGCGACCACCGCTCC (2) The recombinant Agrobacterium obtained in step (1) was cultured in N6 liquid medium to obtain the bacterial culture OD. 600nm The recombinant Agrobacterium bacterial suspension was centrifuged at 5000 rpm for 10 minutes to collect the cells. The cells were then resuspended in a prepared infection buffer (1 L of infection buffer was prepared by mixing 4 g of N6 salt containing N6 vitamin, 2 mg of 2,4-D, 100 mg of inositol, 0.7 g of L-proline, 68.4 g of sucrose, 36 g of glucose, 1 mL of AgNO3 (10 mg / mL), 1 mL of As (100 mol / L), and water, pH 5.2). 600nm The value was around 0.5, and then the mixture was shaken at 28 °C and 150 r / min for 0.5 hours to obtain the inoculum.
[0035] (3) Soak the callus tissue of the maize inbred line KN5585 with good growth in the infection buffer for 1 hour, then transfer it to the infection solution prepared in step (2) and soak it for 15 minutes, and then air dry.
[0036] (4) Place the callus tissue infected in step (3) into a co-culture medium (1L of co-culture medium is prepared by mixing 4g of N6 salt containing N6 vitamin 1000×, 2mg of 2,4-D, 30g of sucrose, 8g of agar, 1mL of AgNO3 (10mg / mL), 1mL of As (100mol / L), 3mL of L-cysteine (100mg / mL) and water, pH 5.8), and culture at 20℃ for 3 days. Then transfer to recovery medium (1L of recovery medium is prepared by mixing 4g of N6 salt, 1mL of N6 vitamin 1000×, 1.5mg of 2,4-D, 0.7g of L-proline, 30g of sucrose, 5μM AgNO3, 0.5g of... MES (100 mg cefotaxime, 100 mg vancomycin, 8 g agar and water, pH 5.8) was mixed and cultured at 28°C for 10 days, then transferred to recovery medium containing 1.5 mg / L glufosinate and cultured in the dark at 28°C for 7 days to screen for positive callus tissue.
[0037] (5) Transfer the positive callus obtained in step (4) to embryoid induction medium (1L of embryoid induction medium is prepared by mixing 4.43g MS salt containing MS vitamin (containing inositol), 0.25mg 2,4-D, 30g sucrose, 5mg 6-BA, 4g plant gel, 1mL Cefo (250mg / mL) and water, pH 5.8), and culture in the dark for 2 weeks. Then transfer to differentiation medium (1L of differentiation medium is prepared by mixing 4.43g MS salt containing MS vitamin (containing inositol), 30g sucrose, 4g plant gel, 1mL Cefo (250mg / mL) and water, pH 5.8). After green shoots emerge, transfer to rooting medium (1L of rooting medium is prepared by mixing 2.215g 1 / 2 MS, 30g sucrose, 51.55mg 6-BA, 4g plant gel, 1mL Cefo (250mg / mL) and water, pH 5.8). MSvitamin (4g plant gel and water, pH 5.8) rooted, grew to a certain height, and was cultured in the air for 3 days before transplanting.
[0038] (6) Take about 3 cm of plant leaves, grind them thoroughly in a tube, add 500 μl of buffer (from bar gene test strip), insert bar gene test strip (Beijing Aochuang Jinbiao Biotechnology Co., Ltd., product number: A07-13-413), and plants that show positive bands are T0 generation positive plants.
[0039] Example 2 This embodiment verifies the transgenic components in the positive plants of Example 1, detects mutations, and identifies the resistance of mutants. The steps are as follows: 1. Verification of genetically modified components: DNA was extracted and purified using a plant genomic DNA extraction kit (Tiangen, China). T-DNA was detected by Bar test strips (Agdia, Cat. #STX14200 / 0012, US) and PCR of the Cas9 gene.
[0040] Cas9 PCR amplification used a 5'-TCTTCTTCTGGCGGTTCTCT-3' forward primer and a 5'-TCATCCACCTGTTTACCCTG-3' reverse primer. The PCR program consisted of 35 cycles: 94 °C for 3 min; 95 °C for 30 s, 58 °C for 30 s, 68 °C for 20 s; and a final extension at 68 °C for 10 min.
[0041] 2. Mutation detection: Primers 5'-AGTGGATCATCGGTGCACGGTGCTCGC-3' and 5'-CCAGGCTACAACTAGCTTTGCTGT-3' were designed based on the target location of the knockout vector. PCR was used to amplify the target gene in the corresponding plants, and the mutation type was analyzed using DSDecode software after sequencing. The PCR reaction system and procedure were the same as those used for transgenic component verification.
[0042] PCR amplification and Sanger sequencing confirmed that positive plants had a mutation in the sgRNA binding region. Figure 1 (in C), and obtained a frameshift mutation, ZmLOX3 The gene mutant is shown in SEQ ID No. 1. The mutation type is the deletion of one thymine and one adenine. This maize material was further used for resistance identification to maize ear rot.
[0043] 3. Mutant resistance identification Will carry ZmLOX3 Maize materials with gene mutants ( ZmLOX3 (-2) Wild-type (WT) maize materials were mixed and inoculated at a 1:1 ratio to identify pathogens, excluding interference from environmental and other factors. Equal concentrations of *Fusarium graminearum* and *Fusarium verticillatum* were inoculated separately, and disease incidence was statistically analyzed after harvest. During the investigation of maize ear rot, the husks of inoculated maize ears were removed, and the disease level of each ear was investigated and recorded: Level 1: 0%–1% of the total ear area affected; Level 3: 2%–10% of the total ear area affected; Level 5: 11%–25% of the total ear area affected; Level 7: 26%–50% of the total ear area affected; Level 9: 51%–100% of the total ear area affected. Statistical data were recorded and relevant analyses were performed to identify the disease resistance effect of the gene mutants.
[0044] Statistical analysis of diseased ears of fruit revealed that ( Figure 2In the experimental group inoculated with Fusarium graminearum, those carrying... ZmLOX3 Compared to wild-type maize, the mutant maize material exhibited significantly enhanced resistance to ear rot caused by *Fusarium verticillatum* and *Fusarium graminearum*, with a significant reduction in the number of diseased kernels. These results indicate that the mutant possesses significant resistance to both *F. verticillatum*-induced *Fusarium* ear rot (FER) and *Fusarium graminearum*-induced *G. graminearum* ear rot (GER). Furthermore, these experimental results demonstrate that gene editing can induce the growth of maize with the mutant gene shown in SEQ ID No. 1. ZmLOX3 Gene mutants can be used to quickly create new germplasm resistant to corn ear rot.
[0045] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims
1. A kind ZmLOX3 Gene mutants, characterized by, It has a nucleotide sequence as shown in SEQ ID No.
1.
2. Biological material containing the gene mutant of claim 1 or its encoded protein.
3. The biomaterial according to claim 2, characterized in that, The biological materials are recombinant DNA, expression cassettes, transposons, plasmid vectors, viral vectors, engineered bacteria, or corn cells or tissues.
4. A type of maize resistant to ear rot, characterized in that, It contains the gene mutant shown in SEQ ID No. 1 or its encoded protein.
5. The use of the gene mutant of claim 1, or the biological material of claim 2 or 3, in at least one of the following aspects: (1) Create new maize varieties resistant to ear rot; (2) Improvement of maize varieties resistant to ear rot; (3) Improve corn yield and / or quality; (4) Improve maize's resistance to ear rot caused by Fusarium graminearum and / or Fusarium verticillatum; (5) Improve maize’s resistance to Fusarium graminearum and / or Fusarium verticillatum.
6. A method for preparing corn resistant to ear rot, characterized in that, include: The maize genome contains the gene mutant of claim 1 or its encoded protein.
7. The method according to claim 6, characterized in that, Genetic engineering techniques are used to introduce the gene mutant or its encoded protein as described in claim 1 into the maize genome.
8. The method according to claim 7, characterized in that, The genetic engineering techniques include CRISPR-Cas system editing technology, zinc finger nuclease system editing technology, or TALEN system editing technology.
9. The method according to claim 8, characterized in that, The genetic engineering method used is CRISPR-Cas system editing technology, and the sgRNA sequence is shown in SEQ ID No.
2.
10. A method for improving resistance to ear rot in maize, characterized in that, include: The maize genome contains the gene mutant of claim 1 or its encoded protein.