Application of gibberellin-related genes in enhancing plant salt tolerance

Abstract

The present application relates to the technical field of plant molecular biology, and particularly relates to application of gibberellin related genes in enhancing plant salt tolerance. The present application provides gibberellin related genes with the function of enhancing plant salt tolerance, and the expression of the genes can effectively enhance the salt tolerance of plants; the present application also finds a new gene of gibberellin metabolism and signal transduction pathway, and provides a mutant of the protein coded by the gene, the mutant can enhance the salt tolerance of plants and will not have adverse effects on flowering and other traits. The present application provides new gene resources for breeding salt-tolerant plants, and has good application prospect in plant breeding such as rice.

Description

Technical Field

[0001] This invention relates to the field of plant molecular biology, and in particular to the application of gibberellin-related genes in enhancing plant salt tolerance. Background Technology

[0002] In recent years, soil salinization has become a global ecological problem. To reduce the impact of soil salinization on crop growth and production, cloning key genes controlling salt tolerance traits and cultivating new salt-tolerant crop germplasm are of great significance. Generally speaking, high and stable yields are important goals in crop breeding. However, due to the strong antagonistic relationship between crop yield traits and salt tolerance, achieving synergistic improvement of crop yield and stress resistance is a major challenge in breeding work. To break this negative correlation between high yield and stress resistance, breeders often need to create a large number of hybrid combinations and select from them favorable genetic recombination events with extremely low frequency of occurrence. This breeding improvement process is very slow and somewhat blind. With the rapid development of genomics and molecular biology, researchers can conduct more in-depth research on the genetic interactions between crop yield traits and salt tolerance traits at the molecular level, identify key genes regulating yield and stress resistance, and explore the genetic basis of their pleiotropic effects. Based on the results of these theoretical studies, precise genetic improvement of key node genes and their downstream signaling pathways can be carried out through efficient gene editing tools, thereby effectively promoting the molecular design and uncoupling of high-yield and stress-resistant traits in crops, and achieving synergistic improvement of high and stable crop yields.

[0003] Rice is an important food crop, and its salt tolerance is a quantitative trait controlled by multiple genes with minor effects. Its genetic basis is complex, making it difficult to improve salt tolerance using traditional breeding methods. Molecular design breeding technology can accelerate the development of new salt-tolerant rice varieties, which relies on the discovery of key salt-tolerant genes. Although many rice salt tolerance-related genes have been identified and cloned over the past few decades, and their salt tolerance mechanisms have been gradually elucidated, only a small number of genes have practical value. Therefore, it is necessary to further explore new superior salt-tolerant genes in rice, elucidate their molecular mechanisms and regulatory pathways, and lay the foundation for the breeding of new salt-tolerant rice varieties. In addition to discovering new salt-tolerant genes, there are other effective techniques for creating new salt-tolerant germplasm that can provide innovative salt-tolerant materials. For example, by analyzing the rich and numerous genotype variations in crop resources and performing association analysis, superior haplotypes can be obtained and used for subsequent molecular breeding. Furthermore, new superior gene loci can be obtained by designing and modifying the important amino acid motif sequences of known salt-tolerant genes or the important nucleotide cis-element sequences that regulate transcriptional expression in the promoter region. Summary of the Invention

[0004] This invention provides the application of gibberellin-related genes in enhancing plant salt tolerance.

[0005] This invention discovers that genes related to gibberellin (GA) synthesis and signal transduction in rice significantly enhance plant salt tolerance, thus providing applications for these genes in enhancing plant salt tolerance traits. These GA synthesis and signal transduction-related genes include the Green Revolution gene GA20ox2, the key regulator of the gibberellin signaling pathway SLR1, and the transcription factor IDS1, which regulates gibberellin synthesis and signal transduction. These genes can enhance plant salt tolerance by regulating and inhibiting gibberellin accumulation or weakening gibberellin signal transduction. Furthermore, this invention utilizes artificially designed superior mutations to create mutations in the key EAR motif of IDS1 protein transcriptional regulation, obtaining a new functional protein type, IDS1-EARmut. This mutant significantly enhances plant salt tolerance, and its genetic material exhibits excellent salt-alkali tolerance agronomic traits.

[0006] Specifically, the present invention provides the following technical solutions.

[0007] In a first aspect, the present invention provides the application of the rice GA20ox2 gene or its encoded protein or its repressor in regulating rice salt tolerance.

[0008] The GA20ox2 (LOC_Os01g66100) described in this invention is a rice green revolution gene, and its CDS nucleotide sequence is shown in SEQ ID NO.1; the amino acid sequence of the encoded protein is shown in SEQ ID NO.2. A repressor of the GA20ox2 gene or its encoded protein refers to a substance capable of downregulating the expression of the GA20ox2 gene or the activity of its encoded protein. These substances can be proteins, nucleic acid molecules (including DNA and RNA), compounds, or combinations thereof. Exemplary repressors include interfering RNA targeting the GA20ox2 gene.

[0009] In this invention, regulating rice salt tolerance includes enhancing or reducing rice salt tolerance.

[0010] Preferably, the above-described applications include enhancing the salt tolerance of rice by reducing the expression of the rice GA20ox2 gene and / or the activity of its encoded protein.

[0011] In some specific embodiments of the present invention, the application of reducing the expression of the rice GA20ox2 gene and / or the activity of its encoded protein is provided in enhancing the salt tolerance of rice.

[0012] In this invention, the method for reducing gene expression can be selected from one or more of the following: 1) mutating the nucleotide sequence of the gene; 2) regulating gene expression using weaker transcriptional and / or translational regulatory elements. Mutating the nucleotide sequence of the gene includes, but is not limited to, nucleotide sequence mutations caused by various physical and chemical methods, such as mutagenesis caused by mutagens, radiation-induced mutagenesis, mutations caused by RNAi gene silencing, or mutations caused by TALLEN and CRISPR / Cas9 technologies. For example, reducing gene expression can be achieved by knocking out the gene.

[0013] In this invention, protein activity can be reduced by mutating the amino acid sequence of the protein.

[0014] In a second aspect, the present invention provides any of the following applications of the plant SLR1 gene or its encoded protein or biological materials containing said SLR1 gene: (1) Application in regulating plant salt tolerance; (2) Application in constructing transgenic plants with enhanced salt tolerance; (3) Application in cultivating plant germplasm with enhanced salt tolerance.

[0015] In this invention, SLR1 is a core component of GA signal transduction in plants. The accession number for rice SLR1 is LOC_Os03g49990, the sequence of the rice SLR1 protein is shown in SEQ ID NO.3, and the CDS sequence is shown in SEQ ID NO.4. The accession number for wheat SLR1 (Rht1b) protein is TraesCS4B02G043100.

[0016] In this invention, the biological material includes any one or more selected from recombinant DNA, expression cassette, vector, host cell, plant tissue, and plant.

[0017] The expression cassette includes a promoter and the gene, wherein the promoter can be any promoter capable of initiating transcription in plants. For example, the expression cassette is constructed by using a 35S promoter or a self-promoting promoter (shown in SEQ ID NO. 6) to drive the transcription of the rice SLR1 gene.

[0018] The vectors include plasmid vectors or viral vectors. These vectors can be clonal vectors, expression vectors, or integration vectors.

[0019] The host cell includes microbial cells or plant cells, wherein the microorganism can be commonly used host microorganisms such as Escherichia coli and Agrobacterium.

[0020] In this invention, regulating plant salt tolerance includes enhancing or reducing plant salt tolerance.

[0021] Preferably, the above-described applications include enhancing the salt tolerance of plants by increasing the expression of the SLR1 gene and / or the activity of its encoded protein.

[0022] Alternatively, the application may include reducing the salt tolerance of plants by decreasing the expression of the SLR1 gene and / or the activity of its encoded protein.

[0023] In this invention, gene expression can be enhanced by one or more of the following methods: 1) mutating the nucleotide sequence of the gene; 2) increasing the copy number of the gene; 3) using stronger transcriptional and / or translational regulatory elements to regulate gene expression. Increasing the copy number of the gene can be achieved by introducing an overexpression vector carrying the gene, or by increasing the gene copy number on the chromosome. For example, enhancing gene expression is achieved by introducing an overexpression vector carrying the gene.

[0024] In this invention, protein activity can be improved by mutating the amino acid sequence of the protein.

[0025] Thirdly, the present invention provides any of the following applications of the rice IDS1 gene or its encoded protein or biological materials containing the IDS1 gene: (1) Application in promoting the accumulation of gibberellins in plants; (2) Application in inhibiting the degradation of plant gibberellins; (3) Application in promoting gibberellin signal transduction in plants; (4) Application in promoting plant growth; (5) Application in improving the height of plant plants; (6) Application in regulating plant salt tolerance.

[0026] This invention identifies a novel gene, IDS1 (LOC_Os03g60430), in rice to regulate gibberellin metabolism and signal transduction. IDS1 can amplify the gibberellin hormone effect by binding to the gibberellin degradation component EUI1 and the core component of gibberellin signal negative regulation, SLR1, thereby inhibiting its transcriptional level. The CDS sequence of the IDS1 gene described in this invention is shown in SEQ ID NO. 7, and the IDS1 protein sequence is shown in SEQ ID NO. 8.

[0027] Preferably, the above-described applications include: promoting gibberellin accumulation, inhibiting gibberellin degradation, promoting plant gibberellin signal transduction, promoting plant growth, and increasing plant height by increasing the expression of the rice IDS1 gene and / or the activity of its encoded protein.

[0028] Alternatively, the application may include reducing gibberellin accumulation and / or promoting gibberellin degradation and / or enhancing plant salt tolerance by decreasing the expression of the rice IDS1 gene and / or the activity of its encoded protein.

[0029] In this invention, the plant is a monocotyledonous plant, preferably a grass; more preferably rice or wheat.

[0030] Fourthly, the present invention provides a rice IDS1 protein mutant, which, compared with the wild-type rice IDS1 protein, contains a mutation in which DLDLDL at positions 289 to 294 is changed to AAAAAA.

[0031] Preferably, the rice IDS1 protein mutant has the amino acid sequence shown in SEQ ID NO.10.

[0032] This invention modifies key motif components in the IDS1 protein sequence through artificial molecular design, changing DLDLDL to AAAAAA, generating a new protein type that transforms transcriptional repression into transcriptional occupancy effect, providing new gene resources for the regulation of plant salt tolerance, GA synthesis, and signal transduction.

[0033] Fifthly, the present invention provides a nucleic acid molecule, which is a mutant of the rice IDS1 protein described above.

[0034] Based on the amino acid sequence of the rice IDS1 protein mutant provided above, those skilled in the art can obtain the nucleotide sequence of the nucleic acid molecule encoding the rice IDS1 protein mutant. Due to the degeneracy of codons, the nucleotide sequence encoding a nucleic acid molecule with a single amino acid sequence is not unique, and all nucleic acid molecules capable of encoding the above-mentioned rice IDS1 protein mutant are within the scope of protection of this invention.

[0035] In some specific embodiments of the present invention, the sequence of the nucleic acid molecule encoding the rice IDS1 protein mutant is shown in SEQ ID NO.9.

[0036] In a sixth aspect, the present invention provides a biological material comprising the nucleic acid molecules described above; the biological material is an expression cassette, a vector, or a host cell.

[0037] The aforementioned expression cassette can be obtained by linking a promoter or other transcriptional or translational regulatory element upstream of the nucleic acid molecule and / or a terminator or other transcriptional or translational regulatory element downstream of it.

[0038] The aforementioned vectors include, but are not limited to, plasmid vectors, bacteriophage vectors, and viral vectors.

[0039] The host cells mentioned above include microbial cells, plant cells, etc. The microbial cells can be bacteria or fungi; bacteria include, but are not limited to, *Escherichia coli* and *Agrobacterium*, and fungi include, but are not limited to, yeast. When the host cell is a plant cell, it is preferably a cell that cannot develop into a plant individual.

[0040] In a seventh aspect, the present invention provides any one of the following applications of the rice IDS1 protein mutant, the nucleic acid molecule, or the biological material described above: (1) Application in enhancing plant salt tolerance; (2) Application in constructing transgenic plants with enhanced salt tolerance; (3) Application in cultivating plant germplasm with enhanced salt tolerance.

[0041] Eighthly, the present invention provides a method for improving the salt tolerance of plants, the method comprising: reducing the expression level of the GA20ox2 gene and / or the activity of its encoded protein in the plant, or increasing the expression level of the SLR gene and / or the activity of its encoded protein in the plant, or increasing the expression level of the IDS1 gene and / or the activity of its encoded protein in the plant, or causing the plant to express a mutant of the IDS1 protein.

[0042] Preferably, the plant is a monocotyledonous plant, more preferably a grass; even more preferably, it is rice or wheat.

[0043] The beneficial effects of this invention include at least the following: This invention provides gibberellin-related genes that enhance plant salt tolerance; regulating the expression of these genes can effectively enhance plant salt tolerance. This invention also discovers a novel gene involved in gibberellin metabolism and signal transduction pathways, and provides a mutant of the protein encoded by this gene. This mutant enhances plant salt tolerance without adversely affecting traits such as flowering. This invention provides new gene resources for breeding salt-tolerant plants and has promising application prospects in plant breeding, such as rice. Attached Figure Description

[0044] To more clearly illustrate the technical solutions in this invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0045] Figure 1This invention provides an analysis of the salt tolerance of near-isogenic lines of the sd1 and SD1 genotypes in Indica rice 93-11 and Japonica rice NIP background in Example 1 of this invention. Specifically, A represents the statistical analysis of salt tolerance and survival rate of near-isogenic lines of the sd1 and SD1 genotypes in Indica rice variety 93-11 under salt concentration treatments of 70, 100, and 140 mM; B and C represent the statistical analysis of salt tolerance and survival rate of near-isogenic lines of the sd1 and SD1 genotypes in Japonica rice variety Nipponbare NIP and overexpression lines of IDS1 EARmut under a 140 mM salt concentration treatment, respectively.

[0046] Figure 2 The rice slr#1 knockout line and the wheat gain-of-function mutant NIL in Example 1 of this invention are examples of this invention. B1b / D1b Salt tolerance phenotypes of rice SLR1 overexpression lines; where A is the identification of salt tolerance phenotypes in rice SLR1 knockout mutants; B is the salt tolerance phenotypes of rice SLR1 overexpression and self-promoted SLR1; C is the salt tolerance phenotype of wheat gain-of-function mutant NIL. B1a / D1b Salt tolerance phenotype.

[0047] Figure 3 This is Example 2 of the present invention, which detects the salt-induced protein expression of SLR1 in different rice and wheat varieties. A and B are the detection of SLR1 protein accumulation levels in roots and leaves of two japonica rice varieties, DongJing (DJ) and NIP, and two indica rice varieties, 93-11 and HHZ, under salt treatment conditions. C and D are the changes in SLR1 protein accumulation levels in roots and leaves of wheat SLR1 Green Revolution genotype and non-Green Revolution genotype under salt treatment conditions.

[0048] Figure 4 In Example 3 of this invention, IDS1 inhibits GA degradation, amplifies GA signaling pathways, and promotes vegetative growth; wherein, A is that the GA4 content in the ids1-1 mutant is significantly lower than that in the control; B is the binding of IDS1 to EUI and SLR1 genomic DNA; C is the levels of EUI1 and SLR1 after sampling at different time points (0, 0.5, and 48h) during 48 hours of salt treatment. ids1-1 The mRNA accumulation in the mutant (vertical axis, relative expression level) was significantly higher than that in the control. The leftmost two graphs represent the detection results in leaves, and the rightmost two graphs represent the detection results in roots. In each graph, the leftmost three bars represent the detection results of DJ, and the rightmost three bars represent... ids1-1 The test results are as follows: D indicates that the plant height of ids1-1 is shorter than that of wild type, while the plant height of IDS1 overexpressing plants is taller than that of wild type; E indicates that the seedling development of ids1-1 is weaker than that of wild type, while the overexpressing plants have stronger growth than wild type.

[0049] Figure 5 Example 4 of this invention describes an artificially designed mutation of the IDS1 EAR motif to enhance rice salt tolerance; wherein, A is the artificially designed mutation sequence of the IDS1 protein EAR motif; and B is the salt tolerance phenotype analysis of the EAR mutation.

[0050] Figure 6 In Example 4 of this invention, the ids1-1 mutant with DJ background had a much higher rate of shriveled shells due to abnormal flower development, while the mutant with IDS1 EARmOE form had normal flower development. Detailed Implementation

[0051] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0052] In the following embodiments, the gene overexpression vector is pCambia1300 background, and gene knockout is performed using CRISPR-Cas9 technology; the engineered bacteria used in the plant transgenic process is Agrobacterium EHA105. The gene editing processes such as overexpression and knockout involved in the following embodiments can all be achieved using common plant genetic engineering techniques, and specific methods will not be elaborated upon in the embodiments.

[0053] Example 1: Analysis of Salt Tolerance Regulation by Green Revolution Genes in Rice and Wheat This invention first obtained background genetic materials of japonica and indica rice from two breeders, representing two gene types, SD1 and sd1, of the rice green revolution gene GA20ox2 (LOC_Os01g66100). The japonica background was Nipponbare NIP, and the indica background was 93-11. SD1 is the wild-type GA20ox2 gene, with the sequence shown in SEQ ID NO.1, while sd1 is a mutated, loss-of-function GA20ox2 gene. Using the above-mentioned two pairs of near-isogenic lines of the rice green revolution gene (named NIL),... NIPSD1 / NIL NIPsd1 NIL 93-11SD1 / NIL 93-11sd1 To conduct salt tolerance function identification of the rice green revolution gene GA20ox2 and discover better salt tolerance types.

[0054] Meanwhile, SLR1 (TraesCS4B02G043100, also known as DELLA), as a Green Revolution gene in wheat, has the Green Revolution genotype NIL. B1b / D1bThis is a gene type with an N-terminal deletion of SLR1, whose protein is less susceptible to degradation system regulation, thus maintaining a more stable protein level; comparing it with the wild-type NIL... B1a / D1a Salt tolerance comparative analysis was performed to identify superior salt tolerance genotypes, including the aforementioned NILs. B1b / D1b The protein sequence is shown in SEQ ID NO.5.

[0055] We collected the NIP background of Japonica rice Nipponbare, the near-isogenic lines of the Green Revolution gene sd1 and wild genotype SD1 of Indica rice 93-11, and the NIL of the Green Revolution gene DELLA in wheat. B1b / D1b and wild-type NIL B1a / D1a Seeds were used for salt tolerance identification and analysis during the seedling stage. Sixteen well-germinating rice seedlings were transplanted into 96-well hydroponic plates and cultured for one month until they reached the 3-leaf, 1-bud stage. Salt tolerance identification tests were conducted at NaCl concentrations of 0 mM, 70 mM, 100 mM, and 140 mM, generally for 7-14 days. Rehydration was then initiated, and approximately 7 days after rehydration, once new leaves emerged, data such as survival rate and above-ground fresh weight were collected, and phenotypic photographs were taken. Wheat hydroponics required oxygen supply, and salt tolerance identification tests were conducted at NaCl concentrations of 0 mM, 50 mM, 100 mM, and 200 mM.

[0056] The results showed that for the Green Revolution gene, sd1 (in both japonica and indica rice backgrounds) Figure 1 ), or the wheat green revolution gene DELLA NIL B1b / D1b ( Figure 2 The salt tolerance of the C) was significantly enhanced compared to the wild type, indicating that the loss of function of the green revolution gene GA20ox2 in rice can significantly enhance salt tolerance, and the overexpression of the green revolution gene DELLA (i.e. SLR1) in wheat can also significantly enhance salt tolerance.

[0057] The rice DELLA gene (i.e., SLR1) was knocked out and overexpressed. The sgRNA used to knock out the SLR1 gene using CRISPR / Cas technology was AAAACTTTGCGATCACGCCG. The CDS amplification primers for SLR1 used in the overexpression construction were atgaagcgcgagtaccaagaag, cgccgcggcgacgcgccatg. The amplification primers for the SLR1 promoter used were AAGCTTGCATGCCTGCAGTCAAGGAGGCCTAACAAGATTTCC, CCCATCCCCATGGCCATGATCTCGCCTCCCCCAAA.

[0058] The results showed that the rice SLR1 gene knockout mutant ( slr1#1The salt tolerance of ) is significantly reduced ( Figure 2 The salt tolerance of rice strains overexpressing SLR1 (35S::SLR1) and strains driven by their own strong promoter (shown in SEQ ID NO. 6) (pSLR1::SLR1) was significantly enhanced. Figure 2 B).

[0059] Example 2: Detection of Salt-Induced Accumulation of Green Revolution Gene Proteins Following the method in Example 1, japonica rice DJ and NIP, indica rice HZZ and 93-11, and wheat NIL were used. B1b / D1b NIL B1a / D1a Plants were grown to a suitable leaf age and then treated with salt. Roots and leaves were collected at 0 h, 1 h, 2 h, 4 h, 8 h, and 12 h after treatment, and total protein was extracted. The differences in DELLA protein accumulation were detected using an SLR1 antibody. The results showed that for the above-mentioned plants, SLR1 protein expression in both root and leaf tissues was always induced and increased by salt treatment. Figure 3 ).

[0060] Example 3: Discovering a new gene IDS1 that regulates GA synthesis and signal transduction. By detecting the levels of active GA hormone in the background IDS1 loss-of-function mutant material ids1-1 (premature termination of IDS1 gene transcription) and the wild-type material DJ of the rice variety DJ, it was found that the ids1 mutation severely interferes with the synthesis of active GA4. Figure 4 (A). By examining IDS1-overexpressing plants (IDS1-OE) and ids1-1 mutants, it was found that the plant height of IDS1-overexpressing plants was greater than that of wild-type plants, while the plant height of mutants was shorter than that of wild-type plants. Figure 4 (of D), at the same time, ids1-1 Seedling development was weaker than wild type, and overexpressing plants (IDS1-OE) grew stronger than wild type. Figure 4 (E). And ids1-1 In the mutant, the mRNA accumulation levels of both the EUI1 gene, which degrades GA, and SLR1, a core component negatively regulating GA signaling, were significantly increased. Figure 4 (C). Simultaneously, ChIP-seq omics sequencing revealed that IDS1 can bind to the promoters of EUI1 and SLR1 (C). Figure 4 (B). Based on the above results, this invention has discovered a novel dual regulator of GA synthesis and signal transduction, IDS1.

[0061] Example 4: Design of the mutant protein IDS1 EARmut and salt tolerance analysis. Rice IDS1 is a transcriptional repressor. Amino acid sequence analysis revealed an important motif in IDS1, the EAR motif, characterized by the DLDLDL pattern. It was hypothesized that altering this motif could change the properties of IDS1. Therefore, this invention designed a non-repressive sequence, AAAAAA, to replace DLDLDL. Figure 5 The novel protein obtained (mutated IDS1) is called IDS1 EARmut. The primers used for the above mutation are CCGCgcATCCgcATCAgcATCGCCATCAACAAT and gcTGATgcGGATgcGCGGATTTCGCAACCTAATG. The mutated IDS1 was constructed into an overexpression vector and overexpressed in NIP to obtain the overexpression line (EARm-OE). After salt treatment during the seedling stage, its salt tolerance was found to be significantly higher than the control and higher than that of the ids1 mutant. Figure 5 (B). Furthermore, flower development was unaffected in the overexpression line EARm-OE, while the ids1 mutant, although exhibiting enhanced salt tolerance, suffered from defective flower development, leading to reduced yield per plant. Figure 6 Therefore, the IDS1 EARmut constructed in this invention is a novel genotype superior to the ids1 knockout mutant.

[0062] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. Application of the rice GA20ox2 gene or its encoded protein or its repressor in regulating rice salt tolerance.

2. The application according to claim 1, characterized in that, The applications include enhancing the salt tolerance of rice by reducing the expression of the GA20ox2 gene and / or the activity of its encoded protein.

3. Any of the following applications of the plant SLR1 gene or its encoded protein, or of biological material containing said SLR1 gene: (1) Application in regulating plant salt tolerance; (2) Application in constructing transgenic plants with enhanced salt tolerance; (3) Application in cultivating plant germplasm with enhanced salt tolerance.

4. The application according to claim 3, characterized in that, The applications include enhancing the salt tolerance of plants by increasing the expression of the SLR1 gene and / or the activity of its encoded protein.

5. Any of the following applications of the rice IDS1 gene or its encoded protein, or of biological materials containing the IDS1 gene: (1) Application in promoting the accumulation of gibberellins in plants; (2) Application in inhibiting the degradation of plant gibberellins; (3) Application in promoting gibberellin signal transduction in plants; (4) Application in promoting plant growth; (5) Application in improving the height of plant plants; (6) Application in regulating plant salt tolerance.

6. The application according to any one of claims 3 to 5, characterized in that, The plant is a monocotyledonous plant, preferably a grass; more preferably rice or wheat.

7. A rice IDS1 protein mutant, characterized in that, Compared with the wild-type rice IDS1 protein, the mutant contains a mutation where the DLDLDL mutation at positions 289 to 294 is changed to AAAAAA. Preferably, the rice IDS1 protein mutant has the amino acid sequence shown in SEQ ID NO.

10.

8. A nucleic acid molecule, characterized in that, The nucleic acid molecule encodes the rice IDS1 protein mutant of claim 7.

9. A biomaterial, characterized in that, The biomaterial comprises the nucleic acid molecule of claim 8; the biomaterial is an expression cassette, vector, or host cell.

10. Any of the following applications of the rice IDS1 protein mutant of claim 7, the nucleic acid molecule of claim 8, or the biomaterial of claim 9: (1) Application in enhancing plant salt tolerance; (2) Application in constructing transgenic plants with enhanced salt tolerance; (3) Application in cultivating plant germplasm with enhanced salt tolerance.

Images