Thymosin alpha 1 mutant polypeptides and uses thereof
By replacing specific amino acids and modifying PEG at key sites of thymosin α1, the problems of thermal stability and short half-life of thymosin α1 were solved, resulting in longer serum stability and pharmacokinetic properties, and improved antitumor activity and medication adherence.
Patent Information
- Application Number
- CN202610549807.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-24
- Publication Date
- 2026-06-30
AI Technical Summary
The existing thymosin α1 has poor thermal stability and a short half-life, leading to frequent dosing, which affects medication adherence and treatment efficacy. Furthermore, existing modification strategies may affect immune activity and tissue penetration.
By making specific substitutions at the 15th, 21st, and 27th amino acids of thymosin α1, combined with PEG modification, and using a triple technology platform of AlphaFold-3 structure prediction, FoldX energy calculation, and DUET consensus verification, mutant peptides with improved in vivo pharmacokinetic properties and antitumor activity were constructed for screening and validation.
It significantly improved the serum stability and pharmacokinetic properties of thymosin α1, prolonged its half-life, reduced the dosing frequency, enhanced its antitumor activity, and maintained its immune activity, thus avoiding the shortcomings of existing modification strategies.
Smart Images

Figure CN122302030A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically relating to a novel thymosin α1 mutant polypeptide and its use in the preparation of therapeutic agents for tumors, viral infections, or immune-related diseases. Background Technology
[0002] Thymosin alpha-1 (Tα-1) is an immunomodulatory polypeptide composed of 28 amino acids, with the sequence SDAAVDTSSEITTKDLKEKKEVVEEAEN (molecular weight 3108 Da). Thymosin alpha-1 enhances the antigen-presenting capacity of dendritic cells (DCs) and promotes CD4+ expression by activating the Toll-like receptor 2 / 9 (TLR2 / TLR9) signaling pathway. + / CD8 + T cell proliferation and differentiation play a central role in anti-tumor, antiviral, and immune reconstitution. Clinical studies have confirmed that thymosin α1 can significantly improve the 5-year survival rate of patients with solid tumors (↑23%) and reduce the incidence of lymphopenia caused by radiotherapy and chemotherapy (>40%). However, its widespread application is limited by the following inherent limitations:
[0003] 1. Thermal stability is not outstanding.
[0004] The α-helix structure of natural thymosin α1 is readily unfolded at high temperatures. Natural thymosin α1 is rapidly degraded and eliminated in vivo, resulting in an extremely short plasma half-life. Clinical pharmacokinetic studies have shown that its half-life after subcutaneous administration is only about 1.2 hours. This pharmacokinetic characteristic severely limits the sustained clinical efficacy of thymosin α1. To achieve effective immunomodulation, patients need frequent dosing (e.g., once or even twice daily), significantly reducing medication adherence and increasing the treatment burden. Therefore, developing thymosin α1 derivatives with long half-lives has become crucial for improving its clinical applicability.
[0005] 2. Limitations of chemical modification
[0006] Existing technologies have attempted to extend the in vivo half-life of thymosin α1 through strategies such as PEGylation, PAS tag fusion, Fc fusion, and albumin fusion. Related studies have shown that these strategies can significantly increase the in vivo exposure of thymosin α1 and prolong its circulation time. However, while macromolecular modifications improve pharmacokinetic properties, they may also affect the interaction between thymosin α1 and its receptors or interfaces due to steric hindrance, conformational constraints, or changes in tissue distribution, thereby altering early immune activation kinetics. This effect is not static but depends on the modification site, the size of the modified group, and the linkage mode; therefore, further experimental and in vivo functional studies are needed to evaluate it specifically. In contrast, sequence optimization based on the minimization of the natural backbone holds promise for simultaneously improving stability and maintaining immune activity with less introduction of additional macromolecular burden.
[0007] In addition, fusion protein technology increases molecular weight by up to 10 times, drastically reduces tissue penetration, and is prone to triggering immunogenic reactions; for example, the cost of synthesizing non-natural amino acid insertions increases by 5 times, and the process is complex and difficult to scale up.
[0008] 3. Inefficiency of traditional mutation techniques
[0009] Random mutation screening has a low success rate and is prone to causing loss of activity. In addition, the NMR structure of thymosin α1 (PDB: 2L9I) is difficult to support high-precision energy calculations, which further limits the application of rational design strategies. Summary of the Invention
[0010] The primary objective of this invention is to provide a thymosin α1 mutant polypeptide that significantly improves serum stability, enhances in vivo pharmacokinetic properties, and increases antitumor activity. The mutant polypeptide has an amino acid sequence that is substituted at least once at positions 15, 21, and 27 relative to natural thymosin α1. The sequence of natural thymosin α1 is shown in SEQ ID NO:1. The mutant polypeptide, relative to natural thymosin α1, possesses at least one of the following functions: improved serum stability, enhanced in vivo pharmacokinetic properties, and increased antitumor activity.
[0011] The mutant peptides described in this invention are predicted, screened, and preliminarily verified using a triple technology platform of "AlphaFold-3 structure prediction → FoldX energy calculation → DUET consensus verification".
[0012] Furthermore,
[0013] The improvement of in vivo pharmacokinetic properties includes: prolonging plasma half-life; the tumors include at least one of melanoma, hepatocellular carcinoma, breast cancer, and lung cancer.
[0014] Furthermore,
[0015] The 15th amino acid was replaced by a hydrophobic amino acid, the 21st amino acid was replaced by an aromatic amino acid, and the 27th amino acid was replaced by a positively charged amino acid.
[0016] Preferably, the mutated amino acid at position 15 is selected from Met, Leu, Ile or Val, the mutated amino acid at position 21 is selected from Trp, Phe or Tyr, and the mutated amino acid at position 27 is selected from Arg or Lys.
[0017] More preferably, the mutation includes at least one of the following: D15M, E21W, and E27R.
[0018] More preferably, the mutation includes at least one of the following: a double mutation of D15M and E27R, or a triple mutation of D15M, E21W and E27R.
[0019] Furthermore, the N-terminus of the polypeptide is modified with PEG, preferably with PEG5000.
[0020] A second objective of this invention is to provide a nucleic acid molecule encoding the mutant polypeptide.
[0021] A third objective of this invention is to provide an expression vector comprising the aforementioned nucleic acid molecule.
[0022] Furthermore, the expression vector also contains a control element operably connected thereto;
[0023] Preferably, the control element is selected from one or more of the following groups: enhancer, promoter, terminator.
[0024] A fourth object of the present invention is to provide a host cell comprising the expression vector described above.
[0025] Furthermore, the host cell is a recombinant genetically engineered bacterium, which contains the nucleic acid molecule of the mutant polypeptide mentioned above, or the expression vector mentioned above.
[0026] Preferably, the host cell of the recombinant genetically engineered bacteria is Escherichia coli BL21(DE3).
[0027] A fifth object of the present invention is to provide a pharmaceutical composition comprising the mutant polypeptide and / or a pharmaceutically acceptable carrier thereof.
[0028] A sixth object of the present invention is the use of the pharmaceutical composition in the preparation of medicaments for treating tumors, viral infections, or immune-related diseases.
[0029] The viral infection includes at least one of chronic hepatitis B, HIV, and COVID-19 infection, and the tumor includes at least one of melanoma, hepatocellular carcinoma, breast cancer, and lung cancer.
[0030] The pharmaceutical composition can be prepared into dosage forms suitable for various routes of administration, including but not limited to injection, oral administration, inhalation, nasal administration, or transdermal administration.
[0031] Preferably, the pharmaceutical composition is a dosage form suitable for multiple routes of administration, such as an injection, a lyophilized powder for injection, or a sustained-release injection.
[0032] The beneficial effects of this invention are as follows:
[0033] 1. This invention, through rationally designed mutations at key sites of thymosin α1, reveals that these specific mutations significantly improve serum stability and prolong plasma half-life while maintaining major secondary structural features, overall thermostability, and immunomodulatory activity. The mutant peptide described in this invention exhibits a half-life of 2.9-6.1 hours in rats (compared to 1.2 hours for natural thymosin α1, representing approximately 5.1-fold improvement), optimized pharmacokinetic characteristics, and can significantly reduce the frequency of clinical dosing, thereby improving patient compliance.
[0034] 2. The mutant described in this invention exhibits superior antitumor activity compared to natural thymosin α1 in in vivo models. The pharmaceutical compositions prepared from it contain an effective dose of the thymosin α1 mutant (0.1-10 mg / kg) and a pharmaceutically acceptable carrier (such as physiological saline or mannitol), and are used to prepare drugs for treating tumors (such as breast cancer and lung cancer), autoimmune diseases, or infectious diseases. Experiments show that the D15M mutant achieved a tumor inhibition rate of 58.26% in the MDA-MB-231 tumor-bearing mouse model, with no significant systemic toxicity observed.
[0035] 3. This invention overcomes the shortcomings of existing technologies, such as PEGylation modification weakening immune activation function, fusion protein technology causing a sharp drop in tissue penetration ability and easily triggering immunogenic reactions, and the increased synthesis cost and complex process of non-natural amino acid insertion, making large-scale production difficult. Research has shown that the PEG-modified thymosin α1 mutant of this invention can further improve the half-life without significantly affecting pharmaceutical properties. Attached Figure Description
[0036] Figure 1 Example 2: Purity of natural thymosin α1 and its mutants was determined by HPLC-MS.
[0037] Figure 2 Example 2: Thermal stability of natural thymosin α1 and its mutants.
[0038] Figure 3 Analysis of the properties of the preferred thymosin α1 mutant in Example 2;
[0039] in Figure 3 A: Far-ultraviolet CD spectral characteristics of natural thymosin α1 and its mutants (D15M, E27R, E21W); Figure 3 B: Secondary structure fitting results of natural thymosin α1 and its mutants (D15M, E27R, E21W); Figure 3 C: Serum stability analysis results of natural thymosin α1 and its mutants (D15M, E27R, E21W): Figure 3 D: Stability of natural thymosin α1 and its mutants (D15M, E27R, E21W) in the serum environment.
[0040] Figure 4 Example 3: Pharmacokinetic evaluation of the thymosin α1 mutant in rats;
[0041] in Figure 4 A: Pharmacokinetic curves of natural thymosin α1 and its mutants (D15M, E27R, E21W); Figure 4 B: Area under the curve (AUC) of natural thymosin α1 and its mutants (D15M, E27R, E21W) during drug use. 0–600min ).
[0042] Figure 5 Example 4: Antitumor pharmacodynamic evaluation of thymosin α1 mutant in MDA-MB-231 tumor-bearing mouse model;
[0043] in Figure 5 A: Body weight change curves in tumor-bearing mice after injection of natural thymosin α1 and its mutants (D15M, E27R). Figure 5 B: Tumor volume change curves after injection of natural thymosin α1 and its mutants (D15M, E27R).
[0044] Figure 6 The results of parallel survival rate detection of RAW264.7 cells after treatment with the natural thymosin α1 mutant in Example 5.
[0045] Figure 7 Example 6 shows the results of high-performance liquid chromatography (HPLC) detection of the obtained PEGylated natural thymosin α1 mutant. Detailed Implementation
[0046] The following examples are intended to further illustrate the present invention, but not to limit the invention.
[0047] Example 1:
[0048] The mutant peptides described in this invention were predicted, screened, and preliminarily verified using a triple technology platform of "AlphaFold-3 structure prediction → FoldX energy calculation → DUET consensus verification". The results are shown in Table 1.
[0049] First, a structure-based computational workflow was established for prioritizing candidate mutations. The Tα-1 monomer model predicted by AlphaFold was used as the initial scaffold for computer simulation and comparative analysis.
[0050] Before mutation scanning, the model was repaired to minimize local geometric inconsistencies and improve compatibility with energy-based calculation methods. Subsequently, FoldX software was used to perform systematic single-point substitutions on the peptide sequence, and the free energy change (ΔΔG) of each amino acid substitution relative to the parent sequence was estimated. Because Tα-1 is a short-chain peptide with dynamic conformational changes, rather than a typical globular protein, these values cannot be directly interpreted as absolute folding energy parameters. Their primary application is in relative ordination analysis.
[0051] To avoid over-reliance on a single prediction framework, the selected variants were further evaluated using the DUET consensus stability prediction platform. Variants showing consistently favorable trends in both FoldX and DUET were prioritized for experimental validation. In this invention, the computational steps primarily serve to narrow down the sequence spatial range, rather than directly providing structural or mechanistic evidence. In summary, this invention employs both FoldX and DUET tools to assess mutation-related energy trends and prioritizes candidate substitution sites for experimental validation.
[0052]
[0053] Example 2: Design and Construction of Thymosin α1 Mutant
[0054] 1. Based on the results obtained in Example 1, this embodiment uses thymosin α1 (Tα-1) as a template and designs site-directed mutagenesis at amino acid positions 15, 21, and 27 to construct a series of thymosin α1 mutant expression vectors. The mutants include: D15M mutant, D15L mutant, D15I mutant, E21W mutant, E27R mutant, E27K mutant, D15M / E21W double mutant, E21W / E27R double mutant, D15M / E27R double mutant, and D15M / E21W / E27R triple mutant.
[0055] The coding sequence for natural thymosin α1 was optimized for expression in *E. coli*, and its nucleotide sequence is as follows:
[0056] AGCGACGCGGCGGTGGACACCAGCAGCGAAATCACCACCAAAGACCTGAAAGAAAAAAAAGAAGTGGTGGAAGAAGCGGAAAAC (SEQ ID NO:2), wherein the target polypeptide sequence corresponding to the expression product encoded by SEQ ID NO:2 is the thymosin α1 sequence shown in SEQ ID NO:1:
[0057] SDAAVDTSSEITTKDLKEKKEVVEEAEN.
[0058] Based on SEQ ID NO: 2, site-specific substitutions were performed on the corresponding codons to obtain the coding sequences of each mutant. The key mutation sites and codon changes are shown in Table 2 below.
[0059]
[0060] The above-mentioned natural and mutant coding sequences and vector construction were all completed by Shanghai Sangon Biotech Co., Ltd., and were respectively constructed into the pET-28a(+) expression vector. After construction, the resulting recombinant plasmids were sequenced to verify that the inserted sequences and mutation sites were correct.
[0061] 2. Induced expression of natural thymosin α1 and its mutants
[0062] The naturally occurring thymosin α1-pET-28a(+) expression vector and the various mutant pET-28a(+) expression vectors, which were verified by sequencing, were transformed into Escherichia coli BL21(DE3) competent cells. Single colonies were picked and inoculated into 50 mL LB broth containing 50 μg / mL kanamycin and cultured at 37°C and 200 rpm for 16 h with shaking to obtain the seed culture.
[0063] Transfer the seed culture to 400 mL LB liquid medium containing 50 μg / mL kanamycin at a 1% (v / v) inoculation rate and continue culturing at 37°C and 200 rpm for 2–4 h. Monitor the absorbance (OD) of the bacterial culture at 600 nm. 600 When OD 600 When the concentration reached 0.6-0.8, IPTG was added to a final concentration of 0.5 mM, and expression was induced for 16-20 h at 16℃ and 200 rpm.
[0064] 3. Purification of natural thymosin α1 and its mutants
[0065] After induction, the bacterial culture was centrifuged at 12,000 rpm for 10 min, and the bacterial pellet was collected. The bacterial cells were resuspended in lysis buffer [20 mM Tris-HCl, pH 8.0, 500 mM NaCl, 20 mM imidazole] and sonicated under the following conditions: 300 W power, 3 s sonication, 5 s interval, total processing time 30 min. After centrifugation of the lysate, the supernatant was collected.
[0066] The obtained supernatant was loaded onto a nickel affinity chromatography column and washed with the lysis buffer described above to remove contaminating proteins. Elution was then performed with elution buffer [20 mM Tris-HCl, pH 8.0, 500 mM NaCl, 250 mM imidazole], and the elution fraction containing the target product was collected. The eluent was then replaced with PBS buffer (pH 7.4) to obtain the corresponding recombinant peptide product.
[0067] 4. Thermal stability testing of natural thymosin α1 and its mutants
[0068] The thermal stability of each sample was assessed using differential scanning fluorometry (DSF, or Thermal Shift Assay). The peptide samples were mixed with the fluorescent dye SYPRO Orange and then subjected to temperature gradient scanning in a real-time quantitative PCR instrument, ranging from 25°C to 95°C, with a heating rate of 1°C / min. The apparent melting temperature (Tm value) of each sample was calculated by monitoring the fluorescence signal versus temperature curve. Three technical replicates were performed for each sample.
[0069] 5. Structural characterization and serum stability assay of natural thymosin α1 and three mutants
[0070] To characterize the structural properties, thermal stability, and in vitro anti-degradation ability of the thymosin α1 mutant, the following analyses were performed.
[0071] (1) Secondary structure analysis
[0072] Purified natural thymosin α1 (Tα-1) and its mutants (D15M, E27R, and E21W) were diluted to the same concentration (0.2 mg / mL) with PBS buffer (pH 7.4). Circular dichroism spectroscopy (CD) was used to scan the samples in the far-ultraviolet region at room temperature, recording the CD spectra in the range of 190–260 nm. The secondary structure composition of each sample was calculated using the accompanying analysis software.
[0073] (2) Serum stability analysis
[0074] To further evaluate the stability of each sample in a body fluid environment, natural thymosin α1 (Tα-1) and its mutants (D15M, E27R, and E21W) were added to a 50% rat serum system and incubated at 37°C. Samples were taken at different time points. Immediately after sampling, ice-cold acetonitrile was added to terminate the reaction, the precipitate was removed by centrifugation, and the supernatant was collected for analysis by reversed-phase high-performance liquid chromatography (RP-HPLC). The peak area of intact peptide at 0 h was recorded as 100%, and the percentage of intact peptide remaining at each time point was calculated to evaluate its serum stability.
[0075] result:
[0076] (1) The recombinant polypeptide products obtained after purification of natural thymosin α1 and its mutants were analyzed by HPLC-MS and the purity was greater than 95%, see [reference]. Figure 1 It can be used for subsequent structural characterization, thermal stability analysis, serum stability analysis, and in vivo pharmacodynamic evaluation.
[0077] (2) The Tm value of natural thymosin α1 (Tα-1) is approximately 42.0℃. Compared with natural thymosin α1, the Tm values of the three mutants at the D15 site and the three mutants at the E27 site are basically maintained at similar levels, and they show a certain degree of enhanced stability. The E21W mutant also has comparable stability to natural thymosin α1. Figure 2 As shown, the results indicate that the D15 and E27 site mutants exhibit enhanced thermal stability compared to the natural thymosin α1, suggesting that the mutations did not significantly degrade the stability of the polypeptide structure. The three mutation sites with the most pronounced stability enhancements were preferably selected for further verification.
[0078] (3) Secondary structure:
[0079] As attached Figure 3 A and Appendix Figure 3 As shown in Figure B, natural thymosin α1 and its mutants (D15M, E27R, and E21W) all exhibit similar far-UV CD spectral characteristics, with a largely consistent main peak distribution. Secondary structure fitting results show that all samples maintain a high proportion of α-helical structures, approximately 70%-80%, while the proportion of random coils is low, approximately 10%-20%. These results indicate that the mutations at the aforementioned key sites did not disrupt the natural secondary structure characteristics of thymosin α1, and the overall conformation of the polypeptide remained stable.
[0080] (4) Serum stability analysis results:
[0081] As attached Figure 3As shown in Figure C, at 0 h, the corresponding complete polypeptide chromatographic peaks of natural thymosin α1 and each mutant could be detected. After incubation with serum at 37°C for 4 h, the complete peak areas of natural thymosin α1 and E21W mutant were significantly reduced, while E27R and D15M mutants still retained relatively obvious complete polypeptide peaks, with D15M retaining the most significant peaks.
[0082] Furthermore, as shown in the appendix Figure 3 As shown in Figure D, quantitative analysis based on the remaining percentage of intact peptides revealed that the degradation rates of the D15M and E27R mutants in serum were significantly lower than those of native thymosin α1, with D15M exhibiting the best serum stability. In contrast, the E21W mutant showed little difference from native thymosin α1. These results indicate that, without compromising the native conformation and thermal stability, the D15M and E27R mutations can effectively improve the stability of thymosin α1 in the serum environment and enhance its anti-degradation ability, providing experimental evidence for subsequent in vivo half-life extension and efficacy enhancement.
[0083] Example 3: Pharmacokinetic evaluation of thymosin α1 mutant in rats
[0084] To evaluate the in vivo stability of the thymosin α1 mutant, the following pharmacokinetic experiments were conducted.
[0085] Animal Model and Drug Administration: Healthy male SD rats (SPF grade, weighing 200-250 g, Hunan Silek Jingda Experimental Animal Co., Ltd.) were used. The animals were randomly divided into four groups (natural thymosin α1 group, E27R mutant group, D15M mutant group, and E21W mutant group), with five rats in each group. After acclimatization under standard conditions for 3 days, the animals were administered a single subcutaneous injection. The dose of the thymosin α1 mutant in Example 1 was 2 μg / kg.
[0086] Sample collection and testing: Approximately 0.5 mL blood samples were collected via the retro-orbital venous plexus before administration (0:00) and at 30, 60, 120, 180, 240, 360, and 600 minutes after administration. The samples were placed in heparin sodium anticoagulant tubes and centrifuged at 3000 rpm for 10 minutes at 4°C to separate the plasma. The concentration of thymosin α1 in the plasma was determined using a commercially available thymosin α1 ELISA kit, strictly following the instructions.
[0087] Data analysis: Pharmacokinetic parameters were calculated using DAS 3.0 pharmacokinetic software with a non-compartmental model. All data are expressed as mean ± standard deviation (Mean ± SD). One-way ANOVA was used for comparisons between groups, and p < 0.01 was considered statistically significant.
[0088] Results: The main pharmacokinetic parameters are shown in Table 3 below.
[0089]
[0090] Note: This indicates that compared with the natural thymosin α1 group, p < 0.01.
[0091] Figure 4 Analysis showed that the mutants all had advantages over the natural thymosin α1, especially the elimination half-life (t) of the E27R and D15M mutants. 1 / 2 The time to peak efficacy was extended to 2.9 hours and 6.1 hours, respectively, which were 2.4-5.1 times higher than that of the natural mutant (1.2 hours), and the differences were statistically significant (p < 0.01). Simultaneously, the time to peak efficacy (Tmax) of the mutant was significantly delayed, and the area under the curve (AUC) was significantly increased. 0–600min The significantly increased levels of E27R and D15M mutants indicate a substantial improvement in in vivo stability and a significant increase in exposure. Subsequent tumor suppression examples were grouped using the preferred E27R and D15M mutants.
[0092] Example 4: Antitumor pharmacodynamic evaluation of thymosin α1 mutant in MDA-MB-231 tumor-bearing mouse model
[0093] To evaluate the in vivo antitumor activity of the thymosin α1 mutant, the following pharmacodynamic experiments were conducted.
[0094] Model construction: Female BALB / c nude mice (SPF grade, 6-8 weeks old) were selected and subcutaneously inoculated with human breast cancer cells MDA-MB-231 (5 × 10⁶ cells per mouse) in the right axilla. 5 (1 cell) to establish a tumor-bearing model.
[0095] Grouping and Administration: When the tumor volume grew to approximately 100 mm³, mice were randomly divided into four groups (PBS solvent control group, natural thymosin α1 group, E27R mutant group, and D15M mutant group), with five mice in each group. Mice were administered the drug subcutaneously once daily at a dose of 10 μg / kg (based on peptide mass) for 12 days. The solvent control group received an equal volume of PBS.
[0096] Detection indicators: Tumor diameter (major diameter a and minor diameter b) was measured every 2 days using calipers, and tumor volume was calculated (V = 0.5 × a × b²). At the end of the experiment, mice were euthanized by cervical dislocation, tumors were dissected and weighed, and the tumor growth inhibition rate (TGI) was calculated. Tumor inhibition rate (%) = (1 - average tumor volume in the drug treatment group / average tumor volume in the solvent control group) × 100%. Mouse weight was recorded daily to assess drug safety.
[0097] result:
[0098] Tumor inhibition effect: The tumor volume and tumor inhibition rate of each group at the experimental endpoint are shown in Table 4 below.
[0099]
[0100] Figure 5 The results showed that, compared with the PBS group, both natural thymosin α1 and its mutants could inhibit tumor growth in tumor-bearing mice. Among them, the D15M mutant group had the lowest tumor volume at the endpoint and the most significant tumor-inhibiting effect; the E27R mutant group also showed superior tumor-inhibiting activity compared to natural thymosin α1. Based on the endpoint volume, the tumor inhibition rates of the thymosin α1 group, the E27R group, and the D15M group were 40.27%, 48.09%, and 58.26%, respectively. The overall body weight of the mice in each group remained stable, and no obvious toxic reactions were observed.
[0101] In addition, to evaluate the effects of natural thymosin α1 and its mutants on the viability of RAW264.7 cells, RAW264.7 mouse macrophages were cultured in DMEM supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin at 37°C in a humidified incubator containing 5% carbon dioxide. Cells were cultured at a density of 2 × 10⁶ cells per well. 5 RAW264.7 cells were seeded at a density of [number] cells per well in 24-well plates and allowed to adhere overnight. RAW264.7 cells were treated with 100 ng / mL of native Tα-1, E27R, or D15M for 24 hours. CCK-8 reagent was added, and absorbance at 450 nm was recorded. Cell viability was normalized to the PBS control group and expressed as a percentage. Parallel viability assays in RAW264.7 cells showed no significant decrease in viability compared to the PBS control group; results are shown in [see attached table]. Figure 6 .
[0102] Example 5: Preparation of N-terminal PEGylated thymosin α1 analog
[0103] Take thymosin α1 polypeptide or its mutant, wherein the amino acid sequence of the polypeptide is as follows:
[0104] SDAAVDTSSEITTKDLKEKKEVVEEAEN
[0105] Or a mutant thereof containing one or more amino acid substitutions, dissolved in PB buffer (50 mM, pH=7.0), and threonine or serine is introduced at the N-terminus of the peptide.
[0106] Since the N-terminus of the peptide is a serine residue, its N-terminus was oxidized using sodium periodate. A 1 mg / mL NaIO4 solution was added at a NaIO4 to peptide molar ratio of 2:1, and the reaction was carried out at 4°C in the dark for 30 min. After the reaction was complete, 100 μL of ethylene glycol was added to terminate the reaction. The reaction solution was then added to a GEG25 desalting column for desalting, and the peptide peak was collected to obtain an oxidized thymosin α1 intermediate with an N-terminal aldehyde group.
[0107] Add mPEG hydrazide (mPEG5k-HZ) with a molecular weight of 5000 Da to the above oxidation product, control the molar ratio of mPEG5k-HZ to the peptide to be 5:1, and add 5 mM sodium cyanoborohydride as a reducing agent. The reaction is carried out under shaking conditions at pH 4.5 and 4℃ for 4 h to allow PEG to undergo a coupling reaction with the oxidized N-terminal aldehyde group.
[0108] After the reaction was completed, the reaction solution was separated by chromatography using a GE Superdex 75 10 / 300 GL column. The mobile phase was a Na2SO4 buffer system containing 20 mM PB (0.1 M, pH = 7.4), and the flow rate was 0.6 mL / min. The target peak was collected at a detection wavelength of 220 nm. The collected sample was aliquoted and lyophilized to obtain the N-terminal PEGylated thymosin α1 analog.
[0109] The obtained product was detected by high-performance liquid chromatography, thus proving the successful acquisition of the target PEGylated product. The results are shown in the figure. Figure 7 .
[0110] To evaluate the in vivo stability of the modified thymosin α1 mutant, the following pharmacokinetic experiments were conducted.
[0111] Animal Model and Drug Administration: Healthy male SD rats (SPF grade, weighing 200-250 g, Hunan Silek Jingda Experimental Animal Co., Ltd.) were used. The animals were randomly divided into 8 groups (natural thymosin α1 group, mPEG5000-natural thymosin α1 group, E27R mutant group, mPEG5000-E27R group, D15M mutant group, mPEG5000-D15M group, E21W mutant group, and mPEG5000-E21W group), with 5 rats in each group. After acclimatization under standard conditions for 3 days, the animals were administered a single subcutaneous injection at a dose of 2 μg / kg.
[0112] Sample collection and testing: Approximately 0.5 mL blood samples were collected via the retro-orbital venous plexus before administration (0:00) and at 0.5, 1, 1.5, 2, 4, 6, 8, 10, 12, and 24 hours after administration. The samples were placed in heparin sodium anticoagulant tubes and centrifuged at 3000 rpm for 10 minutes at 4°C to separate the plasma. The concentration of thymosin α1 in the plasma was determined using a commercially available thymosin α1 ELISA kit, strictly following the instructions.
[0113] Data analysis: Pharmacokinetic parameters were calculated using DAS 3.0 pharmacokinetic software with a non-compartmental model. All data are expressed as mean ± standard deviation (Mean ± SD). One-way ANOVA was used for comparisons between groups, and p < 0.01 was considered statistically significant. Results are shown in Table 5.
[0114]
[0115] Note: Indicates a comparison with the corresponding unmodified group.
[0116] Example 6: Evaluation of the binding of N-terminal PEGylated thymosin α1 analog to TLR9 protein
[0117] To evaluate the effect of PEG modification on the binding ability of thymosin α1 and its mutants to TLR9 protein, microscale thermophoresis (MST) was used to detect the epigenetic binding ability of natural thymosin α1 (Tα-1), D15M, E27R, E21W and their corresponding N-terminal PEGylated products to recombinant TLR9 protein.
[0118] Recombinant TLR9 extracellular domain protein was labeled with a fluorescent labeling reagent. After removing the free dye, the labeled protein was diluted to a final concentration of 25 nM. Samples of PBS, Tα-1, D15M, E27R, E21W, mPEG5000-Tα-1, mPEG5000-D15M, mPEG5000-E27R, and mPEG5000-E21W were prepared using a 1:1 serial dilution method to obtain different concentration gradients, with the preferred final concentration range being 0.003–100 μM. An equal volume of labeled TLR9 protein was mixed with each concentration sample, incubated at room temperature for 30 min, and then aspirated into a standard capillary tube for detection using a micro-thermophoresis apparatus. Binding curves were fitted using fluorescence normalization values, and the apparent dissociation constant (Kd) between each sample and TLR9 protein was calculated. The PBS group served as a negative control, used only for signal baseline correction and not involved in Kd fitting.
[0119] The results showed that both natural thymosin α1 and its mutants could exhibit detectable interactions with TLR9 protein. The PEG-modified thymosin α1 analogs retained their binding ability to TLR9, but their apparent affinity was lower than that of the unmodified peptide, suggesting that the introduction of the large PEG chain may have created steric hindrance. In contrast, the D15M, E27R, and E21W mutants described in this invention maintained an apparent binding ability comparable to or similar to that of natural thymosin α1 in their unmodified state.
[0120] For example, the apparent dissociation constants (Kd) for each group are shown in Table 6 below:
[0121]
[0122] Note: This indicates that the apparent Kd is increased compared to the corresponding unmodified group.
[0123] The above results indicate that the epigenetic binding capacity of thymosin α1 and its mutants was weakened after PEG modification, suggesting that the PEG chain may create some steric hindrance at the receptor recognition interface; however, this type of modification did not completely eliminate its binding capacity with TLR9. Subsequent in vivo cytokine kinetic experiments further demonstrate that although PEG modification may weaken the peak activation intensity in the short term, it still helps to improve the overall sustained immune stimulation effect by significantly prolonging the in vivo exposure time.
[0124] Example 7: Evaluation of serum cytokine kinetics at 4 h and 24 h after administration of N-terminal PEGylated thymosin α1 analog
[0125] To further evaluate the effects of PEG modification on the in vivo immune activation kinetics of thymosin α1 and its mutants, a single-dose rat model was used to detect serum levels of inflammation / immunity-related cytokines at 4 h and 24 h after administration.
[0126] Healthy male SD rats were randomly divided into 9 groups: PBS control group, Tα-1 group, D15M group, E27R group, E21W group, mPEG5000-Tα-1 group, mPEG5000-D15M group, mPEG5000-E27R group, and mPEG5000-E21W group, with 5 rats in each group. All treatment groups were administered the drug subcutaneously, with a preferred dose of 2 μg / kg. Blood samples were collected from the retro-orbital venous plexus at 4 h and 24 h post-administration. Serum was separated, and IFN-γ and IL-2 levels were detected using an ELISA kit.
[0127] The results showed that natural thymosin α1 and its mutants induced a significant increase in early cytokines 4 h after administration, with the D15M and E27R groups showing higher levels of early activation. In contrast, the PEG-modified group showed a lower increase in cytokines at 4 h than the corresponding unmodified group, suggesting that PEG modification may weaken the peak activation capacity within a short time window.
[0128] However, 24 hours after administration, the levels of most cytokines induced by natural thymosin α1 and its mutants had significantly decreased, while the PEG-modified groups, especially the mPEG5000-D15M and mPEG5000-E27R groups, maintained higher levels. These results indicate that although PEG modification may initially reduce transient receptor-driven signaling due to steric hindrance or conformational constraints, it significantly prolongs the in vivo circulation time, maintaining effective immune stimulation over a longer timescale, thus generally contributing to improved sustained efficacy.
[0129] For example, the detection results of IFN-γ and IL-2 in each group are shown in the table below.
[0130]
[0131]
[0132] Note: This indicates a comparison with the corresponding unmodified group.
[0133] The above results indicate that PEG-modified thymosin α1 and its mutants exhibited a decrease in the peak cytokine activation in the early post-drug administration period, but a significantly prolonged activation duration. In particular, the mPEG5000-D15M and mPEG5000-E27R groups maintained high IFN-γ and IL-2 levels even after 24 h, demonstrating superior sustained immunostimulatory capacity. This result is consistent with the pharmacokinetic trend of PEG modification significantly prolonging the half-life, suggesting that the short-term decrease in binding capacity caused by PEG modification can be compensated to some extent by a longer in vivo exposure time, ultimately contributing to improved overall efficacy.
Claims
1. A thymosin α1 mutant polypeptide, characterized in that, The amino acid sequence of the mutant polypeptide is substituted at least once at the 15th, 21st, and 27th amino acid positions relative to natural thymosin α1, and the sequence of natural thymosin α1 is shown in SEQ ID NO:
1. The mutant polypeptide has at least one function relative to natural thymosin α1, namely, improving serum stability, improving in vivo pharmacokinetic properties, and improving antitumor activity. Further, the improvement of in vivo pharmacokinetic properties includes: prolonging plasma half-life; the tumor includes at least one of breast cancer, lung cancer, liver cancer, or melanoma.
2. The mutant polypeptide according to claim 1, characterized in that, The 15th amino acid was replaced by a hydrophobic amino acid, the 21st amino acid was replaced by an aromatic amino acid, and the 27th amino acid was replaced by a positively charged amino acid.
3. The mutant polypeptide according to claim 2, characterized in that, The mutated amino acid at position 15 is selected from Met, Leu, Ile, or Val; the mutated amino acid at position 21 is selected from Trp, Phe, or Tyr; and the mutated amino acid at position 27 is selected from Arg or Lys.
4. The mutant polypeptide according to claim 1, characterized in that, The mutations include at least one of the following: D15M, E21W, and E27R.
5. The mutant polypeptide according to claim 1, characterized in that, The mutant is at least one of the following: a double mutation of D15M and E27R, or a triple mutation of D15M, E21W and E27R.
6. The mutant polypeptide according to any one of claims 1–5, characterized in that, The polypeptide further includes chemical modifications, preferably PEG modifications.
7. A nucleic acid molecule encoding the mutant polypeptide of any one of claims 1–6, or an expression vector or host cell containing said nucleic acid molecule.
8. A pharmaceutical composition comprising the mutant polypeptide of any one of claims 1–6 and / or a pharmaceutically acceptable carrier thereof.
9. The pharmaceutical composition according to claim 8, characterized in that, The pharmaceutical composition is a dosage form suitable for multiple routes of administration, including at least one of the following: injection, oral administration, inhalation, nasal administration, and transdermal administration.
10. Use of the mutant polypeptide of any one of claims 1–6 or the pharmaceutical composition of claim 8 in the preparation of a medicament for treating a disease, wherein the disease is selected from tumors, viral infections or immune-related diseases, preferably breast cancer, lung cancer, liver cancer or melanoma.