A hydrophobic drug delivery nanoparticle and a preparation method and application thereof

By using TTVP to assist the formation of nanoparticles of hydrophobic drugs and nucleic acids in the aqueous phase, the problem of poor stability of hydrophobic drug carriers is solved, and efficient hydrophobic drug delivery and multimodal therapy are achieved.

CN122272829APending Publication Date: 2026-06-26AFFILIATED HOSPITAL OF NANTONG UNIV

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
AFFILIATED HOSPITAL OF NANTONG UNIV
Filing Date
2026-04-17
Publication Date
2026-06-26

AI Technical Summary

Technical Problem

Existing hydrophobic drug carriers have poor stability in physiological environments, leading to drug leakage. Furthermore, nucleic acid origami technology suffers from poor in vivo stability and high mass production costs, making it difficult to achieve efficient hydrophobic drug delivery.

Method used

TTVP-assisted hydrophobic drugs and nucleic acids were mixed in an aqueous phase and then subjected to programmed temperature-controlled heat treatment to form nanoparticles with electrostatic, hydrophobic, and π-π stacking effects, resulting in dense and stable nanoparticles.

Benefits of technology

It improves the loading efficiency and physiological stability of hydrophobic drugs, achieves multimodal synergistic therapeutic effects, with a drug loading rate of up to 77.5%, and can work in conjunction with nucleic acid drugs to achieve efficient disease diagnosis and treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122272829A_ABST
    Figure CN122272829A_ABST
Patent Text Reader

Abstract

This invention discloses a hydrophobic drug delivery nanoparticle, its preparation method, and its application, belonging to the field of biomedical technology. The method includes the following steps: (1) preparing a hydrophobic drug organic solution and a 4-(2-(5-(4-(diphenylamino)phenyl)thiophene)vinyl)-1-(3-(trimethylammonium)propyl)pyridine-1-onium bromide TTVP organic solution, mixing them, and removing the organic solvent to obtain a hydrophobic drug-TTVP complex; (2) mixing the hydrophobic drug-TTVP complex with a nucleic acid aqueous solution, and performing heat treatment by programmed temperature control to allow the hydrophobic drug, TTVP, and nucleic acid to self-assemble into nanoparticles, and further centrifuging and washing to obtain the hydrophobic drug delivery nanoparticles. The method of this invention is environmentally friendly, simple in steps, and has high drug loading efficiency. It can be used as a universal hydrophobic drug delivery system to achieve efficient diagnosis and treatment of diseases.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to a hydrophobic drug delivery nanoparticle, its preparation method, and its application. Background Technology

[0002] Chemotherapy drugs are one of the core methods of cancer treatment, effectively killing rapidly proliferating tumor cells, controlling disease progression, and prolonging patient survival. For example, camptothecin can inhibit DNA topoisomerase and is widely used in cancer patients. However, most chemotherapy drugs have poor water solubility, so drug carriers are needed to uniformly disperse them in an aqueous phase and deliver them to the lesion area to improve treatment efficacy.

[0003] Currently, liposomes are one of the most widely used drug carriers in clinical practice, especially suitable for the delivery of hydrophobic drugs and gene therapy drugs. For example, Chinese patent document CN116617165A discloses a hydroxycamptothecin liposome for the treatment of liver fibrosis, comprising hydroxycamptothecin, distearylphosphatidylcholine, and polyethylene glycol phospholipids. Hydroxycamptothecin serves as the active ingredient for anti-liver fibrosis, distearylphosphatidylcholine serves as the carrier material, and polyethylene glycol phospholipids serve as a membrane modifier, forming a lipid membrane with the distearylphosphatidylcholine. Hydroxycamptothecin is loaded within the lipid membrane to form hydroxycamptothecin liposomes. However, liposome-based delivery systems suffer from poor stability, easily breaking down or aggregating in physiological environments, leading to drug leakage before reaching the lesion area and causing systemic toxicity. Furthermore, albumin-based hydrophobic drug delivery systems also have extremely limited effectiveness, mainly due to the significant difference in water solubility between hydrophobic drugs and albumin, making it difficult to prepare uniformly sized nanoparticles.

[0004] As a biological macromolecule, nucleic acids can be used not only as gene therapy drugs but also as drug delivery carriers. Commonly used nucleic acid-based drug delivery carriers include nucleic acid origami technology and amphiphilic nucleic acid molecules. For example, Chinese patent document CN114177312A discloses a nucleic acid nanomedicine carrier and its preparation method and application, which includes a DNA origami nanostructure, a cholesterol-disulfide bond-DNA complex, a tumor-targeting peptide-DNA complex, and a drug. The origami structure contains a DNA molecule lock modified with disulfide bonds as a response element. However, DNA origami technology mainly suffers from poor in vivo stability and high mass production costs. The hydrophobic ends of amphiphilic nucleic acid molecules can spontaneously assemble into micelle structures in an aqueous phase. These micelle structures can load hydrophobic drugs, thereby achieving efficient drug delivery. However, the high difficulty in synthesizing amphiphilic nucleic acid molecules and their low drug loading efficiency limit their widespread application.

[0005] Therefore, there is an urgent need to develop a universal and simple method for delivering hydrophobic drugs to simplify complex preparation processes and improve drug loading stability. Summary of the Invention

[0006] To address the issues of poor water solubility of hydrophobic drugs and low drug loading efficiency in existing delivery systems, this invention provides nanoparticles for hydrophobic drug delivery and their preparation method. The method utilizes TTVP to assist in the uniform dispersion of hydrophobic drugs in the aqueous phase, and then forms dense and physiologically stable nanoparticles with nucleic acids through heat treatment.

[0007] The specific technical solution adopted is as follows: A method for preparing hydrophobic drug delivery nanoparticles includes the following steps: (1) Prepare a hydrophobic drug organic solution and a 4-(2-(5-(4-(diphenylamino)phenyl)thiophene)vinyl)-1-(3-(trimethylammonium)propyl)pyridine-1-onium bromide TTVP organic solution respectively, mix them and remove the organic solvent to obtain a hydrophobic drug-TTVP complex; (2) The hydrophobic drug-TTVP complex is mixed with a nucleic acid aqueous solution and heat-treated by programmed temperature control to allow the hydrophobic drug, TTVP and nucleic acid to self-assemble into nanoparticles. After further centrifugation and washing, the hydrophobic drug delivery nanoparticles are obtained. The parameters for heat treatment by programmed temperature control are as follows: heat to 70 °C~95 °C and incubate for 10~60 minutes, then cool down by 1 °C~5 °C every 1~10 minutes until room temperature (0 °C~25 °C) is reached and then maintained at a constant temperature; Specifically, the structural formula of TTVP is shown below, and it can be synthesized by yourself or according to the records in the literature.

[0008] .

[0009] This invention utilizes the positively charged water-soluble aromatic compound TTVP to uniformly disperse a hydrophobic drug in an aqueous phase, which is then blended with nucleic acids in the aqueous phase. During heating, the hydrophobic and π-π stacking interactions between TTVP and the aromatic ring structures in the hydrophobic drug and nucleic acid are significantly enhanced, and the negative charge of the nucleic acid is shielded by the positive charge of TTVP. Ultimately, the system assembles into hydrophobic drug-loaded nanoparticles under the combined effects of electrostatics, hydrophobicity, and π-π stacking.

[0010] Specifically, the hydrophobic drug is preferably a hydrophobic drug containing an aromatic ring structure, such as sorafenib, lenvatinib, camptothecin, curcumin, sertraline hydrochloride, etc. The hydrophobic and π-π stacking interactions between the aromatic ring structures can be significantly enhanced under heat treatment, thereby forming a dense and stable nanostructure.

[0011] Specifically, the organic solvents in the hydrophobic drug organic solution and the TTVP organic solution can be methanol, ethanol, N,N-dimethylformamide, chloroform, or dichloromethane, etc.; the organic solvents are removed by drying.

[0012] Preferably, when preparing the hydrophobic drug-TTVP complex, the molar ratio of the hydrophobic drug to TTVP is 1:1 to 5.

[0013] Preferably, the molar ratio of the hydrophobic drug to the nucleic acid is 1~50:1.

[0014] Furthermore, nucleic acids can be obtained through solid-phase synthesis or commercial purchase. The length of the nucleic acid is at least 10 bases, preferably 10-50 bases. If the nucleic acid length is too short, the internal forces of the particles are too weak to maintain the stability of the nanoparticles, and the drug loading capacity is significantly reduced.

[0015] A further preferred method is to heat the material by controlling the temperature using a programmed temperature control: heat the material to 85 °C~95 °C and incubate for 20~60 minutes, then cool it down by 3 °C~5 °C every 3~5 minutes until it reaches room temperature and is then kept at a constant temperature.

[0016] The present invention also provides hydrophobic drug delivery nanoparticles prepared by the method described above.

[0017] The present invention also provides a drug comprising the aforementioned hydrophobic drug delivery nanoparticles.

[0018] Compared with the prior art, the beneficial effects of the present invention are as follows: (1) The preparation method of hydrophobic drug delivery nanoparticles provided by the present invention is environmentally friendly, simple in steps, green and environmentally friendly. The formed nanoparticles are dense and compact, with good dispersibility and uniform and complete structure, which can significantly improve physiological stability.

[0019] (2) The hydrophobic drug delivery nanoparticles provided by the present invention have high drug loading efficiency, with a loading efficiency of 77.5% for sorafenib. They can be used as a universal hydrophobic drug delivery system and can work in conjunction with nucleic acid drugs to achieve efficient diagnosis and treatment of diseases.

[0020] (3) The hydrophobic drug delivery nanoparticles provided by the present invention can synergistically achieve the therapeutic effects of TTVP (photodynamic therapy), nucleic acid (gene therapy) and hydrophobic drugs, thereby achieving multimodal synergistic treatment of diseases with excellent results. Attached Figure Description

[0021] Figure 1 The results are from the dynamic light scattering test of the nucleic acid-TTVP-sorafenib nanoparticles prepared in Example 1.

[0022] Figure 2 The results are obtained from scanning electron microscopy of the nucleic acid-TTVP-sorafenib nanoparticles in Example 1.

[0023] Figure 3 The transmission electron microscopy and elemental analysis results of the nucleic acid-TTVP-sorafenib nanoparticles in Example 1 are shown.

[0024] Figure 4 The results show the cytotoxicity of nucleic acid-TTVP-sorafenib nanoparticles in mouse liver cancer cells. Detailed Implementation

[0025] To make the objectives, features, and advantages of this invention more apparent and understandable, a detailed description is provided below through specific embodiments. Many specific details are set forth in the following description to provide a thorough understanding of the invention. However, the invention can be practiced in many other ways different from those described herein, and those skilled in the art can make similar modifications without departing from the spirit of the invention. Therefore, the invention is not limited to the specific embodiments disclosed below. Technical features in various embodiments of the invention can be combined appropriately without mutual conflict.

[0026] Unless otherwise specified, the operating methods in the following examples are generally performed under conventional conditions or as recommended by the manufacturer. Contents not described in detail in this specification are prior art known to those skilled in the art. Unless otherwise specified, the experimental materials used in the examples below can be purchased from conventional biochemical reagent companies.

[0027] Specifically, in the following embodiments, the structural formula of TTVP is shown below, which can be synthesized by oneself or synthesized according to the description in the literature.

[0028] .

[0029] This invention utilizes the positively charged, water-soluble aromatic compound TTVP to uniformly disperse hydrophobic drugs in an aqueous phase, which are then mixed with nucleic acids in the aqueous phase. During heating, TTVP, the hydrophobic drug, and the nucleic acid assemble under the combined effects of electrostatics, hydrophobicity, and π-π stacking to form hydrophobic drug-loaded nanoparticles. These nanoparticles not only have a high hydrophobic drug loading rate but also exhibit uniform dispersion in the aqueous phase. This good dispersibility allows for the synergistic therapeutic effects of TTVP (photodynamic therapy), nucleic acid (gene therapy), and the hydrophobic drug, thereby achieving multimodal synergistic treatment of diseases.

[0030] Example 1 10 μL of a sorafenib solution (1 mmol / L) dissolved in N,N-dimethylformamide (DMF) was mixed with 10 μL of a TTVP solution (2 mmol / L) dissolved in DMF in a centrifuge tube. The mixture was then placed in a vacuum drying oven for 24 hours to allow for thorough drying and removal of the organic solvent, yielding a hydrophobic drug-TTVP complex. 100 μL of a nucleic acid aqueous solution containing 10 μmol / L of 20 bases (hereinafter referred to as 20MER, sequence: ATCCATCCCGACCTCTTTTT) was added to the centrifuge tube containing the hydrophobic drug-TTVP complex, and the mixture was shaken for 1 minute. The mixture was then heat-treated using a thermal cycling device: incubated at 95°C for 30 minutes, followed by cooling to room temperature at 3°C ​​every 4 minutes to obtain nucleic acid-TTVP-sorafenib nanoparticles, i.e., the hydrophobic drug delivery nanoparticles.

[0031] Tests showed that the hydrophobic drug delivery nanoparticles in this embodiment achieved a loading efficiency of 77.5% for sorafenib, indicating a high drug loading rate.

[0032] Example 2 5 μL of a 2.2 mmol / L camptothecin solution dissolved in ethanol and 15 μL of a 1 mmol / L TTVP solution dissolved in ethanol were mixed in a centrifuge tube and placed in a drying oven for 48 hours to dry thoroughly. The organic solvent was then removed to obtain the hydrophobic drug-TTVP complex. Next, 80 μL of a nucleic acid aqueous solution containing 30 μmol / L of 25 cytosine molecules (hereinafter referred to as 25T) was added to the centrifuge tube containing the hydrophobic drug-TTVP complex, and the mixture was shaken for 2 minutes. The mixture was then heat-treated using a thermal cycling device: incubated at 90°C for 40 minutes, and then cooled to room temperature by 5°C every 5 minutes to obtain nucleic acid-TTVP-camptothecin nanoparticles, i.e., the hydrophobic drug delivery nanoparticles.

[0033] Example 3 20 μL of curcumin solution (0.6 mmol / L in dichloromethane) and 20 μL of TTVP solution (0.6 mmol / L in dichloromethane) were mixed in a centrifuge tube and placed in a vacuum drying oven for 10 hours to dry thoroughly. The organic solvent was then removed to obtain the hydrophobic drug-TTVP complex. Next, 200 μL of a nucleic acid aqueous solution containing 8 μmol / L of 30 adenine atoms (hereinafter referred to as 30A) was added to the centrifuge tube containing the hydrophobic drug-TTVP complex, and the mixture was shaken for 1.5 minutes. The mixture was then heat-treated using a thermal cycling device: incubated at 85°C for 20 minutes, and then cooled to room temperature by 3°C every 3 minutes to obtain nucleic acid-TTVP-curcumin nanoparticles, i.e., the hydrophobic drug delivery nanoparticles.

[0034] Example 4 7 μL of lenvatinib solution (1 mmol / L in methanol) and 50 μL of TTVP solution (0.5 mmol / L in methanol) were mixed in a centrifuge tube and dried in a forced-air drying oven for 20 hours to remove the organic solvent, yielding a hydrophobic drug-TTVP complex. Then, 100 μL of a 5 μmol / L nucleic acid aqueous solution containing 35 bases (hereinafter referred to as 35MER; sequence: TGGTCAACCTCTGCTAGTCGGAACGCATTATTGGA) was added to the centrifuge tube containing the hydrophobic drug-TTVP complex, and the mixture was shaken for 3 minutes. The mixture was then heat-treated using a thermal cycling device: incubated at 70°C for 60 minutes, and then cooled to room temperature by 5°C every 6 minutes to obtain nucleic acid-TTVP-lenvatinib nanoparticles, i.e., the hydrophobic drug delivery nanoparticles.

[0035] Sample Analysis Figure 1 The results of dynamic light scattering tests on the nucleic acid-TTVP-sorafenib nanoparticles in Example 1 show that their average particle size is 260 nm.

[0036] Figure 2 The results are obtained by scanning electron microscopy of the nucleic acid-TTVP-sorafenib nanoparticles in Example 1. It is evident that they exhibit good dispersibility and a uniform, intact structure.

[0037] Figure 3 The transmission electron microscopy and elemental analysis results of the nucleic acid-TTVP-sorafenib nanoparticles in Example 1 show that the nanoparticles are composed of nucleic acid, TTVP and sorafenib, and the three components are uniformly distributed in the nanoparticles.

[0038] Nucleic acid-TTVP-sorafenib nanoparticles were prepared according to the method in Example 1, with only the sorafenib loading amount changed, and cytotoxicity tests were performed: 100 μL of mouse hepatocellular carcinoma cell suspension was added to the wells of a 96-well plate, so that the wells contained 1×10⁻⁶ cells / well. 4 Cells were cultured in 96-well plates for 12 hours. The supernatant was then removed, and the plates were washed twice with PBS. 100 μL of nucleic acid-TTVP-sorafenib nanoparticles (containing concentrations of 1.6, 3.2, 6.3, 12.5, 25, 50, and 100 μmol / L, prepared with culture medium, were added to each well and incubated for 24 hours. A blank control was also included. After incubation, the solution was removed, and the plates were washed with PBS. Cell viability was assessed using an MTT assay. The results are shown below. Figure 4 As shown, the results indicate that nucleic acid-TTVP-sorafenib nanoparticles loaded with 12.5 μM sorafenib were able to induce death in more than 50% of murine liver cancer cells, demonstrating a good therapeutic effect.

[0039] The embodiments described above provide a detailed explanation of the technical solutions of the present invention. It should be understood that the above descriptions are merely specific embodiments of the present invention and are not intended to limit the present invention. Any modifications, additions, or similar substitutions made within the scope of the principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A method for preparing nanoparticles for hydrophobic drug delivery, characterized by, The method comprises the following steps: (1) separately preparing a hydrophobic drug organic solution and a TTVP organic solution, mixing the two solutions and removing the organic solvent to obtain a hydrophobic drug-TTVP complex; (2) mixing the hydrophobic drug-TTVP complex with an aqueous nucleic acid solution, performing heat treatment by temperature programming, allowing the hydrophobic drug, the TTVP and the nucleic acid to self-assemble into nanoparticles, and further centrifuging and washing to obtain the hydrophobic drug delivery nanoparticles; The parameters of the heat treatment by temperature programming are as follows: incubation at 70 °C~95 °C for 10~60 minutes, then cooling down to room temperature at a rate of 1 °C~5 °C per 1~10 minutes and keeping constant temperature; The structural formula of the TTVP is as follows: 。 2. The method of claim 1, wherein the hydrophobic drug delivery nanoparticle is prepared by the process comprising: The hydrophobic drug includes sorafenib, lenvatinib, camptothecin, curcumin or sertraline hydrochloride.

3. The method for preparing hydrophobic drug delivery nanoparticles according to claim 1, characterized in that, The organic solvent in the hydrophobic drug organic solution and the TTVP organic solution is selected from methanol, ethanol, N,N-dimethylformamide, chloroform or dichloromethane.

4. The method for preparing hydrophobic drug delivery nanoparticles according to claim 1, characterized in that, When the hydrophobic drug-TTVP complex is prepared, the molar ratio of the hydrophobic drug to the TTVP is 1:1~5.

5. The method for preparing hydrophobic drug delivery nanoparticles according to claim 1, characterized in that, The molar ratio of the amount of the hydrophobic drug to the amount of the nucleic acid is 1~50:

1.

6. The method for preparing hydrophobic drug delivery nanoparticles according to claim 1, characterized in that, The length of the nucleic acid is at least 10 bases.

7. The method for preparing hydrophobic drug delivery nanoparticles according to claim 1, characterized in that, The parameters of the heat treatment by temperature programming are as follows: incubation at 85 °C~95 °C for 20~60 minutes, then cooling down to room temperature at a rate of 3 °C~5 °C per 3~5 minutes and keeping constant temperature.

8. The hydrophobic drug delivery nanoparticles prepared by the method of any one of claims 1-7.

9. A medicament, characterized by comprising a compound of the formula (I) or a pharmaceutically acceptable salt thereof. The hydrophobic drug delivery nanoparticles of claim 8.