An inha gene molecular marker related to chicken muscle ph value character and application thereof
Patent Information
- Application Number
- CN202610219845.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-24
- Publication Date
- 2026-06-26
AI Technical Summary
There are no existing studies on the role of the INHA gene in chicken meat quality traits, especially reports on its correlation with muscle pH, which affects the effectiveness of chicken meat quality breeding.
By screening the C+363T site on exon 2 of the INHA gene in Ningdu Yellow Rooster, it was found that it is significantly associated with the pH value of the breast muscle in chicken meat quality traits. This provides an application of the INHA gene molecular marker in chicken breeding. The site was amplified and sequenced using primer pairs, and the muscle pH value trait was determined based on the genotype.
This provides a theoretical basis for the breeding of chicken meat quality traits, and improves chicken meat quality, especially the pH value of the breast muscle, through genotype screening to meet consumers' demands for meat quality.
Smart Images

Figure CN122279048A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, and in particular to an INHA gene molecular marker related to the pH value trait of chicken muscle and its application. Background Technology
[0002] Inhibin (INH) is a heterodimeric glycoprotein hormone secreted by granulosa cells of the female ovary and Sertoli cells of the male testis. It belongs to the transforming growth factor β superfamily and consists of two distinct subunits, α and β, linked by a disulfide bond. INH plays a crucial role in follicle development, oocyte maturation, and embryonic development. INH exists in two forms: INHA (αβA) and INHB (αβB). INHA and INHB have essentially the same functional activity, and at the amino acid level, they are roughly the same except for significant differences in the content of histidine, isoleucine, and lysine.
[0003] Inhibin (INHA) primarily originates from dominant follicles and luteal cells, produced and secreted by the granulosa layer of large pre-ovulatory follicles. mRNA encoding the α- and βA-subunits is also found in skeletal and cardiac muscle tissues in chickens; simultaneously, βA-subunit mRNA has been detected in small intestinal muscle. The chicken INHA gene is located on chromosome 7, containing two exons and one intron, with a total length of 1679 bp and a coding region of 987 bp, encoding 329 amino acids. Researchers both domestically and internationally have discovered the important regulatory role of inhibin in reproductive function in animals such as pigs, cattle, sheep, and mice, and in chickens, it is also largely related to the growth and reproductive traits of hens. Active immunization against INHA leads to increased ovulation in sheep, pigs, chickens, mice, and cattle. INHA is considered the functional center of inhibin and has the potential to increase ovulation rates in poultry.
[0004] Numerous studies have reported that the INHA gene is closely related not only to human reproductive performance but also to animal reproductive performance. The INHA gene has been confirmed as a major or candidate gene influencing reproductive performance. Single nucleotide polymorphism (SNP) analysis related to chicken reproductive traits has revealed that INHA may be a candidate gene for improving chicken reproductive traits. Gui Taotao et al., through SNP screening, found that INHA may be one of the main genes affecting follicle development, playing a crucial role in chicken follicle development and serving as a suitable molecular marker for selective breeding of egg production. Jin Heng et al., through studying the relationship between INHA gene polymorphism sites in Ningdu Yellow hens and their growth and reproductive traits, and then conducting correlation analysis, found that the INHA gene is closely related to the growth and development of the organism. Currently, domestic and international research on INHA gene polymorphism mainly focuses on growth and reproductive traits, with few reports on its correlation with poultry meat quality traits.
[0005] The quality of poultry meat is determined by its nutritional value, sensory characteristics, and safety. The content of high-value proteins, cholesterol, vitamins, micronutrients, and unsaturated fatty acids in poultry meat determines its nutritional quality, while basic sensory characteristics include meat color, aroma, and flavor. Large-scale broiler production has been achieved; the current focus is on improving meat quality by modifying various characteristics of broilers. Appearance, texture, juiciness, water content, firmness, tenderness, aroma, and flavor are the most important and easily perceived meat characteristics, influencing consumers' initial and final judgments about meat quality before and after purchase. Quantifiable characteristics of meat, such as water retention, shear strength, drip loss, cooking loss, pH value, shelf life, collagen content, protein solubility, viscosity, and fat binding capacity, are essential for processors involved in manufacturing value-added meat products. Commonly used indicators for evaluating chicken meat quality include meat color, tenderness, water loss rate, water-holding capacity, and pH value. With the improvement of people's living standards, the requirements for chicken meat quality are also increasing, making research on the selective breeding of chicken meat quality traits an inevitable trend. Currently, there are no research reports on the role of the INHA gene in chicken meat quality traits. Summary of the Invention
[0006] The purpose of this invention is to provide a molecular marker for the INHA gene related to the pH value trait of chicken muscle and its application, so as to solve the problems existing in the prior art. Through screening, it was found that the C+363T site on exon 2 of the INHA gene of Ningdu Yellow Rooster is significantly related to the pH value of the breast muscle, which is an evaluation index of chicken meat quality traits. This provides a theoretical basis for the breeding of meat quality traits of local chicken breeds and marker-assisted selection.
[0007] To achieve the above objectives, the present invention provides the following solution:
[0008] This invention provides an INHA gene molecular marker related to the pH value trait of chicken muscle. The nucleotide sequence of the INHA gene molecular marker is shown in SEQ ID NO.1. A C / T mutation exists at the 101st base of the molecular marker [i.e., the 363rd base of the CDS sequence of the INHA gene (GenBank accession number: NM_001031257.2)]. The mutation site contains CC and CT genotypes.
[0009] The present invention also provides the application of the INHA gene molecular marker in identifying the pH trait of chicken muscle.
[0010] The present invention also provides the application of the INHA gene molecular marker in chicken breeding, wherein the trait index of chicken breeding is the pH value of chicken muscle.
[0011] Preferably, chickens with the CT genotype have a higher muscle pH than chickens with the CC genotype.
[0012] Preferably, the pH value of the chicken muscle is 16w, which is the pH value of the breast muscle of Ningdu Yellow Rooster.
[0013] The present invention also provides a method for detecting the pH value of chicken muscle, comprising the following steps:
[0014] Genomic DNA was extracted from the chicken to be tested;
[0015] The INHA gene molecular marker was amplified using primer pairs, followed by sequencing. The genotype of the mutation site of the INHA gene molecular marker was analyzed based on the sequencing results, and the muscle pH trait of the chicken to be tested was determined based on the genotype results.
[0016] Preferably, the nucleotide sequences of the primer pair are as shown in SEQ ID NO.2-3.
[0017] Preferably, the muscle pH of chicken individuals with the CT genotype and the mutation site of the INHA gene molecular marker is higher than that of chicken individuals with the CC genotype.
[0018] Preferably, the pH value of the chicken muscle is 16w, which is the pH value of the breast muscle of Ningdu Yellow Rooster.
[0019] The present invention discloses the following technical effects:
[0020] This invention uses 16-week-old Ningdu Yellow Roosters as the research subject to analyze the correlation between exon 2 polymorphism of the INHA gene and meat quality traits. A highly significant (P<0.01) correlation was found between the C+363T locus and the meat quality traits of Ningdu Yellow Roosters, indicating that the INHA gene can serve as a candidate gene affecting the meat quality traits of Ningdu Yellow Roosters. Further analysis revealed a significant correlation between the C+363T locus and the pectoral muscle pH value, a key meat quality trait in Ningdu Yellow Roosters. Furthermore, the pectoral muscle pH value of individuals with the CT genotype at this locus was significantly higher (P<0.01) than that of individuals with the CC genotype. Therefore, this invention can provide a theoretical basis for the breeding and marker-assisted selection of meat quality traits in local chicken breeds at the molecular level. Attached Figure Description
[0021] Figure 1 The results are shown in the electrophoresis detection of the amplification products; M is the standard DNA molecule, and 1-2 are the amplification products.
[0022] Figure 2 This is a peak diagram of polymorphic variant sites in exon 2 of the INHA gene. Detailed Implementation
[0023] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0024] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0025] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0026] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0027] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0028] Example 1
[0029] 1. Test materials and measured properties
[0030] The DNA samples used in this experiment were obtained from a natural population of 499 Ningdu Yellow Roosters preserved in a -20℃ freezer at the Jiangxi Provincial Key Laboratory for Genetic Improvement of Local Chicken Breeds. Meat quality traits of the left breast muscle of the 499 16-week-old Ningdu Yellow Roosters were measured, including pH value, meat color (L represents brightness, a represents redness, and b represents yellowness), shear force, and drip loss at 24 and 48 hours.
[0031] pH value: The portable pH meter (PHBJ-260) was calibrated using standard solutions with pH values of 9.18 and 6.86. Within 45 minutes after slaughter, the probe of the pH meter was inserted into the breast muscle of each chicken, ensuring that the probe was embedded in the muscle. When the pH meter reading stabilized, the reading was recorded. This was repeated three times, and the average value was calculated. Generally, the muscle pH value of chickens with good meat quality will be between 6.0 and 6.5.
[0032] Meat color: The color of the exposed breast muscle cross-section was measured 30 minutes after slaughter using a colorimeter (CHROMA METER CR-400). Muscle brightness (L), redness (a), and yellowness (b) were measured. Each sample was measured three times, and the average value was used for subsequent analysis. Meat color is mainly determined by the state and relative content of myoglobin, oxymyoglobin, and metmyoglobin. Brightness is affected by the pH value of the muscle, the content of myoglobin in the muscle affects redness, and the metabolism of lutein affects yellowness. Measuring the meat color can accurately determine its freshness; freshly slaughtered chicken breast meat is generally bright and light red.
[0033] Shear force: Following the People's Republic of China Agricultural Industry Standard NY / T 1180-2006 "Determination of Meat Tenderness - Shear Force Measurement Method", the sample was placed on the blade groove of a digital display muscle tenderizer, with the muscle fibers perpendicular to the blade direction. The instrument was then started to cut the meat sample, and the maximum shear force (peak value) during the cutting process was measured. Each sample was measured three times, and the average value was used for subsequent analysis. The lower the shear force value, the more tender the muscle meat.
[0034] Drip loss: A rectangular muscle sample (W0) measuring 55 mm in length, 50 mm in width, and 15 mm in thickness was weighed. One end of the meat sample was then tied with a thin thread, pulling the muscle fibers downwards. The sample was sealed in an inflatable plastic bag and hung in a refrigerator at 4°C for 24 hours. After 24 hours, the meat sample (W1) was weighed, and the 24-hour drip loss was calculated as follows: W 24h (%) = (W0 - W1) / W0 * 100%. After storing the meat sample again in the refrigerator for 48 hours under the same conditions, weigh the meat sample again (W2) and calculate the drip loss as W. 48h (%) = (W0-W2) / W0*100%.
[0035] 2. Test methods
[0036] 2.1 Primer design and PCR amplification
[0037] The chicken INHA genome sequence (GenBank accession number: NM_001031257.2) was downloaded from NCBI. Using Genetool software, upstream and downstream primers were designed to amplify a 565 bp fragment containing exon 2 of the INHA gene upstream and downstream. The primer sequences are: F: 5'-GCACGACACCCTGAGCCACT-3' (SEQ ID NO.2), R: 5'-GGGGTGCACGATCCAATTGTC-3' (SEQ ID NO.3). The primers were synthesized by Hunan Qingke Biotechnology Co., Ltd.
[0038] The PCR reaction system was as follows (50 μL): 2 × PCR mix 25 μL, forward and reverse primers 0.4 μL each, DNA template 1.0 μL, ddH2O 23.2 μL.
[0039] The PCR reaction program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 45 s, 35 cycles; final extension at 72℃ for 10 min. The PCR products were analyzed by 1% agarose gel electrophoresis to determine if the fragment size met expectations. The analyzed PCR products were then sent to Hunan Qingke Biotechnology Co., Ltd. for direct sequencing using upstream primers.
[0040] 2.2 Data Statistical Analysis
[0041] Statistical analysis was performed using the SAS 9.0 GLM program, and the model was constructed as follows: Y ij = μ+G i +e ij Among them, Y ij G represents the phenotypic value of the trait, μ is the population mean of the trait, and G is the population mean of the trait. i e represents the genotype effect value. ij The residual effect is random. The association analysis between SNP loci and meat quality traits of Ningdu Yellow Roosters was conducted using the regression and principal component analysis of testicular quality and secondary sexual characteristics at different ages published by Zhou Min et al. Results are expressed as mean ± standard deviation, with P < 0.05 considered statistically significant and P < 0.01 considered highly statistically significant.
[0042] Gene effect analysis methods: Additive effect (a) = (AA-BB) / 2; Dominance effect (d) = AB-(AA+BB) / 2.
[0043] 3. Results and Analysis
[0044] 3.1 Amplification Results
[0045] The electrophoretic detection results of the amplification products are as follows: Figure 1 As shown, after direct sequencing of the PCR product and removal of uncertain upstream and downstream sequences, a 514 bp sequence (SEQ ID NO.1) was obtained. According to the comparison with NCBI (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi), this sequence is the sequence of exon 2 of the INHA gene.
[0046] The sequence shown in SEQ ID NO.1:
[0047] CGTGCGAGCCCACGCAGCCAGACAAGCTGCTGGAGGAAGAAGGCATCTTCACTTACCTCTTCCAGCCCTCGGCGCACGCCCTGAGCCGCACGCTGACATC C GCCCAGCTCTGGTTCTACAGCGGCCCCTCGGCTGCTCCCAACCACTCGGCCCCCGCTGTGCTGACCCTCTCACCGCAGGGCAGGTGCCGGTGGTGGCCACAGCGTCGCGGACACCGGAGCACTGGACCGTGTTTGACTTCGGCCCCGATGCGCTGCCCCAGCTGGCACAGCCGCTCTTTGTGCTCCTGGTGCGCTGCCCCGGCTGC CCCTGCCTGGCCGATGGGGACAAGATGCCCTTCCTGGTGGCCACTACCCGTGCCAAGCAGCCGGGAGGGCTCGCCGCTCCGCCGTGCCCTGGTCGCCGGCTGCGCTCAGCCTGCTGCAGCGCCCATCGGAGGACGTGGCCGCCCACACCAACTGCCGCCGGGCGTCCCTCAACATCTCTTTCGAGGAGCTGGGCTGGGACAATTG.
[0048] In the above sequence, the underlined bases are mutation sites.
[0049] 3.2 Association analysis of exon 2 polymorphism of INHA gene with meat quality traits of Ningdu yellow rooster meat
[0050] Based on screening of exon 2 polymorphism sites in the INHA gene of Ningdu Yellow Rooster, a C / T mutation (abbreviated as C+363T) was found at bp 363 (see...). Figure 2 Furthermore, it showed a highly significant (P<0.01) correlation with the meat quality traits of Ningdu Yellow Rooster, as shown in Table 1.
[0051] Table 1. Association analysis of exon 2 polymorphism in the INHA gene of Ningdu Yellow Rooster with meat quality traits.
[0052]
[0053] Note: In the table, L represents brightness, a represents redness, b represents yellowness, J represents shear strength, and W represents... 24h W represents the water loss over 24 hours. 48h This indicates water loss over 48 hours. ** This indicates that the difference is highly significant. *NS indicates a significant difference, while NS indicates a non-significant difference, and so on.
[0054] 3.3 Association analysis between C+363T locus and meat quality traits
[0055] Association analysis was performed on the C+363T locus with the pectoral muscle texture trait of 499 individuals in a 16-week Ningdu Yellow Rooster population. The results showed a highly significant correlation between the C+363T locus and pH value. Table 2 shows that the pectoral muscle pH value of CT genotype chickens was significantly higher (P<0.01) than that of CC genotype chickens. Since no TT genotype individuals were detected among the 499 individuals, the genetic effect could not be estimated.
[0056] Table 2 Association analysis between C+363T locus and meat quality traits
[0057]
[0058] Note: 'a' indicates an additive effect, and 'd' indicates a dominant effect. Different uppercase letters in the same data indicate extremely significant differences (P < 0.01), different lowercase letters indicate significant differences (P < 0.05), and the same letter indicates no significant differences (P > 0.05).
[0059] The above results indicate that the genotype of the INHA gene C+363T locus affects the expression of meat quality traits in Ningdu Yellow Rooster. Therefore, chicken breeds with superior genotypes can be selected for breeding to provide a certain reference for the selection of meat quality traits in Ningdu Yellow Rooster, and help improve the quality of chicken meat to meet people's needs.
[0060] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A molecular marker for the INHA gene associated with the pH trait of chicken muscle, characterized in that, The nucleotide sequence of the INHA gene molecular marker is shown in SEQ ID NO.
1. A C / T mutation exists at the 101st base of the molecular marker, and the mutation site contains CC and CT genotypes.
2. The application of the INHA gene molecular marker as described in claim 1 in identifying the pH trait of chicken muscle.
3. The application of the INHA gene molecular marker in chicken breeding as described in claim 1, characterized in that, The phenotypic index for chicken breeding is the pH value of chicken muscle.
4. The application as described in claim 2 or 3, characterized in that, Chickens with the CT genotype have a higher muscle pH than chickens with the CC genotype.
5. The application as described in claim 2 or 3, characterized in that, The pH value of the chicken muscle is 16w, which is the pH value of the breast muscle of Ningdu Yellow Rooster.
6. A method for detecting the pH value of chicken muscle, characterized in that, Includes the following steps: Genomic DNA was extracted from the chicken to be tested; The INHA gene molecular marker described in claim 1 is amplified using primer pairs, followed by sequencing. The genotype of the mutation site of the INHA gene molecular marker is analyzed based on the sequencing results, and the muscle pH trait of the chicken to be tested is determined based on the genotype results.
7. The method as described in claim 6, characterized in that, The nucleotide sequences of the primer pairs are shown in SEQ ID NO.2-3.
8. The method as described in claim 6, characterized in that, The mutation site of the INHA gene molecular marker was CT genotype, and the muscle pH of chicken individuals with this mutation was higher than that of chicken individuals with CC genotype.
9. The method as described in claim 6, characterized in that, The pH value of the chicken muscle is 16w, which is the pH value of the breast muscle of Ningdu Yellow Rooster.