Digital PCR kit and method for accurately detecting copy number of CAR gene of CAR-T cell and lentiviral vector

Abstract

The application belongs to the technical field of molecular diagnosis, and particularly relates to a digital PCR kit and method for accurately detecting the copy number of a CAR gene of a CAR-T cell and a lentivirus vector. The application first realizes the absolute quantification of CAR, Rev and an internal reference gene RNase P in a single tube simultaneously, and has strong universality. Based on the principle of digital PCR, the absolute copy number is directly obtained without a standard curve, and the result is accurate and highly repeatable. The detection lower limit reaches 0.01%, and extremely low abundance CAR-T residues or microresidual diseases can be detected. Primers and probes are designed for the conservative regions of CD3zeta, Rev and RNase P, and no cross reaction is verified, so that false positives are effectively avoided. The sample only needs gDNA, and there is no requirement for cell activity, and the sample is compatible with freezing and transportation. The kit is premixed and optimized, the process is automated, and 4-5 hours are needed. The kit is suitable for the whole chain of CAR-T drug research and development, production process quality control, clinical patient monitoring and safety evaluation.

Description

Technical Field

[0001] This invention belongs to the field of molecular diagnostic technology, specifically relating to a digital PCR kit and method for accurately detecting the copy number of CAR gene and lentiviral vector in CAR-T cells. Background Technology

[0002] Chimeric antigen receptor T-cell (CAR-T) therapy is an immunotherapy method that uses genetic engineering to introduce the CAR gene into T cells, enabling them to specifically recognize and kill tumor cells. Currently, this therapy has demonstrated significant clinical efficacy in various hematological malignancies.

[0003] The copy number of the CAR gene integrated into the T cell genome is a key pharmacokinetic parameter affecting the proliferation, persistence, and therapeutic efficacy of CAR-T cells in vivo. Simultaneously, the integration copy number of lentiviral vectors, commonly used delivery tools, is also an important safety indicator for assessing transduction efficiency and monitoring the risk of insertional mutations. Therefore, establishing a method for simultaneously, accurately, and absolutely quantifying the copy numbers of CAR genes and vectors is of great significance for the research and development, production quality control, clinical treatment monitoring, and efficacy evaluation of CAR-T products.

[0004] The commonly used detection methods currently include:

[0005] 1. Quantitative PCR (qPCR): Relies on a standard curve, is a relative quantification method, is easily affected by inhibitors and amplification efficiency, has poor repeatability, and is not suitable for low copy number or precise quantification scenarios.

[0006] 2. Flow cytometry: Detects CAR protein expression on cell surface. It is an indirect relative quantification method, which requires high sample activity and cannot directly detect vector sequences. Its versatility is limited by specific antibodies.

[0007] Digital PCR (dPCR) technology divides the reaction system into tens of thousands of independent microreaction units and directly counts target molecules based on the Poisson distribution principle. It can achieve absolute quantification without the need for a standard curve and has extremely high sensitivity, accuracy and repeatability. It is particularly suitable for the accurate detection of low-abundance nucleic acids.

[0008] However, there is currently a lack of a universal digital PCR detection kit on the market that can simultaneously and absolutely quantify CAR genes (targeting the mainstream co-stimulatory domains) and lentiviral vector marker genes in CAR-T cells in a single tube, and perform standardized calibration with internal reference genes. Summary of the Invention

[0009] To address the shortcomings of existing detection technologies, this invention aims to provide a digital PCR kit and detection method that is easy to operate, accurate, highly sensitive, and highly specific. It can simultaneously and absolutely quantify the copy number of the CAR gene (covering the CD28 and 4-1BB co-stimulatory domains) and the Rev gene of the lentiviral vector in CAR-T cells in a single tube, meeting the precise detection needs throughout the entire process from research and development to production and clinical application.

[0010] This invention is achieved through the following technical solution:

[0011] In a first aspect, the present invention provides a digital PCR kit for accurately detecting the copy number of CAR gene and lentiviral vector in CAR-T cells, comprising:

[0012] (1) Three sets of specific primer pairs and probes for the simultaneous detection of the following three targets:

[0013] (a) Primer pairs and probes targeting CAR genes, wherein the primer pairs comprise: an upstream primer targeting the CD28 costimulatory domain, an upstream primer targeting the 4-1BB costimulatory domain, and a downstream primer targeting the CD3ζ activation domain.

[0014] (b) Primer pairs and probes targeting the Rev gene of the lentiviral vector;

[0015] (c) Primer pairs and probes targeting the human internal reference single-copy gene RNase P.

[0016] (2) Premixed solution and droplet generation consumables required for digital PCR reaction;

[0017] (3) A premixed working solution prepared from the three sets of primers and probes.

[0018] Preferably, the nucleotide sequences of the three sets of primers and probes are as follows:

[0019] Primers and probes targeting the CAR gene:

[0020] Upstream primer CD28-F: SEQ ID NO: 1;

[0021] Upstream primer 4-1BB-F: SEQ ID NO: 2;

[0022] Downstream primer CD3ζ-R: SEQ ID NO: 3;

[0023] Probe CD3ζ-P: SEQ ID NO: 4, with its 5' end labeled FAM and its 3' end labeled MGB;

[0024] Primers and probes targeting the Rev gene:

[0025] Upstream primer Rev-F: SEQ ID NO: 5;

[0026] Downstream primer Rev-R: SEQ ID NO: 6;

[0027] Probe Rev-P: SEQ ID NO: 7, with ROX labeled at its 5' end and MGB labeled at its 3' end;

[0028] Primers and probes targeting RNase P:

[0029] Upstream primer RNase PF: SEQ ID NO: 8;

[0030] Downstream primer RNase PR: SEQ ID NO: 9;

[0031] The probe RNase PP: SEQ ID NO: 10, with its 5' end labeled CY5.5 and its 3' end labeled BHQ2.

[0032] Preferably, the kit further comprises a positive control and a negative control; the positive control is a mixture of plasmids containing CAR gene target fragments and Rev gene target fragments with human genomic DNA of known copy number;

[0033] The negative control is peripheral blood genomic DNA from healthy individuals that does not contain the CAR gene or lentiviral vector sequence.

[0034] Secondly, the present invention provides the application of the kit in the preparation of detection products for detecting the copy number of CAR gene in CAR-T cells, the copy number of Rev gene in lentiviral vectors, or the ratio of CAR gene to Rev gene copy number.

[0035] Thirdly, the present invention provides a method for simultaneously detecting the copy numbers of the CAR gene and lentiviral vector in CAR-T cells using the aforementioned kit, comprising the following steps:

[0036] (a) Prepare a digital PCR reaction system containing the three sets of primers and probes;

[0037] (b) Perform droplet generation and PCR amplification;

[0038] (c) Collect fluorescence channel signals corresponding to the CAR gene, Rev gene and RNase P gene respectively;

[0039] (d) Calculate the absolute copy number of each target based on the Poisson distribution principle.

[0040] Preferably, the PVR amplification program in step (b) is 95℃ for 10 min; 98℃ for 15 s, 60℃ for 30 s, 40 cycles; 28℃ for 10 min.

[0041] Preferably, the fluorescence channel of the CAR gene in step (c) is FAM, the fluorescence channel of the Rev gene is ROX, and the fluorescence channel of the Rnase P gene is CY5.5.

[0042] Preferably, step (d) further includes calculating the following indicators:

[0043] (i) CAR gene copy number / cell = (CAR concentration / RNase P concentration) × 2 × 100%;

[0044] (ii) Rev gene copy number / cell = (Rev concentration / RNase P concentration) × 2 × 100%;

[0045] (iii) CAR / Rev ratio = CAR concentration / Rev concentration.

[0046] The present invention has the following advantages over the prior art:

[0047] 1. One tube for three tests, highly efficient and versatile: For the first time, a single tube can simultaneously and absolutely quantify CAR gene (compatible with CD28 / 4-1BB), lentivirus Rev gene and internal reference gene, covering the current mainstream CAR-T products and with strong versatility.

[0048] 2. Absolute quantification, accurate and reliable: Based on the principle of digital PCR, no standard curve is needed. It directly gives the absolute copy number of the target molecule, avoiding the error caused by the qPCR standard curve. The results are accurate and highly reproducible.

[0049] 3. Extremely high sensitivity: The lowest limit of detection (LOD) can reach 0.01% (the proportion of the target gene in the total genome), which can detect extremely low abundance of CAR-T cell residues or minimal residual disease (MRD).

[0050] 4. High specificity: Primers and probes are designed for the highly conserved CD3ζ, Rev and RNase P regions, and have been experimentally verified to have no cross-reactivity in gDNA from healthy individuals, effectively avoiding false positives.

[0051] 5. Relaxed sample requirements: Only gDNA needs to be extracted, and there are no requirements for cell viability in the sample. It is suitable for various types of cryopreserved and long-distance transported clinical samples (such as whole blood and bone marrow), which facilitates retrospective analysis and multicenter studies.

[0052] 6. Simple and quick operation: The reagent kit components are premixed and optimized, and the detection process is highly automated. From sample addition to result analysis, it can be completed within 4-5 hours, which is suitable for routine clinical laboratory operations.

[0053] 7. Wide range of applications: Applicable to the entire chain of CAR-T cell drug development, production process quality control (transduction efficiency assessment), clinical trial patient monitoring (in vivo expansion, persistence, efficacy correlation analysis) and safety assessment (vector integration monitoring). Attached Figure Description

[0054] Figure 1 This is a graph showing the dynamic change trend of CAR gene copy number in patient 1 who received iquiolone injection in Example 5;

[0055] Figure 2 This is a graph showing the dynamic change trend of CAR gene copy number in patient 2 who received iprodione injection in Example 5. Detailed Implementation

[0056] To better understand the technical means and effects of this invention, further explanation is provided in conjunction with the following embodiments. The descriptions in these embodiments are for illustrative purposes only and should not, and will not, limit the scope of this invention. Unless otherwise specified, the reagents, methods, and equipment used in this invention are all conventional reagents, methods, and equipment in the art.

[0057] Example 1: Preparation and Validation of Core Components of the Reagent Kit

[0058] This embodiment details the design, preparation, and quality control process of the core components of the digital PCR kit of the present invention.

[0059] 1.1 Primer and probe design, synthesis, and quality control

[0060] To address the issues of limited target selection and lack of vector detection in existing CAR gene detection technologies, this invention incorporates the following meticulous design:

[0061] CAR gene targets: Universal downstream primers (SEQ ID NO: 3) and probes (SEQ ID NO: 4) were designed targeting the CD3ζ activation domain common to second-generation CAR products. Simultaneously, to avoid missed detections due to targeting only a single co-stimulatory domain, two innovative upstream primers targeting CD28 (SEQ ID NO: 1) and 4-1BB (SEQ ID NO: 2) were designed respectively. Bioinformatics analysis ensured that the selected sequences were highly specific within their corresponding gene families and showed no significant homology with the human genome.

[0062] Rev gene target: Primers (SEQ ID NO: 5-6) and probes (SEQ ID NO: 7) were designed to target the highly conserved and essential Rev gene in HIV-1-derived lentiviral vectors, with the aim of universally tracking vector integration.

[0063] RNase P gene target: Human single-copy gene RNase P was selected as an internal control (SEQ ID NO: 8-10) for precise quantification of DNA input.

[0064] All oligonucleotide sequences were synthesized by Hunan Aikerui Biotechnology Co., Ltd., and the probes were labeled with fluorescence and quencher groups as required (see Table 1 for details). The synthesized products were confirmed to have correct sequences by mass spectrometry, and the purity of all products was greater than 98%.

[0065] Table 1 Primer and probe sequences and modification information

[0066]

[0067] 1.2 Optimized Formulation of Premixed Working Solution

[0068] To achieve triple detection in a single tube and ensure balanced amplification efficiency for each target, this invention optimized the concentration and ratio of the primer and probe working solutions. The aforementioned primers and probes were prepared into 100 μM stock solutions using ddH2O. Using a checkerboard titration method, it was determined that when the CAR gene detection mixture (SEQ ID NO: 1, 2, 3, 4 stock solutions mixed in a volume ratio of 3:3:3:1), the Rev detection mixture (SEQ ID NO: 5, 6, 7 stock solutions mixed with ddH2O in a ratio of 3:3:1:3), and the RNase P detection mixture (SEQ ID NO: 8, 9, 10 stock solutions mixed with ddH2O in a ratio of 3:3:1:3) participated in the reaction at a final concentration of 10 μM (primer) / 5 μM (probe), the signal intensity of each channel was optimal, with no mutual interference. After aliquoting, the solutions were stored at -20℃, and stability tests showed that they could be stably stored for 12 months.

[0069] 1.3 Construction and Standardization of Positive and Negative Controls

[0070] Positive control: The plasmid pUC57-CAR-Rev, containing SEQ ID NO: 1-3 (CD28-4-1BB-CD3ζ chimeric fragment) and SEQ ID NO: 5-6 (Rev gene fragment), was synthesized by General Biotechnology (Anhui) Co., Ltd. The copy number was calculated based on the plasmid's length and concentration, and then mixed with accurately quantified human genomic DNA in a specific ratio to ensure that the final positive control had a CAR and Rev plasmid copy number > 500 copies / μl and an RNase P gene (from human gDNA) copy number > 1000 copies / μl.

[0071] The nucleotide sequence of the CAR gene CD28-4-1BB-CD3ζ chimeric fragment is shown in SEQ ID NO: 11:

[0072] CACGCGACTTCGCAGCCTATCGCTCCTTCGAACGTTTCTCTGTTGTTAAACGGGGCAGAAAGAAACTCCTGTATATATTCAAACAACCATTTATGAGACCAGTACAAACTACTCAAGAGGAAGATGGCTGTAGCTGCCGATTTCCAGAAGAAGAAGAAGGAGGATGTGAACTGGAATTC AGAGTGAAGTTCAGCAGGAGCGCAGACGCCCCCGCGTACCAGCAGGGCCAGAACCAGCTCTATAACGAGCTCAATCTAGGACGAAGAGAGGAGTACGATGTTTTGGACAAGAGACGTGGCCGGGACCCTGAGATGGGGGGAAAGCCGAGAAGGAAGAACCCTCAGGAAGGCCTGTACAAT

[0073] The nucleotide sequence of the REV gene fragment is shown in SEQ ID NO: 12:

[0074] AAGCGGAGACAGCGACGAAGAGCTCATCAGAACAGTCAGACTCATCAAGCTTCTCTATCAAAGCAGT

[0075] Negative control: Genomic DNA from peripheral blood of healthy individuals that does not contain any CAR or lentiviral vector sequences was selected and its concentration was adjusted so that the RNase P gene copy number was > 1000 copies / μL.

[0076] 1.4 Complete Assembly of the Reagent Kit

[0077] The kit contains the following components: 1) 2× digital PCR premix (LeaderGene, catalog number 3205001); 2) Premixed working solution of the above three primer and probe tubes; 3) Positive control; 4) Negative control; 5) Digital PCR microfluidic chip and droplet generation oil (LeaderGene, catalog number 3400001); 6) Instructions for use. The entire kit should be stored at -20°C.

[0078] Example 2: Standard operating procedure for detection using the kit of the present invention

[0079] This embodiment describes the standardized operating procedures for detection using the Leading Gene D3200 digital PCR system and the kit of this invention.

[0080] 2.1 Preparation of the reaction system: Prepare a total reaction system of 15 μL in the reaction tube according to the following proportions:

[0081] 2× Digital PCR Premix: 7.5 μL

[0082] CAR gene primer and probe mixed working solution: 0.3 μL

[0083] Rev gene primer and probe mixed working solution: 0.3 μL

[0084] RNase P gene primer and probe mixed working solution: 0.3 μL

[0085] Sample to be tested: X μl (Recommended dosage 5-300 ng)

[0086] Make up to 15 μL with nuclease-free water.

[0087] Each batch of experiments must simultaneously include a positive control, a negative control, and a blank control (using water instead of template).

[0088] 2.2 Droplet generation: The above reaction system and droplet generation oil were added together to the digital PCR microfluidic chip, and tens of thousands of nano-level water-in-oil droplets were generated using a droplet generator.

[0089] 2.3 PCR amplification: After generating droplets, the chip was placed in a PCR instrument and the following program was run: 95℃ for 10 min; 98℃ for 15 s, 60℃ for 30 s, 40 cycles; 28℃ for 10 min.

[0090] 2.4 Fluorescence Signal Reading and Analysis: The amplified chip was placed in a droplet reader, and fluorescence signals of each droplet were acquired in the FAM, ROX, and CY5.5 channels, respectively. The software automatically distinguished between positive and negative droplets.

[0091] 2.5 Quality Control and Result Interpretation:

[0092] Validity assessment: The results of the negative / positive controls met expectations (positive control: CAR / Rev > 500 copies, RNase P > 1000 copies; negative / blank control: CAR / Rev < 2 copies, RNase P negative control > 1000 copies). Since the above conditions were met, this test was valid.

[0093] Result calculation:

[0094] The absolute copy number of the CAR gene in the sample (copies / μL reaction solution) = the concentration value of the positive droplets of the FAM channel after Poisson correction.

[0095] The absolute copy number of Rev gene in the sample (copies / μL reaction solution) = the concentration value of ROX channel positive droplets after Poisson correction.

[0096] The absolute copy number of RNase P gene in the sample (copies / μL reaction solution) = the concentration value of positive droplets in the CY5.5 channel after Poisson correction.

[0097] CAR gene copy number / cell = (CAR concentration / RNase P concentration) × 2 × 100%

[0098] Rev gene copy number / cell = (Rev concentration / RNase P concentration) × 2 × 100%

[0099] CAR / Rev ratio = CAR concentration / Rev concentration

[0100] CAR gene copy number / μg DNA = CAR concentration / (RNase P concentration × 3.27 × 10) -12 (Note: 3.27 × 10) -12 g represents the weight of the haploid human genome.

[0101] Example 3: Validation of the reagent kit's analytical performance

[0102] This embodiment systematically verifies the key analytical performance indicators of the kit of the present invention, including sensitivity, linearity, and specificity.

[0103] 3.1 Sensitivity and Detection Limit

[0104] The positive control plasmid prepared in Example 1 was serially diluted to simulate its proportion in the human genome background of 5%, 1%, 0.5%, 0.05%, and 0.01%, respectively. Each concentration level was tested three times. The results are shown in Table 2. The detection limits of the kit of this invention for both the CAR and Rev genes are as low as 0.01% (i.e., abundance of one ten-thousandth). Within the range of 0.01% to 5%, the detected values ​​are in high agreement with the theoretical values.

[0105] Table 2. Sensitivity and linearity validation results for CAR and Rev genes.

[0106]

[0107] 3.2 Specificity Validation

[0108] Peripheral blood gDNA from 10 healthy donors was detected using the kit of this invention. As shown in Table 3, the copy numbers of the CAR and Rev genes were both 0 in all healthy donor samples, while the RNase P gene signal was detected normally. This result strongly demonstrates the specificity of the target selected in this invention and can effectively avoid false positives caused by homology with non-target genomic regions.

[0109] Table 3. Results of gDNA sample testing from healthy donors

[0110]

[0111] Example 4: Clinical application validation of the kit – universality

[0112] This embodiment verifies the broad applicability of the kit of the present invention by detecting samples related to commercially available CAR-T products using different technical approaches.

[0113] 4.1 Detection of CAR-T products with different co-stimulatory domains

[0114] Peripheral blood samples were collected from patients receiving different CAR-T products. The test results are shown in Tables 4 and 5. The data in Tables 4 and 5 show that the kit of this invention can effectively and specifically detect CAR gene signals in both samples of Fosun Kite Akylenzai injection (using the CD28 co-stimulatory domain) and CARsgen Therapeutics Zewoki Orenzai injection (using the 4-1BB co-stimulatory domain). This is because the kit contains primers for both CD28 and 4-1BB, achieving "full coverage" of mainstream second-generation CAR-T products.

[0115] Table 4. Detection of CAR gene copy number in patients treated with Fosun Kite's Akylenza injection.

[0116]

[0117] Table 5. CAR gene copy number detection in patients treated with CARsgen's Zawagi Orenza injection.

[0118]

[0119] 4.2 Distinguishing ability for different carrier types

[0120] Further analysis of the Rev gene detection results of the above samples (Tables 4 and 5) showed that the gene was positive and the CAR / Rev ratio was close to 1.

[0121] For the retroviral vector Akylencephalosporin, the sample showed a negative Rev gene result (Table 4). This result clearly demonstrates that the kit of this invention can effectively distinguish the vector type used in CAR-T cells through Rev gene detection, which is of great value for tracing product origin and assessing safety risks.

[0122] Example 5: Clinical application validation of the reagent kit—dynamic monitoring and comparison of advantages

[0123] This embodiment demonstrates the core value of the reagent kit of the present invention in clinical management and its advantages over existing technologies through real patient dynamic monitoring data.

[0124] 5.1 Dynamic monitoring of CAR-T cells in patients

[0125] Two patients treated with iolosyl-Loncin injection were continuously monitored for up to 200 days. The data are shown in Tables 6 and 7, and the dynamic trend graph is shown below. Figure 1 , Figure 2 As shown, digital PCR clearly depicts the complete dynamic process of CAR-T cells in vivo: the rapid expansion phase (peaking 7-14 days after infusion), the persistence phase (weeks to months after peak), and the slow decay phase. Using the indicator of "CAR copy number / cell," doctors can quantitatively assess the viability and quantity of CAR-T cells, providing crucial molecular evidence for efficacy evaluation and relapse prediction.

[0126] Table 6. Dynamic detection of CAR gene copy number in patient 1 treated with Reindeer Biosciences' Ikiorenza injection.

[0127]

[0128] Table 7. Dynamic detection of CAR gene copy number in patients 2 who received Iquioxane injection from Reindeer Biosciences.

[0129]

[0130] 5.2 Comparative advantages with flow cytometry

[0131] At the same time point, flow cytometry (for detecting cell surface CAR proteins) and the digital PCR method of this invention were used in parallel for detection. Comparative results are shown in Tables 6 and 7 above.

[0132] Consistency in trends: The changes in the proportion of "CAR-positive cells" detected by the two methods are basically consistent.

[0133] Numerical differences: At most time points, especially when there was a delay in sample processing or cell viability may have been affected, the “CAR copy number / cell” value detected by digital PCR was significantly higher than the “CAR+ cell percentage” value detected by flow cytometry.

[0134] Scientific Explanation: Digital PCR detects DNA in the cell genome, unaffected by cell viability, membrane integrity, or CAR protein expression levels. Flow cytometry, on the other hand, relies on intact proteins on the surface of living cells, making it undetectable when cells undergo apoptosis, death, or CAR protein internalization. Therefore, this invention provides a more stable and comprehensive in vivo CAR-T cell quantification method, particularly suitable for non-fresh or poorly processed clinical samples.

[0135] Conclusion: The above examples fully demonstrate that the digital PCR kit provided by the present invention is not only a highly sensitive and specific detection tool, but also an innovative platform that can provide a comprehensive solution for the efficacy evaluation, persistent monitoring, vector safety traceability and universal sample processing of CAR-T therapy, and has huge clinical application potential and market value.

[0136] The specific embodiments described above further illustrate the purpose, technical solution, and beneficial effects of the present invention. It should be understood that the above description is only a specific embodiment of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A digital PCR kit for accurately detecting the copy number of CAR gene and lentiviral vector in CAR-T cells, characterized in that, Include: (1) Three sets of specific primer pairs and probes for the simultaneous detection of the following three targets: (a) Primer pairs and probes targeting CAR genes, wherein the primer pairs comprise: an upstream primer targeting the CD28 costimulatory domain, an upstream primer targeting the 4-1BB costimulatory domain, and a downstream primer targeting the CD3ζ activation domain. (b) Primer pairs and probes targeting the Rev gene of the lentiviral vector; (c) Primer pairs and probes targeting the human internal reference single-copy gene RNase P. (2) Premixed solution and droplet generation consumables required for digital PCR reaction; (3) A premixed working solution prepared from the three sets of primers and probes.

2. The reagent kit according to claim 1, characterized in that, The nucleotide sequences of the three sets of primers and probes are as follows: Primers and probes targeting the CAR gene: Upstream primer CD28-F: SEQ ID NO: 1; Upstream primer 4-1BB-F: SEQ ID NO: 2; Downstream primer CD3ζ-R: SEQ ID NO: 3; Probe CD3ζ-P: SEQ ID NO: 4, with its 5' end labeled FAM and its 3' end labeled MGB; Primers and probes targeting the Rev gene: Upstream primer Rev-F: SEQ ID NO: 5; Downstream primer Rev-R: SEQ ID NO: 6; Probe Rev-P: SEQ ID NO: 7, with ROX labeled at its 5' end and MGB labeled at its 3' end; Primers and probes targeting RNase P: Upstream primer RNase PF: SEQ ID NO: 8; Downstream primer RNase PR: SEQ ID NO: 9; The probe RNase PP: SEQ ID NO: 10, with its 5' end labeled CY5.5 and its 3' end labeled BHQ2.

3. The kit according to claim 1 or 2, characterized in that, The kit also includes a positive control and a negative control; the positive control is a mixture of plasmids containing CAR gene target fragments and Rev gene target fragments with human genomic DNA of known copy number; The negative control is peripheral blood genomic DNA from healthy individuals that does not contain the CAR gene or lentiviral vector sequence.

4. The use of the kit according to any one of claims 1 to 3 in the preparation of a detection product for detecting the copy number of CAR gene in CAR-T cells, the copy number of Rev gene in lentiviral vectors, or the ratio of CAR gene to Rev gene copy number.

5. A method for simultaneously detecting the copy numbers of the CAR gene and lentiviral vector in CAR-T cells using the kit described in any one of claims 1 to 3, characterized in that, Includes the following steps: (a) Prepare a digital PCR reaction system containing the three sets of primers and probes; (b) Perform droplet generation and PCR amplification; (c) Collect fluorescence channel signals corresponding to the CAR gene, Rev gene and RNase P gene respectively; (d) Calculate the absolute copy number of each target based on the Poisson distribution principle.

6. The method according to claim 5, characterized in that, The PVR amplification program in step (b) is 95℃ for 10 min; 98℃ for 15 s, 60℃ for 30 s, 40 cycles; 28℃ for 10 min.

7. The method according to claim 5, characterized in that, The fluorescence channel of the CAR gene mentioned in step (c) is FAM, the fluorescence channel of the Rev gene is ROX, and the fluorescence channel of the Rnase P gene is CY5.

5.

8. The method according to claim 5, characterized in that, Step (d) also includes calculating the following metrics: (i) CAR gene copy number / cell = (CAR concentration / RNase P concentration) × 2 × 100%; (ii) Rev gene copy number / cell = (Rev concentration / RNase P concentration) × 2 × 100%; (iii) CAR / Rev ratio = CAR concentration / Rev concentration.

Images