CRISPR / cas14a1 system based on double closed modification and its application in pancreatic cancer mutant gene detection
By modifying the CRISPR/Cas14a1 system and combining it with dual blocking of BLK-DNA and BLK-RNA, and utilizing the four-strand substitution reaction and the trans-cleavage activity of Cas14a1, the problem of detecting low-abundance KRAS-G12D mutations in early pancreatic cancer screening was solved, achieving high sensitivity and specificity in detection.
Patent Information
- Application Number
- CN202610305807.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-13
- Publication Date
- 2026-06-23
AI Technical Summary
Existing methods for early pancreatic cancer screening lack sensitivity and specificity when detecting low-abundance KRAS-G12D mutations in peripheral blood, and are also costly, making it difficult to meet the needs of large-scale screening.
The CRISPR/Cas14a1 system, based on a double-blocking modification, utilizes BLK-DNA, BLK-RNA, sgRNA, activator, Cas14a1 protein, and FAM-modified ssDNA probes. By leveraging the four-strand substitution reaction and the trans-cleavage activity of Cas14a1, the thermodynamic differences of single-base mismatches are significantly amplified, achieving high sensitivity and specificity for detection.
It significantly improves the detection capability for low-abundance KRAS-G12D mutations, possesses extremely high sensitivity and specificity, is suitable for early screening of pancreatic cancer, and has extremely low signature.
Smart Images

Figure CN122256483A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of gene mutation detection technology, and particularly relates to a CRISPR / Cas14a1 system based on double-closed modification and its application in pancreatic cancer mutation gene detection. Background Technology
[0002] Pancreatic cancer is a highly lethal malignant tumor of the digestive system with insidious onset, rapid progression, and extremely low early diagnosis rate, with a 5-year survival rate of less than 10%. Due to its insidious onset, most patients are diagnosed at a stage of local progression or distant metastasis, thus losing the opportunity for surgery. Therefore, early diagnosis of pancreatic cancer is crucial for improving surgical resection rates and prolonging patient survival. The KRAS-G12D mutation has an extremely high incidence in pancreatic ductal adenocarcinoma and is one of the most common and critical driving events in the development and progression of pancreatic cancer. This mutation is not only closely related to the early occurrence of pancreatic cancer but also significantly associated with tumor progression, invasion and metastasis, and patient prognosis, making it a key molecular marker for assessing disease malignancy and guiding precision clinical treatment.
[0003] In the early stages of disease, non-invasive testing and screening can be performed by detecting cell-free DNA mutations in the patient's peripheral blood. Currently, liquid biopsy of peripheral blood is used for early screening of pancreatic cancer in the general population. However, the mutation abundance of ctDNA in the peripheral blood of pancreatic cancer patients is usually extremely low (MT < 1%), which places extremely high demands on the sensitivity and specificity of detection methods. Currently, the mainstream methods for detecting single-base mutations include high-throughput sequencing, qPCR / ddPCR, and DNA probe technology. High-throughput sequencing can detect multi-gene whole-exon mutations in parallel, but it is expensive and the subsequent analysis is complex; although PCR systems have extremely high sensitivity, they suffer from high sequencing costs and demanding operational requirements; while DNA probe technology is less expensive, its sensitivity is not high, with a detection limit of only 10%-20%. Therefore, in the field of liquid biopsy currently used in actual clinical applications, there is an urgent need for a single-base mutation detection technology that combines high sensitivity and specificity, capable of detecting KRAS-G12D mutations in peripheral blood ctDNA with low abundance, and with the advantage of low cost, suitable for large-scale early screening of pancreatic cancer.
[0004] The discovered CRISPR / Cas family includes Cas9, Cas12, Cas13, and Cas14a1. Among them, Cas14a1, as a newly discovered member, possesses advantages over Cas12 and others, such as compact size (approximately half the size of other proteins), no need for a pre-spacer adjacent motif (PAM) when recognizing single-stranded DNA (ssDNA), and high target specificity, making it a powerful molecular detection tool. In our work, we fully utilize the highly specific recognition capability of the Cas14a1 protein and combine it with a double-closed four-strand substitution reaction, thus significantly enhancing the thermodynamic differences caused by single-base mismatches. This gives our method extremely high specificity. Simultaneously, thanks to its trans-cleavage activity, Cas14a1 exhibits significant signal amplification, thereby granting our method extremely high sensitivity.
[0005] In summary, there is a need for a pancreatic cancer early screening method that combines high sensitivity and specificity, capable of detecting low abundance of KRAS-G12D gene mutations in the peripheral tissues of pancreatic cancer patients, thus making it suitable for early screening of pancreatic cancer. Summary of the Invention
[0006] The purpose of this invention is to provide a CRISPR / Cas14a1 system based on dual-blocking modification and its application in pancreatic cancer mutation gene detection, thereby achieving early pancreatic cancer screening with both high sensitivity and specificity.
[0007] To achieve the above objectives, this application adopts the following technical solution: In a first aspect, the present invention provides a CRISPR / Cas14a1 system based on dual-blocking modification, characterized in that it comprises BLK-DNA, BLK-RNA, sgRNA, activator, Cas14a1 protein, FAM and BHQ modified ssDNA probes, NEBuffer 2.1 and ultrapure water; The activator is a short-chain ssDNA target prepared from a gene template by asymmetric PCR; The activator, BLK-DNA, sgRNA, and BLK-RNA are subjected to a temperature annealing procedure to form an sgRNA-BLKRNA complex and an activator-BLKDNA complex. The two complexes undergo a four-strand displacement reaction based on toehold, thereby binding BLKDNA and BLKRNA, and binding the activator to sgRNA, activating the trans-cleavage activity of the Cas14a1 protein. The Cas14a1 protein indiscriminately cleaves the ssDNA probe.
[0008] In the above technical solution, the heating and annealing process is 10 minutes at 85°C, 5 minutes at 55°C, and 5 minutes at 37°C.
[0009] In the above technical solution, the reaction system of asymmetric PCR includes 10 μL of forward primer, 1 μL of reverse primer, 1 μL of genomic DNA template and 12 μL of 2×Phanta Max Buffer. The PCR program is: 95℃ for 10s, 55℃ for 20s, 72℃ for 10s, for a total of 40 cycles.
[0010] In the above technical solutions, all bases of BLK-DNA bind to some bases of MT or WT, and all bases of BLK-RNA bind to some bases of sgRNA.
[0011] In the above technical solutions, BLK-RNA and sgRNA are perfectly matched, BLK-DNA is perfectly matched with WT, while BLK-DNA and MT have a one-base mismatch.
[0012] Secondly, the present invention provides the application of the above-mentioned CRISPR / Cas14a1 system in the preparation of a pancreatic cancer mutation gene detection kit.
[0013] In the above technical solution, the mutant gene site is KRAS-G12D, and the DNA primers used for asymmetric PCR include the forward primer with nucleotide sequence as shown in SEQ ID NO. 1 and the reverse primer with nucleotide sequence as shown in SEQ ID NO. 2.
[0014] In the above technical solutions, the nucleotide sequence of the BLK-DNA is shown in SEQ ID NO. 3, the nucleotide sequence of the BLK-RNA is shown in SEQ ID NO. 4, and the nucleotide sequence of the sgRNA is shown in SEQ ID NO. 9.
[0015] Thirdly, the present invention provides a pancreatic cancer mutation gene detection kit, including the above-mentioned CRISPR / Cas14a1 system.
[0016] Fourthly, the present invention provides the application of the above-mentioned detection kit in the preparation of pancreatic cancer mutation gene detection reagents.
[0017] This invention employs a DNA blocking agent (BLK-DNA) and an RNA blocking agent (BLK-RNA) to perform a double-blocking modification on the sgRNA and activators (WT and MT) of Cas14a1. All bases of BLKDNA bind to a portion of the bases of MT or WT, and all bases of BLK-RNA bind to a portion of the bases of sgRNA. Specifically, BLK-RNA and sgRNA are perfectly matched, BLK-DNA is perfectly matched to WT, while BLK-DNA and MT exhibit a one-base mismatch. After the double blocking is formed, the BLKDNA-activator complex and the BLKRNA-sgRNA complex undergo a toehold-dependent four-strand displacement reaction. After the reaction, BLK-DNA binds to BLK-RNA, while the activator binds to sgRNA. Because BLK-DNA and MT have a single-base mismatch, while BLK-RNA and sgRNA are perfectly matched, and MT and sgRNA are also perfectly matched, a single-base mismatch exists before and after the reaction, allowing the reaction to proceed in the forward direction. However, because BLK-DNA and WT, BL-KRNA and sgRNA are perfectly matched, while WT and sgRNA have a single-base mismatch, there is no base mismatch before the reaction, but a two-base mismatch exists after the reaction, making it difficult for the reaction to proceed in the forward direction. Therefore, the double-closed four-stranded substitution reaction of this invention significantly amplifies the thermodynamic differences caused by single-base mutations, thus enabling the identification of low-abundance gene mutations in a high-interference background.
[0018] The beneficial effects of this invention are as follows: Based on a double-blocking modified CRISPR / Cas14a1 system, this invention significantly increases the thermodynamic differences caused by single-base mismatches in gene mutations, solving the problem of insufficient discrimination ability of the CRISPR / Cas system for single-base mismatches in traditional methods. Therefore, the system of this invention has extremely high discrimination ability and specificity. Simultaneously, relying on the strong trans-cleavage ability of the Cas14a1 protein, the system of this invention has the ability to detect gene mutations from low-abundance peripheral blood ctDNA, exhibiting extremely high sensitivity. Attached Figure Description
[0019] The specific embodiments of the present invention will be described in detail below with reference to the accompanying drawings. It should be noted that the accompanying drawings are merely schematic illustrations, used to help illustrate the technical solutions and preferred embodiments of the present invention, and do not constitute a limitation on the scope of protection of the technical solutions of the present invention. Within the scope defined by the claims of the present invention, any equivalent transformations or modifications based on the principles of the present invention should be considered to fall within the protection scope of the present invention.
[0020] Figure 1 Schematic diagram of a CRISPR / Cas14a1 system modified for double mismatch.
[0021] Figure 2A schematic diagram illustrating the direct recognition of WT and MT by Cas14a1.
[0022] Figure 3 This is a schematic diagram of a single-layer closed BLKDNA system.
[0023] Figure 4 This is a schematic diagram of a single-layer closed BLKRNA system.
[0024] Figure 5 Experimental diagram for testing the MT capability of a CRISPR / Cas14a1 system modified with double mismatch under unoptimized conditions.
[0025] Figure 6 Experimental diagram showing the direct recognition of WT and MT by Cas14a1 to explore the optimal single-base mismatch site.
[0026] Figure 7 Figure 1 shows the experimental results for optimizing the discrimination of the BLKDNA system.
[0027] Figure 8 Figure 1 shows the experimental results for optimizing the discrimination of the BLKRNA system.
[0028] Figure 9 Figure 1 shows the experimental optimization of different BLK-DNA and BLK-RNA lengths in the CRISPR / Cas14a1 system with double mismatch modification.
[0029] Figure 10 The figure shows the detection limit of the CRISPR / Cas14a1 system modified with double mismatch, with mutation abundance ranging from 100% to 0.1%.
[0030] Figure 11 The figure shows the detection limit of the mismatch-modified CRISPR / Cas14a1 system, with mutation abundance ranging from 0.05% to 0.0002%. Detailed Implementation
[0031] To better illustrate the objectives, technical solutions, and advantages of this invention, the invention will be further described below in conjunction with specific embodiments. This invention can be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the inventive concept to those skilled in the art. This invention will be defined only by the claims.
[0032] Unless otherwise specified, the test methods or experimental methods described in the following examples are conventional methods; unless otherwise specified, the reagents and materials are obtained from conventional commercial sources or prepared by conventional methods.
[0033] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0034] This invention provides a CRISPR / Cas14a1 system based on dual-blocking modification, comprising BLK-DNA, BLK-RNA, sgRNA, activator (MT or WT), Cas14a1 protein, FAM and BHQ modified ssDNA probes, NEBuffer 2.1 and ultrapure water.
[0035] The activator was a short-chain ssDNA target prepared from the gene template via asymmetric PCR. The asymmetric PCR reaction system consisted of 10 μL of forward primer (5 μM), 1 μL of reverse primer (5 μM), 1 μL of genomic DNA template (200 ng / μL), and 12 μL of 2×PhantaMax Buffer. The PCR program was: 95℃ for 10 s, 55℃ for 20 s, 72℃ for 10 s, for a total of 40 cycles.
[0036] All bases of BLK-DNA bind to a portion of the bases of MT or WT, and all bases of BLK-RNA bind to a portion of the bases of sgRNA. Specifically, BLK-RNA and sgRNA are perfectly matched, BLK-DNA and WT are perfectly matched, while BLK-DNA and MT have a one-base mismatch.
[0037] The activator, BLK-DNA, sgRNA, and BLK-RNA were subjected to a temperature annealing program (85°C for 10 min, 55°C for 5 min, and 37°C for 5 min) to form an sgRNA-BLKRNA complex and an activator-BLKDNA complex. The two complexes underwent a four-strand displacement reaction via toehold, thereby binding BLKDNA and BLKRNA and binding the activator to sgRNA, activating the trans-cleavage activity of the Cas14a1 protein. The Cas14a1 protein indiscriminately cleaved the ssDNA probe.
[0038] Experimental process 1. Construct a system for Cas14a1 to directly recognize WT and MT, and determine the optimal recognition site for single base mismatches. First, thermodynamic calculations are performed, and the reaction equation is as follows: SgRNA + MT SgRNA-MT ΔG1=-34.54 kcal / mol (1) SgRNA + WT SgRNA-WT ΔG2=-32.21 kcal / mol (2) Thermodynamic calculations revealed that the traditional method of Cas14a1 directly recognizing MT and WT is difficult to distinguish the thermodynamic differences caused by single-base mismatches. The thermodynamic differences caused by single-site mismatches are small (ΔG2-ΔG1=2.33 kcal / mol), and both MT and WT tend to bind to SgRNA (ΔG1<ΔG2<<0).
[0039] Single-base mismatches were added to each site in the spacer region (24 nt long) of the sgRNA to explore the single-base mismatch sites with the best recognition and discrimination ability of Cas14a1 under the traditional method.
[0040] 2. Constructing a DNA-blocked BLK-DNA system and an RNA-blocked BLK-RNA system. Both the BLKDNA and BLKRNA systems consist of single-layer blocking. The BLKDNA system includes BLK-DNA, an activator, and sgRNA; the BLKRNA system includes BLK-RNA, sgRNA, and an activator. Based on this, the ability of the single-layer blocked BLKDNA system and BLKRNA to detect gene mutations was investigated, as well as the optimal lengths of BLK-RNA and BLK-DNA were explored.
[0041] First, thermodynamic calculations were performed, and the reaction equations are as follows: BLKRNA system: SgRNA-BLKRNA + MT SgRNA-MT + BLKRNA ΔG3=-9.23 kcal / mol (3) SgRNA-BLKRNA + WT SgRNA-WT + BLKRNA ΔG4=-6.9 kcal / mol (4) BLKDNA system: MT-BLKDNA + SgRNA MT-SgRNA + BLKDNA ΔG5=-10.32 kcal / mol (5) WT-BLKDNA + SgRNA WT-SgRNA + BLKDNA ΔG6=-3.13 kcal / mol (6) For the BLKRNA system, thermodynamic calculations revealed that the thermodynamic migration of the reaction system after adding blocking RNA showed ΔG1 < ΔG2 << ΔG3 < ΔG4 < 0, with ΔG4 being closest to 0. This indicates that the affinity of both MT and WT for binding to SgRNA decreased, with WT showing a greater decrease. This contributes to improving the discrimination ability of the BLKRNA system.
[0042] For the BLKDNA system, thermodynamic calculations show that after adding blocking DNA, ΔG1 < ΔG2 << ΔG5 << ΔG6 < 0. While this causes a thermodynamic shift in the reactions of MT and WT, it also amplifies their thermodynamic difference (ΔG6 - ΔG5 = 7.19 kcal / mol). This helps the BLKDNA system to better distinguish between MT and WT.
[0043] This study aims to verify that the single-blocked BLKDNA and BLKRNA system can improve the ability to distinguish between WT and MT, while systematically exploring different BLK-DNA and BLK-RNA lengths to determine the optimal BLK-DNA and BLK-RNA lengths, thus exploring the best conditions for the double-blocked CRISPR / Cas14a1 system.
[0044] 3. A dual-encapsulation CRISPR / Cas14a1 system was constructed. The system comprises BLK-DNA, BLK-RNA, sgRNA, and an activator (MT or WT). First, the activator and BLK-DNA, sgRNA and BLK-RNA are subjected to a temperature annealing program (85°C for 10 min, 55°C for 5 min, 37°C for 5 min), thereby forming an sgRNA-BLKRNA complex and an activator-BLKDNA complex. The two blocked double-stranded DNA complexes undergo a four-strand displacement reaction via toehold, thereby binding BLKDNA and BLKRNA, and the activator binds to sgRNA, activating the trans-cleavage activity of Cas14a1.
[0045] Thermodynamic calculations were performed on the doubly enclosed CRISPR / Cas14a1 system to verify its ability to amplify the thermodynamic differences of single-base mismatches. The reaction equation is as follows: SgRNA-BLKRNA + MT-BLKDNA SgRNA-MT + BLKRNA-BLK-DNA ΔG7=-6.56kcal / mol (7) SgRNA-BLKRNA + WT-BLKDNA SgRNA-WT + BLKRNA-BLK-DNA ΔG8=0.63 kcal / mol (8) Thermodynamic calculations reveal that ΔG1 < ΔG2 << ΔG7 < 0 < ΔG8. Since ΔG8 in the WT reaction group is greater than 0, the reaction theoretically cannot occur. However, ΔG7 in the MT reaction group is less than 0, allowing the reaction to proceed. Furthermore, the thermodynamic difference between the MT and WT reactions is 7.19 kcal / mol, significantly greater than the differences observed by other methods. Therefore, the double-sealed CRISPR / Cas14a1 system significantly enhances its ability to distinguish single-base mismatches.
[0046] 4. Use the reporter to report the trans-cleavage activity of Cas14a1. When Cas14a1 is activated to perform indiscriminate trans-cleavage of surrounding nucleic acids, the ssDNA probe, which is double-labeled with FAM (fluorescent group) and BHQ (quencher group), is split in two. The FAM loses the spatial quenching effect of BHQ, thus emitting a detectable fluorescent signal.
[0047] The specific DNA and RNA sequences used in this embodiment are designed based on the KRAS-G12D mutation site, and the specific sequences are shown below (from the 5' end to the 3' end): Forward primer: TACCACAAGTTTATAT (SEQ ID NO. 1) Reverse primer: TCAAGGCACTCTTGC (SEQ ID NO. 2) sgRNA-spacer region:UGCCUACGCCAUCAGCUCCAACUA (SEQ ID NO. 5) sgRNA:CAAAUACGACGUGUCAACGGUAAUACGACUCACUAUAGGGCUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGUGGGCUGCUUGCAUCAGCCUA AUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAACAAAUUCAUUUUUCCUCCAAUUCUGCACAAGAAAGUUGCAGAACCCGAAUAGACGAAUGAAGGAAUGCAACUGCCUACGCCAUCCAGCUCCAACUA (SEQ ID NO. 9) WT (PCR product): TAGTTGGAGCTGGTGGCGTAGGCA (SEQ ID NO. 6) MT (PCR product): TAGTTGGAGCTGATGGCGTAGGCA (SEQ ID NO. 7) BLK-DNA: CGCCACCAGCTC (SEQ ID NO. 3) BLK-RNA:GGAGCUGAUGGCGU (SEQ ID NO. 4) ssDNA probe: FAM-TTTTTTTTTTT-BHQ (SEQ ID NO. 8) (The bolded underlined positions are single-base mutation sites) like Figure 1 As shown, the double-blocked CRISPR / Cas14a1 system comprises a double-blocking complex-mediated four-strand displacement reaction and a signal amplification mediated by CRISPR / Cas14a1 trans-cleavage activity. First, single-stranded DNA activators (including MT and WT) were prepared from the gene template via asymmetric PCR. This reaction system included 10 μL of forward primer (5 μM), 1 μL of reverse primer (5 μM), 1 μL of genomic DNA template (200 ng / μL), and 12 μL of 2×PhantaMax Buffer. The PCR program was: 95°C for 10 s, 55°C for 20 s, and 72°C for 10 s, for a total of 40 cycles. Next, the activators and BLK-DNA, sgRNA, and BLK-RNA complexes were subjected to a temperature ramp-annealing program (85°C for 10 min, 55°C for 5 min, and 37°C for 5 min) to form the sgRNA-BLKRNA complex and the activator-BLKDNA complex. All bases of BLKDNA bind to partial bases of MT or WT, and all bases of BLKRNA bind to partial bases of sgRNA. BLKRNA and sgRNA are perfectly matched, BLKDNA and WT are perfectly matched, while BLKDNA and MT have a one-base mismatch. After double blocking is formed, the BLKDNA-activator complex and the BLKRNA-sgRNA complex undergo a toehold-dependent four-strand displacement reaction. After the reaction, BLKDNA binds to BLKRNA, and the activator binds to sgRNA. Therefore, the trans-cleavage activity of Cas14a1 is activated, thereby indiscriminately cleaving surrounding single-stranded DNA reporters and generating a detectable fluorescent signal. The feasibility of the double-blocked CRISPR / Cas14a1 system was preliminarily verified under unoptimized conditions. Figure 5As shown, the inputs of WT and MT can produce significant differences in fluorescence signals, but the discrimination factor (DF) is only 11.9, which requires further experimental optimization.
[0048] The double-blocked CRISPR / Cas14a1 system relies on finely tuned thermodynamic differences, requiring meticulous experimental optimization. Optimization conditions for the double-blocked CRISPR / Cas14a1 system include single-base mismatch sites, BLK-DNA length, and BLK-RNA length. Therefore, we constructed systems for Cas14a1 direct recognition of MT, BLKDNA systems, and BLKRNA systems to explore the optimal conditions for the double-blocked CRISPR / Cas14a1 system. Figure 2 As shown, we investigated the distinguishing effect of different mismatch sites in the spacer region (24 nt long) of sgRNA on MT and WT. Figure 6 As shown in the results, experiments revealed that CRISPR / Cas14a exhibits relatively low specificity in recognizing single-base mismatches. However, overall, the best discriminative power was observed when the mismatch site was located at 8 nt, 12 nt, 13 nt, 14 nt, and 16 nt. Among these, CRISPR / Cas14a1 demonstrated the highest discriminative power when the mismatch site was located at 13 nt.
[0049] like Figure 3 As shown, a single-stranded BLKDNA system was constructed next. The BLKDNA system includes BLK-DNA, an activator, and sgRNA. BLK-DNA forms a double-stranded DNA complex with the activator and contains a toehold of a certain length that binds to sgRNA. MT exhibits a single-base mismatch with BLK-DNA but a perfect match with sgRNA; while WT has some bases that perfectly match all bases of BLK-DNA but a single-base mismatch with sgRNA. Therefore, MT is more likely to undergo strand substitution, while WT is more likely to form a stable double-stranded complex with BLK-DNA. With this design, it is possible to investigate the BLK-DNA length that has the greatest ability to distinguish between MT and WT. Figure 7 As shown, the study explored the maximum discriminative power that could be achieved with different combinations of single-base mismatch sites and BLK-DNA lengths. The results showed that the BLKDNA system had the highest discriminative power when the mismatch site was located at 13 nt and the BLK-DNA length was 18 nt.
[0050] like Figure 4As shown, a single-stranded BLKRNA system was constructed next. The BLKRNA system includes BLK-RNA, an activator, and sgRNA. BLK-RNA and sgRNA form a double-stranded RNA complex, containing a toehold of a certain length that binds to the activator. All bases of the BLK-RNA are perfectly matched with some bases of the sgRNA. WT has a single-base mismatch with sgRNA, while MT is perfectly matched with sgRNA. Therefore, MT is more prone to strand substitution reactions, while WT is less likely to undergo strand substitution reactions. With this design, it is possible to investigate the BLK-RNA length that has the greatest ability to distinguish between MT and WT. Figure 8 As shown, the study explored the maximum discriminative power that could be achieved by combining different single-base mismatch sites and BLK-RNA lengths. The results showed that the BLKRNA system had the highest discriminative power when the mismatch site was located at 13 nt and the BLK-RNA length was 18 nt.
[0051] This indicates that the BLKDNA and BLKRNA systems exhibit the highest discriminative power when the mismatch site is located at 13 nt. Therefore, using 13 nt as the mismatch site, we investigated the discriminative power of the CRISPR / Cas14a1 system with double-blocked modifications at different BLK-DNA and BLK-RNA lengths. Figure 9 As shown, at the 13nt mismatch site, 14nt-BLKRNA + 12nt-BLKDNA achieved the best discrimination (DF=1078).
[0052] Furthermore, the detection capability of the method of this invention for low-abundance targets was explored more comprehensively. Using WT solution as a diluent, the WT solution was diluted according to a concentration gradient to prepare substrates with mutation abundances of 100%, 50%, 10%, 5%, 1%, 0.5%, 0.1%, 0.05%, 0.01%, 0.005%, 0.002%, 0.001%, 0.0005%, and 0.0002%. These substrates with different mutation abundances were annealed separately at elevated temperatures before being mixed and added to the reaction system. Experimental results are as follows: Figure 10 and Figure 11 As shown, the system of this invention can detect mutation abundance as low as 0.0005%. This demonstrates that the method of this invention has extremely high sensitivity and specificity, and a very high detection capability for targets with low abundance.
[0053] In summary, this invention introduces a double-closed four-strand substitution reaction into the CRISPR / Cas14a1 system, significantly improving the system's specificity by leveraging the amplification effect of thermodynamic differences. Furthermore, thanks to the strong trans-cleavage capability of the Cas14a1 protein, even low concentrations of nucleic acid target input can generate significant fluorescence signals, resulting in extremely high sensitivity. Therefore, this invention enables early screening for KRAS-G12D mutations in pancreatic cancer patients. Moreover, by engineering the corresponding nucleic acid sequences, this method can be extended to the detection of gene mutations at other sites, demonstrating broad applicability and promising clinical application potential.
[0054] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.
Claims
1. A CRISPR / Cas14a1 system based on dual-enclosure modification, characterized in that: Includes BLK-DNA, BLK-RNA, sgRNA, activator, Cas14a1 protein, FAM and BHQ modified ssDNA probes, NEBuffer 2.1, and ultrapure water; The activator is a short-chain ssDNA target prepared from a gene template by asymmetric PCR; The activator, BLK-DNA, sgRNA, and BLK-RNA are subjected to a temperature annealing procedure to form an sgRNA-BLKRNA complex and an activator-BLKDNA complex. The two complexes undergo a four-strand displacement reaction based on toehold, thereby binding BLKDNA and BLKRNA, and binding the activator to sgRNA, activating the trans-cleavage activity of the Cas14a1 protein. The Cas14a1 protein indiscriminately cleaves the ssDNA probe.
2. The CRISPR / Cas14a1 system according to claim 1, characterized in that: The annealing process is as follows: 10 min at 85°C, 5 min at 55°C, and 5 min at 37°C.
3. The CRISPR / Cas14a1 system according to claim 1, characterized in that: The asymmetric PCR reaction system included 10 μL of forward primer, 1 μL of reverse primer, 1 μL of genomic DNA template, and 12 μL of 2×Phanta Max Buffer. The PCR program was: 95℃ for 10 s, 55℃ for 20 s, 72℃ for 10 s, for a total of 40 cycles.
4. The CRISPR / Cas14a1 system according to claim 1, characterized in that: All bases of BLK-DNA bind to some bases of MT or WT, and all bases of BLK-RNA bind to some bases of sgRNA.
5. The CRISPR / Cas14a1 system according to claim 4, characterized in that: BLK-RNA and sgRNA are a perfect match, BLK-DNA is a perfect match with WT, but BLK-DNA has a one-base mismatch with MT.
6. The use of the CRISPR / Cas14a1 system according to any one of claims 1-5 in the preparation of a pancreatic cancer mutation gene detection kit.
7. The application according to claim 6, characterized in that: The mutated gene site is KRAS-G12D. The DNA primers used for asymmetric PCR include a forward primer with a nucleotide sequence as shown in SEQ ID NO. 1 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.
2.
8. The application according to claim 7, characterized in that: The nucleotide sequence of the BLK-DNA is shown in SEQ ID NO. 3, the nucleotide sequence of the BLK-RNA is shown in SEQ ID NO. 4, and the nucleotide sequence of the sgRNA is shown in SEQ ID NO.
9.
9. A pancreatic cancer mutation gene detection kit, characterized in that: Includes the CRISPR / Cas14a1 system as described in any one of claims 1-5.
10. The use of the detection kit according to claim 9 in the preparation of a pancreatic cancer mutation gene detection kit.