Application of OsSBF1 gene in regulating cold tolerance of rice seedling and booting stage

Abstract

The application discloses OsSBF1 The application discloses application of a gene in regulating cold tolerance of rice at the seedling stage and the booting stage. OsSBF1 The application discloses a method for regulating cold tolerance of rice at the seedling stage and the booting stage, and the gene can be used to obtain a method for regulating cold tolerance of rice at the two stages, which expands the understanding of the regulation of the cold tolerance of rice and has important significance for breeding of cold-tolerant rice varieties.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering, specifically to... OsSBF1 Application of genes in regulating cold tolerance during the seedling and booting stages of rice. Background Technology

[0002] Rice ( Oryza sativa Rice originated in tropical and subtropical regions and is widely distributed throughout the world, from 53°36'N (Mohe, the northernmost city in China) to 35°S (southern Argentina). As one of the world's most important food crops, it feeds more than half of the world's population (Wing et al., 2018). Rice has a long history of cultivation in my country and is grown in most parts of the country, remaining a staple food for the Chinese people. Therefore, stable and increased rice production is directly related to my country's food security.

[0003] Low temperature, as one of the main abiotic stresses faced by rice during its growth and development, severely restricts its geographical distribution, growth and development, as well as yield and quality. Rice is a thermophilic plant and is very sensitive to low temperature stress, which has varying degrees of harm to rice at different growth stages. When rice seedlings are subjected to low-temperature stress, chlorophyll in the leaves degrades rapidly, causing the seedlings to turn yellow or white. The roots' ability to absorb fertilizer and water decreases, leading to growth and development disorders and even death (Pan Yexing et al., 2008). The rice panicle is a sensitive part to low temperatures, with the anthers being the organ directly affected by low temperatures and grain setting. Low temperatures during the booting stage can cause pollen abortion, reducing the grain setting rate; it can also lead to delayed heading, abnormal organ development, shorter panicle length, and degeneration of branches and spikelets, ultimately affecting rice yield (Jiang Lixia et al., 2009). Chill damage during the grain-filling stage reduces the rate of grain filling, hinders the smooth transfer of nutrients from stems and leaves to grains, resulting in underdeveloped grains, reduced thousand-grain weight, and ultimately, significant yield losses (Geng Liqing et al., 2009). In recent years, abnormal climate and frequent extreme weather events have further increased the uncertainty of high rice yields. my country loses 3-5 billion kilograms of rice annually due to chilling damage (Xia Ruixiang et al., 2010). Therefore, employing effective research methods to identify genes that regulate cold tolerance in rice during the seedling and booting stages is a crucial task for breeding new cold-resistant rice varieties. Summary of the Invention

[0004] The technical problem solved by this invention is how to regulate the cold resistance of plants.

[0005] To address this technical problem, in a first aspect, the present invention provides the application of protein OsSBF1 or related biological materials in the following A1) or A2): A1) Regulate plant cold resistance; A2) Cultivate cold-resistant plants; The protein OsSBF1 is either a1), a2), a3), or a4). a1) The amino acid sequence is that of the protein shown in sequence 1 of the sequence listing; a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in Sequence 1 of the sequence listing; a3) Proteins with the same biological function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in Sequence 1 of the sequence listing. a4) Proteins that have 80% or more identity with the amino acid sequence defined by sequence 1 in the sequence listing, are derived from plants, and have the same biological function.

[0006] In the above-mentioned proteins, identity refers to the identity of the amino acid sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences to calculate the identity value (%), then the identity value can be obtained.

[0007] In the aforementioned proteins, the 80% or more identity can be at least 81%, 82%, 85%, 86%, 88%, 90%, 91%, 92%, 95%, 96%, 98%, 99%, or 100% identity.

[0008] In the applications described above, the protein OsSBF1 Related biological materials include nucleic acid molecules encoding the protein OsSBF1, expression cassettes or recombinant vectors or recombinant bacteria expressing the nucleic acid molecules; The nucleic acid molecule encoding the protein OsSBF1 is as follows: (b1) or (b2) or (b3) or (b4) b1) The nucleotide sequence is the DNA molecule shown in sequence 2 of the sequence listing; b2) The nucleotide sequence is the DNA molecule shown in sequence 3 of the sequence listing; b3) A DNA molecule that has 90% or more identity with the nucleotide sequence defined in b1) or b2) and is derived from a plant and encodes the protein OsSBF1 described in the first aspect; b4) Hybridizes under stringent conditions to the nucleotide sequence defined in b1) or b2), and encodes the protein described in the first aspect. OsSBF1 DNA molecules.

[0009] The term "identity" refers to sequence similarity to a natural nucleic acid sequence. Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0010] The 90% or higher identity can be at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity.

[0011] In a second aspect, the present invention provides the use of a substance that inhibits the activity of the protein OsSBF1 described in the first aspect or inhibits the expression of a nucleic acid molecule encoding the protein OsSBF1 described in the first aspect in B1) or B2) below: B1) Reduces the cold resistance of plants; B2) Cultivate plants with low cold tolerance.

[0012] In the above text, the substance that inhibits the activity of protein OsSBF1 or inhibits the expression of the nucleic acid molecule encoding protein OsSBF1 can be a substance that inhibits or reduces at least one of the following six types of regulation: 1) regulation at the transcriptional level of the gene; 2) post-transcriptional regulation of the gene (i.e., regulation of splicing or processing of the primary transcript of the gene); 3) regulation of RNA transport of the gene (i.e., regulation of mRNA transport of the gene from the nucleus to the cytoplasm); 4) regulation of translation of the gene; 5) regulation of mRNA degradation of the gene; 6) post-translational regulation of the gene (i.e., regulation of the activity of the protein translated from the gene).

[0013] In the applications described above, the inhibition or reduction of nucleic acid molecule expression can be achieved through gene knockout or gene silencing.

[0014] Gene knockout refers to the phenomenon of inactivating a specific target gene through homologous recombination. Gene knockout inactivates a specific target gene by altering its DNA sequence.

[0015] Gene silencing refers to the phenomenon of preventing or reducing gene expression without damaging the original DNA. Gene silencing presupposes no change in the DNA sequence, resulting in the absence or reduction of gene expression. Gene silencing can occur at two levels: transcriptional silencing due to DNA methylation, heterochromatinization, and position effects; and post-transcriptional gene silencing, which inactivates the gene at the post-transcriptional level through specific inhibition of target RNA. This includes antisense RNA, co-suppression, quelling, RNA interference (RNAi), and microRNA (miRNA)-mediated translational repression.

[0016] In the applications described above, the substance that inhibits or reduces the expression of the nucleic acid molecule can be a reagent for knocking out the nucleic acid molecule, such as a reagent for knocking out the gene through homologous recombination, or a reagent for knocking out the nucleic acid molecule through CRISPR / Cas9. The reagent for inhibiting or reducing the expression of the nucleic acid molecule can contain a polynucleotide that targets the gene, such as siRNA, shRNA, sgRNA, miRNA, or antisense RNA.

[0017] In the above-described applications, the substance may be a CRISPR system that inhibits the expression of nucleic acid molecules encoding the protein OsSBF1; The CRISPR system includes sgRNA targeting a nucleic acid molecule encoding the protein OsSBF1. The nucleotide sequence of the target site of the sgRNA is positions 274-293 of sequence listing 3.

[0018] The CRISPR system may include the recombinant plasmid pCRISPR- OsSBF1 .

[0019] Thirdly, the present invention provides a method for reducing the cold resistance of plants, as shown in D1) or D2). The method described in D1) includes the following steps: reducing or inhibiting the content and / or activity of protein OsSBF1 in the target plant, thereby reducing the plant's cold resistance; The method described in D2) includes the following steps: reducing or inhibiting the expression of nucleic acid molecules encoding the protein OsSBF1 in the target plant, thereby reducing the plant's cold resistance; The target plant contains a nucleic acid molecule encoding the protein OsSBF1; The protein OsSBF1 is either a1), a2), a3), or a4). a1) The amino acid sequence is that of the protein shown in sequence 1 of the sequence listing; a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in Sequence 1 of the sequence listing; a3) Proteins with the same biological function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in Sequence 1 of the sequence listing. a4) Proteins that have 80% or more identity with the amino acid sequence defined by sequence 1 in the sequence listing, are derived from plants, and have the same biological function.

[0020] Fourthly, the present invention provides a method for cultivating plants with low cold tolerance, comprising the following steps: inhibiting or reducing the content and / or activity of the protein OsSBF1 described in the first aspect in the low-cold-tolerant plant to obtain a transgenic plant, which is the target plant; The transgenic plant is less cold-resistant than the original plant.

[0021] Fifthly, the present invention provides a method for cultivating plants with low cold resistance, comprising the following steps: inhibiting or reducing the expression of the nucleic acid molecule encoding the protein OsSBF1 in the first aspect in the starting plant to obtain a transgenic plant, which is the target plant; The transgenic plant is less cold-resistant than the original plant.

[0022] Alternatively, the present invention provides a method for cultivating plants with low cold tolerance, comprising the following steps: gene editing of the nucleic acid molecule encoding the protein OsSBF1 in the first aspect of the starting plant, causing the translation of the protein OsSBF1 to terminate prematurely, thereby obtaining a transgenic plant, which is the target plant; The transgenic plant is less cold-resistant than the original plant.

[0023] In the method described above, reducing the content and / or activity of the protein OsSBF1 in the first aspect of the starting plant reduces the protein in the first aspect of the starting plant. OsSBF1 The expression of nucleic acids, or the proteins described in the first aspect in the starting plant. OsSBF1 Gene editing of encoded nucleic acids is performed by introducing a CRISPR system, which in the second aspect inhibits the expression of nucleic acid molecules encoding the protein OsSBF1, into the starting plant.

[0024] The reduced cold resistance can be reflected in the fact that the survival rate or fruit setting rate of transgenic plants under cold stress or low temperature stress is lower than that of the original plants; the aforementioned cold stress or low temperature stress can specifically be low temperature stress of 4℃ during the seedling stage or natural low temperature stress (16-20℃) during the gestation period.

[0025] The cold resistance mentioned above is reflected in the seedling stage and / or the booting stage.

[0026] The plants mentioned above are either dicotyledonous or monocotyledonous plants.

[0027] The plants mentioned above are grasses (Poaceae).

[0028] The plant mentioned above is rice.

[0029] The inventor discovered OsSBF1 Encode a Na + The function of transport proteins in rice's low-temperature tolerance is currently unknown. This has been discovered through genetic engineering methods. OsSBF1 By regulating the cold tolerance of rice during the seedling and booting stages, a method for regulating the cold tolerance of rice at these two stages has been discovered, expanding our understanding of the regulation of rice cold tolerance. This invention discovers through genetic engineering methods OsSBF1 This gene can be used to regulate the cold resistance of rice during the seedling and booting stages. It provides a method to regulate the cold resistance of rice at these two stages, expands our understanding of the regulation of rice cold resistance, and is of great significance for breeding cold-resistant rice varieties. Attached Figure Description

[0030] Figure 1 for OsSBF1 Identification of mutation types and seedling cold tolerance in transgenic lines. Figure A shows the ZH11 background. OsSBF1 Sequencing identification results of the knockout line; Figure B shows the phenotypes of the knockout line and wild-type ZH11 before and after cold treatment in the ZH11 background, with a scale bar of 6 cm. Data are the mean ± standard deviation of three biological replicates, with n≥24 for each replicate. t The test is used for significance testing, and * indicates... P <0.05.

[0031] Figure 2 for OsSBF1 Identification of cold tolerance during the booting stage of transgenic lines. Values ​​shown are mean ± standard deviation, n=5. ** indicates highly significant difference. P <0.01, statistical analysis method is Student's t The test is used for significance testing. Detailed Implementation

[0032] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0033] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0034] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.

[0035] The carrier and culture medium information in the following examples are as follows: CRISPR / Cas vector BGK03: Hangzhou Baige Biotechnology Co., Ltd., product catalog number BGK03.

[0036] Contains "sgRNA- U3 The plasmid for the "promoter" was constructed in our laboratory.

[0037] The culture media below were prepared by dissolving the listed solutes in water.

[0038] N6D2 medium: solid MS medium containing 300 mg / L hydrolyzed casein, 500 mg / L proline, 500 mg / L glutamine, 30 g / L sucrose and 2 mg / L 2,4-D.

[0039] N6D2S1 medium: N6D2 medium containing 25 mg / L hygromycin and 600 mg / L cephalosporin.

[0040] N6D2S2 medium: N6D2 medium containing 50 mg / L hygromycin and 300 mg / L cephalosporin.

[0041] Differentiation medium A: N6D2 medium containing 300 mg / L hydrolyzed casein, 50 mg / L hygromycin, 1 mg / L 6-BA, 0.5 mg / L KT, 0.2 mg / L ZT, 0.25 mg / L NAA, 30 g / L sucrose and 30 g / L sorbitol.

[0042] Differentiation medium B: N6D2 medium containing 300 mg / L hydrolyzed casein, 50 mg / L hygromycin, 1 mg / L 6-BA, 0.5 mg / L KT, 0.2 mg / L ZT, 0.5 mg / L NAA, 30 g / L sucrose and 20 g / L sorbitol.

[0043] Rooting and seedling strengthening medium: solid 1 / 2 MS medium containing 1 mg / L paclobutrazol and 0.5 mg / L NAA.

[0044] The formulation of Kimura B culture medium is shown in Table 1, with a pH of 5.8 and dH2O as the solvent.

[0045] Table 1 shows the formulation of Kimura B culture medium.

[0046] The OsSBF1 protein from Nipponbare rice in the following examples is shown in Sequence 1 of the sequence listing. The cDNA sequences encoding the OsSBF1 protein in Nipponbare rice are all shown in Sequence 2 of the sequence listing. (Genomic sequences are also shown.) OsSBF1 The nucleotide sequence of the gene is shown in Sequence 3.

[0047] The experimental methods in the following examples are as follows: 1. Plant DNA extraction Cut a 2 cm leaf and add 100 μL of TPS extraction solution (12.1 g / L Tris-HCl, 3.72 g / L EDTA, 74 g / L KCl, pH 8.0); add a 5 mm steel ball and shake at 30 rpm for 3 min in a tissue homogenizer; extract an appropriate amount of extract into a new PCR plate, add 4 volumes of ddH2O, mix well and set aside.

[0048] 2. PCR amplification The reaction system is as follows: 10 μL premixed mix, 0.6 μL 10 μM primer, appropriate amount of template, and ddH2O to make up to 20 μL.

[0049] The reaction procedure is as follows: 1. 95℃ for 3 min; 2. 95℃ for 30 s; 3. 50℃-60℃ for 30 s; 4. 72℃ for an appropriate time; 5. 72℃ for 10 min; 30-35 cycles are set for steps 2 to 4.

[0050] 3. Edge-cutting and edge-connecting method for carrier construction The reaction system is as follows: 100-200 ng of carrier PCR amplification of DNA 10-20 ng 1 μL of reaction buffer Bsa I( Eco31 I) 0.5 μL T4 ligase 2.5 μL ddH2O to bring the volume to 10 μL. Simultaneous cleavage and ligation reaction procedure: 37℃ for 5 min 20℃ for 5 min 10 cycles 37℃ for 5 min 4. Nucleic acid purification and recovery The following steps were performed using the OMEGA (USA) gel extraction kit: After nucleic acid electrophoresis, the gel containing the target band was cut using a gel cutter. An appropriate amount of Binding Buffer was added, and the gel was dissolved at 55°C. The completely dissolved gel solution was transferred to an adsorption column (placed in a collection tube) and centrifuged at 12000 rpm for 1 min. The filtrate was removed, and 300 μL of Binding Buffer was added. The column was centrifuged at 12000 rpm for 1 min, and the filtrate was removed. 500 μL of Wash Buffer was added, and the column was centrifuged at 12000 rpm for 1 min, and the filtrate was removed. This washing process was repeated once. The adsorption column was placed back into the collection tube and centrifuged at 12000 rpm for 2 min to completely remove any residual liquid. The adsorption column was then placed in a new EP tube, and approximately 50 μL of ddH2O was added. The column was centrifuged at 12000 rpm for 1 min, and the nucleic acid solution was collected.

[0051] 5. Transformation The constructed vector plasmid was transformed into DH5α competent cells, plated on LB medium with the corresponding resistance, and cultured at 37°C; the correctly sequenced strains were selected and stored for later use.

[0052] Example 1, Knockout OsSBF1 Preparation and phenotypic identification of transgenic rice I. Knockout OsSBF1 Preparation of genetically modified rice 1. Construction of the knockout vector pCRISPR-OsSBF1 choose OsSBF1 The following sequences are used as target sequences for the knockout vector: 5'-ATTGACCATTGCGTCCGCAC'-3 (target site, positions 274-293 of sequence 3) Synthesize single-stranded DNA molecule I (5'-GCAGGTCTCATGTGCGGACTCCGATCCATGCAAGTTTTAGAGCTAGAAATAGCAAGTT-3') and single-stranded DNA molecule II (5'-GCAGGTCTCTAAACTGCCACGGATCATCTGCA-3').

[0053] Using single-stranded DNA molecule I and single-stranded DNA molecule II as primers, a sample containing "sgRNA- U3 The promoter plasmid was used as a template to perform PCR amplification to obtain DNA molecules containing the target, and the DNA fragment was recovered and purified.

[0054] The amplified double-stranded DNA molecule (sequence 4) was ligated to the CRISPR / Cas vector BGK03 using a cleavage-ligation method. The ligation product was transformed into E. coli DH5α competent cells, and positive clones were obtained by screening with kanamycin-containing antibiotic plates.

[0055] The amplified double-stranded DNA molecules were ligated into the CRISPR / Cas vector BGK03 using a cleavage-while-ligating method. The ligation product was transformed into *E. coli* DH5α competent cells, and positive clones were obtained by screening with kanamycin-containing antibiotic plates. Recombinant plasmids were extracted from the positive clones and sequenced for verification. The correctly sequenced vector plasmid was named pCRISPR- OsSBF1 .

[0056] pCRISPR- OsSBF1 The vector is obtained by inserting the DNA molecule shown in sequence 4 between the BsaI restriction sites of vector BGK03.

[0057] In the DNA molecule shown in Sequence 4, positions 4-9 are... Bsa The I restriction site contains the target sequence (positions 15-34), the gRNA scaffold (positions 35-117), the regulatory sequence (positions 118-177), the rice U3 promoter (positions 178-559), and the enzyme cleavage site (positions 565-570). Bsa I. Enzyme cleavage site and its protective base.

[0058] 2. Obtaining genetically modified rice 1) The above pCRISPR- OsSBF1 Agrobacterium EHA105 was chemically transformed, and engineered bacteria with positive clones were obtained by screening on resistance plates containing kanamycin and rifampicin.

[0059] 2) Take the pCRISPR- obtained in step 1). OsSBF1 Recombinant Agrobacterium bacterial suspension was used to infect callus tissue of japonica rice Zhonghua 10 (ZH10, hereinafter also known as wild-type rice). The infected callus tissue was then washed 4-5 times with sterile water containing 300 mg / L cephalosporin, excess water was blotted dry with sterile filter paper, and then transferred to N6D2S1 medium for 2 weeks of incubation.

[0060] 3) After completing step 2), take the callus tissue, transfer it to N6D2S2 medium and culture it for 2 weeks, then transfer it to a new N6D2S2 medium and culture it for 2 weeks.

[0061] 4) After completing step 3), take the vigorously growing callus tissue, transfer it to differentiation medium A and culture for 7 days, then transfer it to differentiation medium B and culture until regenerated seedlings grow. Culture conditions: 12 hours light / 12 hours dark; light intensity of 8000 lux; temperature of 28℃ during light and 25℃ during darkness.

[0062] 5) After completing step 4), the regenerated seedlings are transferred to a rooting and seedling strengthening medium for cultivation. When the seedlings grow to about 10cm, the container sealing film is opened and the seedlings are hardened off for 2-3 days. Then the seedlings are transferred to an artificial climate chamber for cultivation to obtain T0 generation CRISPR knockout transgenic rice.

[0063] PCR identification was performed using primer F (5'-CCTGCCCTGCTCGCTCCATG-3') and primer R (5'-ACGCAGTTTGTGTTGACCAAG-3'). The PCR products were then sequenced and compared with those in wild-type rice NIP. OsSBF1 Compared to the sequence of gene (Sequence 3), a sense mutation occurs, which is recorded as a positive T0 generation CRISPR knockout transgenic rice.

[0064] Positive T0 generation CRISPR knockout transgenic rice was cultured until T2 generation CRISPR knockout transgenic rice homozygous plants were obtained.

[0065] 3. Identification of genetically modified rice 1) Identification of CRISPR knockout transgenic rice Among the homozygous T2 generation CRISPR knockout transgenic rice plants obtained in the ZH10 background as described above, the numbered […] was […]. KO1 and KO3 Genomic DNA was extracted from leaves of the plant and used as a template. PCR amplification of target sites was performed using primers "F+R," followed by sequencing identification. Wild-type rice ZH10 was used as a control.

[0066] F: 5'- CCTGCCCTGCTCCGCTCCATG -3'; R: 5'-ACGCAGTTTTGTGTTGACCAAG-3'; The sequencing results are as follows: Compared with wild-type rice ZH10 OsSBF1 Compared with the gene (sequence 3) sequence, it was found that KO1 Two homologous chromosomes OsSBF1 The region corresponding to the gene underwent the following changes: a 1 bp insertion at the target site (a T base was inserted before position 291 of sequence 3), leading to premature termination and encoding the first 84 amino acids ( Figure 1 A); Compared with wild-type rice ZH10OsSBF1 Compared with the gene (sequence 3) sequence, it was found that KO2 Two homologous chromosomes OsSBF1 The region corresponding to the gene underwent the following changes: a 1 bp insertion at the target site (an A base was inserted before position 291 of sequence 3), leading to premature termination and encoding the first 84 amino acids ( Figure 1 A); The above results indicate that KO1 and KO3 The positive CRISPR knockout transgenic rice is named CRISPR knockout. OsSBF1 Genetically modified rice.

[0067] II. CRISPR Knockout OsSBF1 Cold treatment of genetically modified rice A. Seedling cold tolerance test The parameters for alternating light and dark culture are as follows: light intensity is 120 μmol·m⁻¹. -2 ·s -1 The temperature is 28℃ / 25℃ (day / dark), and the photoperiod is 10 hours of light / 14 hours of darkness.

[0068] The rice seeds tested were homozygous T2 generation CRISPR knockout transgenic rice plants. KO1 and KO3 Wild-type rice ZH10.

[0069] The experiment was repeated three times and the average value was taken. The steps for each repetition were as follows: 1. Take 32 rice seeds to be tested, put them into kraft paper bags, and soak them in water at 28℃~30℃ for 48 hours.

[0070] 2. After completing step 1, germinate the seeds at 28℃~30℃ for 24 hours (keep the seeds moist during germination) to obtain germinated seeds.

[0071] 3. After completing step 2, take a 96-well plate, cut off part of the lower edge of each well, and then put one germinated seed into each well (embryo facing up, radicle facing down).

[0072] 4. After completing step 3, place the 96-well plate (containing the germinated seeds) on a plastic box containing Kimura B culture medium, immersing the germinated seeds in the Kimura B culture medium. Culture in alternating light and dark conditions for 3 weeks to obtain rice seedlings that have grown to the three-leaf stage. During the alternating light and dark culture period, the Kimura B culture medium should be replaced every 7 days.

[0073] 5. After completing step 4, place the 96-well plate (containing rice seedlings that have grown to the three-leaf stage) in a low-temperature water bath for treatment. The water bath temperature is 4℃ and the air temperature is 20℃. During treatment, the water level is 3 cm above the growth point, and the cold treatment time is about 72 hours.

[0074] 6. After completing step 5, put the 96-well plate (with rice seedlings on it) back into the artificial climate chamber for recovery culture. After 4 weeks of recovery, the survival rate of different lines is counted (the survival rate is the number of surviving seedlings divided by the total number of seedlings).

[0075] T2 generation CRISPR knockout OsSBF1 Genetically modified homozygous rice plants KO1 and KO3 Seedling cold resistance was assessed by cold treatment at 4℃ for 72 hours, followed by 4 weeks of normal recovery. Survival rates were then recorded, and knockout strains were identified. KO1 The survival rate was around 20%, while the survival rate of wild-type ZH11 was around 43%; knockout strains were discovered. KO2 The survival rate is around 22%, while the survival rate of wild-type ZH11 is around 48%. Figure 1 B). This indicates that in japonica rice ZH11... OsSBF1 After gene knockout, the seedlings' cold tolerance was significantly reduced.

[0076] B. Cold treatment identification during the booting stage of rice: The rice seeds tested were the aforementioned T2 generation CRISPR knockout rice seeds. OsSBF1 Genetically modified homozygous rice plants KO1 and KO3 Wild-type rice ZH10.

[0077] The experiment was conducted in Kunming, Yunnan Province. Seedlings were raised in late May, and the phenotypes of different strains during the booting period were observed in late September (16-20℃), and the seed setting rate was statistically analyzed.

[0078] 1. Select plump rice seeds and treat them at a constant temperature of 50℃ for two days to break seed dormancy.

[0079] 2. Soak the seeds in a kraft paper bag for two days until they sprout white, then proceed with germination.

[0080] 3. When the sprouts grow to 5 mm–10 mm, sow them in the soil and raise them for one month.

[0081] 4. Select seedlings with similar growth patterns and transplant them to the field to grow and receive natural low temperatures during the growth process.

[0082] 5. After the seeds mature, take 15 main ears from each line and first calculate the seed setting rate of each ear (seed setting rate = number of full grains per ear / total number of grains per ear * 100%). Then, randomly select no less than 5 ears and calculate the average seed setting rate as the seed setting rate of the line to be tested.

[0083] T2 generation CRISPR knockout OsSBF1 Cold resistance assessment of transgenic rice during the booting stage (phenotypic photos as shown) Figure 2 ), and by analyzing the seed setting rate, knockout strains were identified. KO1 The fruit set rate is around 34%, while the wild-type ZH10 has a fruit set rate of around 61%. Figure 2 This indicates that in japonica rice ZH11, [the following will be used / implemented]... OsSBF1 After gene knockout, the seed setting rate during the booting stage decreased.

[0084] The results above show that, under the ZH10 background of japonica rice, knockout OsSBF1 It can reduce the survival rate of rice seedlings and the grain filling rate during the booting stage.

[0085] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. Applications of protein OsSBF1 or related biological materials in the following A1) or A2): A1) Regulate plant cold resistance; A2) Cultivate cold-resistant plants; The protein OsSBF1 is either a1), a2), a3), or a4). a1) The amino acid sequence is that of the protein shown in sequence 1 of the sequence listing; a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in Sequence 1 of the sequence listing; a3) Proteins with the same biological function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in Sequence 1 of the sequence listing. a4) Proteins that have 80% or more identity with the amino acid sequence defined by sequence 1 in the sequence listing, are derived from plants, and have the same biological function.

2. The application according to claim 1, characterized in that: The protein OsSBF1-related biomaterials include nucleic acid molecules encoding the protein OsSBF1, expression cassettes or recombinant vectors or recombinant bacteria expressing the nucleic acid molecules; The nucleic acid molecule encoding the protein OsSBF1 is as follows: (b1) or (b2) or (b3) or (b4) b1) The nucleotide sequence is the DNA molecule shown in sequence 2 of the sequence listing; b2) The nucleotide sequence is the DNA molecule shown in sequence 3 of the sequence listing; b3) Having 90% or more identity with the nucleotide sequence defined in b1) or b2), being derived from a plant and encoding a DNA molecule of the protein OsSBF1 as described in claim 1; b4) Hybridizes under stringent conditions to the nucleotide sequence defined in b1) or b2) and encodes a DNA molecule that encodes the protein OsSBF1 of claim 1.

3. The use of a substance that inhibits the activity of the protein OsSBF1 of claim 1 or inhibits the expression of the nucleic acid molecule encoding the protein OsSBF1 of claim 1 in B1) or B2) below: B1) Reduces the cold resistance of plants; B2) Cultivate plants with low cold tolerance.

4. The application according to claim 3, characterized in that: The substance is a CRISPR system that inhibits the expression of nucleic acid molecules encoding the protein OsSBF1; The CRISPR system includes sgRNA targeting a nucleic acid molecule encoding the protein OsSBF1. The nucleotide sequence of the target site of the sgRNA is positions 274-293 of sequence listing 3.

5. A method for reducing the cold hardiness of plants, as shown in D1) or D2). The method described in D1) includes the following steps: reducing or inhibiting the content and / or activity of protein OsSBF1 in the target plant, thereby reducing the plant's cold resistance; The method described in D2) includes the following steps: reducing or inhibiting the expression of nucleic acid molecules encoding the protein OsSBF1 in the target plant, thereby reducing the plant's cold resistance; The target plant contains a nucleic acid molecule encoding the protein OsSBF1; The protein OsSBF1 is either a1), a2), a3), or a4). a1) The amino acid sequence is that of the protein shown in sequence 1 of the sequence listing; a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in Sequence 1 of the sequence listing; a3) Proteins with the same biological function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in Sequence 1 of the sequence listing. a4) Proteins that have 80% or more identity with the amino acid sequence defined by sequence 1 in the sequence listing, are derived from plants, and have the same biological function.

6. A method for cultivating plants with low cold tolerance, comprising the following steps: inhibiting or reducing the content and / or activity of the protein OsSBF1 described in claim 1 in the starting plant to obtain a transgenic plant, which is the target plant; The transgenic plant is less cold-resistant than the original plant.

7. A method for cultivating plants with low cold tolerance, comprising the following steps: inhibiting or reducing the expression of the nucleic acid molecule encoding the protein OsSBF1 in claim 1 in the starting plant to obtain a transgenic plant, which is the target plant; The transgenic plant is less cold-resistant than the original plant.

8. A method for cultivating plants with low cold tolerance, comprising the following steps: gene editing of the nucleic acid molecule encoding the protein OsSBF1 in claim 1 in the starting plant, causing premature termination of the translation of the protein OsSBF1, to obtain a transgenic plant, which is the target plant; The transgenic plant is less cold-resistant than the original plant.

9. The application according to any one of claims 1-4 or the method according to any one of claims 5-8, characterized in that: The cold resistance is reflected in the cold resistance during the seedling stage and / or the booting stage.

10. The application according to any one of claims 1-4 or the method according to any one of claims 5-8, characterized in that: The plant is a dicotyledonous plant or a monocotyledonous plant.

Images