A solid-state fermentation method for directional high-yield acid-soluble protein and cellulose degradation of distiller's grains and a strain

By using the directional fermentation method of Aspergillus niger strain, the degradation rate of acid-soluble protein and cellulose in distillers' grains is improved, which solves the problems of low acid-soluble protein and insufficient cellulose degradation in existing technologies. This method produces high-efficiency feed ingredients for monogastric animals, achieving high protein nutritional conversion and improved palatability.

CN122303050APending Publication Date: 2026-06-30GUIZHOU MAOTAI DISTILLERY (GRP) CIRCULAR ECONOMY IND INVESTMENT & DEV CO LTD +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
GUIZHOU MAOTAI DISTILLERY (GRP) CIRCULAR ECONOMY IND INVESTMENT & DEV CO LTD
Filing Date
2026-04-17
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

Existing distillers' grains fermentation technology suffers from low acid-soluble protein content, poor feed palatability, low protein nutrient conversion efficiency, and insufficient cellulose degradation rate, making it difficult to become a high-quality feed ingredient for monogastric animals.

Method used

A method for targeted high-yield acid-soluble protein and cellulose degradation of distillers' grains was developed using the Aspergillus niger strain (GXGD-YZ-2548). The strain was inoculated into Moutai and Zunpeng distillers' grains for activation culture and solid-state fermentation. The pH value was adjusted and the temperature was controlled to prepare fermented distillers' grains products with high acid-soluble protein production.

Benefits of technology

It significantly increases the proportion of acid-soluble protein to 8.45%, crude protein content to 30%, and in vitro protein digestibility to 56.4%. It eliminates inhibitory factors in distillers' grains, improves palatability, adapts to the digestive characteristics of monogastric animals, enhances feed nutrient conversion efficiency, and is simple and easy to industrialize.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122303050A_ABST
    Figure CN122303050A_ABST
Patent Text Reader

Abstract

This invention relates to the field of fermented feed technology, specifically to a method and strain for solid-state fermentation of distillers' grains that simultaneously promotes high production of acid-soluble proteins and degrades cellulose. The core objective of this invention is to directionally increase the content and proportion of acid-soluble proteins. By screening suitable fermentation strains and using Moutai distillers' grains as the sole seed substrate and Zunpeng distillers' grains as the sole fermentation substrate, the invention increases crude protein content and directionally induces the conversion of proteins in the distillers' grains into acid-soluble proteins while reducing the cellulose content. This improves the sensory characteristics of the distillers' grains, eliminates microbial inhibitory factors, and achieves efficient activation of the protein nutrition in the distillers' grains. It has significant industrial application value and practical significance for enhancing the feed value of distillers' grains, developing high-quality protein feed for monogastric animals, and promoting the resource utilization of brewing by-products.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of fermented feed technology, specifically to a method and strain for solid-state fermentation of distiller's grains that produces high-yield acid-soluble proteins while simultaneously degrading cellulose. Background Technology

[0002] As a major byproduct of the brewing industry, baijiu (Chinese liquor) lees are rich in residual protein, carbohydrates, and other nutrients, making them a highly promising feed ingredient. Their efficient resource utilization is crucial for reducing raw material costs in the feed industry and promoting the recycling of solid waste from the brewing process. In the utilization of protein nutrients in baijiu lees, the proportion and content of acid-soluble proteins (including small peptides, free amino acids, and other small molecule proteins) are the core indicators determining the feeding value of baijiu lees. Compared to large-molecule crude protein, acid-soluble proteins can be directly absorbed and utilized by monogastric animals (such as pigs and poultry). The absorption process is energy-efficient and can exert biological value such as immune regulation and promoting intestinal health, making it a high-quality protein source in monogastric animal feed. In addition, baijiu lees also contain a certain amount of lignocellulose. Targeted degradation of lignocellulose can promote the release of encapsulated nutrients and further convert them into high-quality microbial protein.

[0003] Monogastric animals (such as pigs and poultry) have relatively short digestive tracts and limited ability to enzymatically break down large-molecule crude proteins. If the acid-soluble protein content in their feed is insufficient, the animals must expend a large amount of energy to digest and break down the protein, which not only reduces nutrient conversion efficiency but also easily leads to digestive problems such as nutritional diarrhea, significantly impacting farming efficiency. Therefore, developing feeds specifically for monogastric animals and increasing the proportion of acid-soluble proteins in the raw materials is the key to achieving efficient utilization of protein nutrition.

[0004] Existing technologies related to distillers' grains fermentation primarily focus on increasing the total crude protein content, completely neglecting the core issue of targeted protein transformation. These processes lack designs for inducing acid-soluble protein formation and do not use the proportion of acid-soluble protein as an evaluation indicator of fermentation effectiveness. Consequently, even with increased crude protein content, the proportion of acid-soluble protein in distillers' grains processed using current methods remains low, failing to meet the needs of monogastric animals for high-quality small-molecule proteins. The nutritional value of the protein in distillers' grains is not fully realized. Furthermore, residual organic acids and fusel oils in the grains not only produce a pungent, sour odor, reducing feed palatability, but also significantly inhibit the growth and reproduction of fermenting microorganisms, further limiting the efficiency of protein conversion during fermentation. This makes it difficult for existing distillers' grains fermentation products to become high-quality feed ingredients for monogastric animals.

[0005] Therefore, there is an urgent need to find and develop a solid-state fermentation process and strain of distiller's grains that aims to increase the content and proportion of acid-soluble proteins while also degrading cellulose. Summary of the Invention

[0006] The technical problem to be solved by the present invention is to address the shortcomings of the existing technology, such as low proportion of acid-soluble protein, poor feed palatability, low conversion efficiency of protein nutrition during the fermentation of distiller's grains, difficulty in becoming feed raw material for monogastric animals, and insufficient cellulose degradation rate. The present invention provides a solid-state fermentation method for distiller's grains that can produce acid-soluble protein in a targeted manner while simultaneously degrading cellulose.

[0007] The technical problem that this invention also aims to solve is to provide the fermented lees product prepared by the solid-state fermentation method of the lees.

[0008] Another technical problem to be solved by the present invention is to provide the application of the fermented distillers' grains product in the preparation of monogastric animal feed.

[0009] The technical problem that this invention also aims to solve is to provide a strain that can selectively produce high levels of acid-soluble proteins while simultaneously degrading cellulose.

[0010] The final technical problem to be solved by this invention is to provide the application of the strain in solid-state fermentation of distiller's grains.

[0011] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows:

[0012] In a first aspect, the present invention provides a method for solid-state fermentation of distiller's grains that produces high yields of acid-soluble proteins while simultaneously degrading cellulose. Using Maotai distiller's grains as the sole seed substrate and Zunpeng distiller's grains as the sole fermentation substrate, Aspergillus niger strain is inoculated into Maotai distiller's grains for activation and culture, and then transferred to Zunpeng distiller's grains for solid-state fermentation culture, thereby obtaining a fermented distiller's grains product that produces high yields of acid-soluble proteins while simultaneously degrading cellulose.

[0013] The Aspergillus niger strain is classified as Aspergillus niger, strain number GXGD-YZ-2548, and was deposited on March 9, 2026 at the Guangdong Provincial Center for Microbial Culture Collection, with accession number GDMCC No: 67893, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0014] Specifically, the Aspergillus niger strain was retrieved from the Aspergillus niger strain library, cultured and propagated, and screened through spore counting and protein content detection.

[0015] Specifically, the Aspergillus niger strain exhibits black spores, no exudate production, no soluble pigment production, uniform colony texture, velvety surface, clear edges, and relatively consistent colony size and shape on PDA plates.

[0016] Specifically, the ITS sequence information of the Aspergillus niger strain is shown in SEQ ID NO.1.

[0017] The Maotai lees and Zunpeng lees mentioned above both come from Guizhou Maotai Distillery (Group) Circular Economy Industry Investment and Development Co., Ltd., a subsidiary of Guizhou Maotai Distillery Co., Ltd.

[0018] The inoculation dosage is 1~5×10⁻⁶. 8 Spores / Dry substrate.

[0019] In some embodiments of the present invention, the inoculation dose is 2 × 10⁻⁶. 8 Spores / Dry substrate.

[0020] The pH value of the Maotai lees and Zunpeng lees is adjusted to 4.0~5.0.

[0021] In some embodiments of the present invention, the pH value of the Maotai lees is adjusted to about 4.5 using a weak alkaline solution of NaOH.

[0022] In some embodiments of the present invention, the pH value of the Zunpeng lees is adjusted to 4.7.

[0023] The activation culture is carried out under the following conditions: activation culture at a constant temperature of 30~32℃ for 5~8 days.

[0024] The transfer involves an inoculation dose of 2 × 10⁻⁶. 8 Spores / Dry substrate.

[0025] The solid-state fermentation culture is carried out under the following conditions: solid-state fermentation at a constant temperature of 30~32℃ for 2~4 days.

[0026] Secondly, the present invention provides fermented lees products prepared by the solid-state fermentation method of the first aspect.

[0027] The fermented lees product contains ≥8.45% acid-soluble protein, ≥30% crude protein, and ≥56.4% in vitro protein digestibility. The product is uniformly grayish-brown, has a typical fermented aroma, and is not pungent.

[0028] Thirdly, the present invention provides the application of the fermented distillers' grains product described in the second aspect in the preparation of monogastric animal feed.

[0029] The monogastric animal is a pig or a poultry, and the poultry includes chickens, ducks, and geese.

[0030] Fourthly, the present invention provides a strain that can selectively produce high levels of acid-soluble proteins while simultaneously degrading cellulose.

[0031] The strain in question is an Aspergillus niger strain, classified and named as Aspergillus niger, strain number GXGD-YZ-2548. It was deposited on March 9, 2026, at the Guangdong Provincial Center for Microbial Culture Collection, with accession number GDMCC No: 67893, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0032] In some embodiments of the present invention, the strain possesses extremely strong cellulase production capacity, secreting a highly active cellulase system with extremely high cellulose degradation efficiency. Through the targeted degradation of the lignocellulose structure in the distiller's grains by these cellulases, the physical barrier of the substrate is effectively broken down, promoting the release of encapsulated nutrients and their further conversion into microbial proteins, thus significantly shortening the biotransformation cycle.

[0033] In some embodiments of the present invention, when the strain is cultured in solid-state fermentation using Maotai lees as the sole seed substrate and Zunpeng lees as the sole fermentation substrate, it can produce high-yield acid-soluble proteins in a targeted manner.

[0034] Fifthly, the present invention provides the application of the strain described in the fourth aspect in solid-state fermentation of distiller's grains.

[0035] Beneficial effects:

[0036] (1) Achieving directional and efficient conversion of acid-soluble protein and simultaneous enhancement of cellulose degradation and crude protein: This invention achieves precise matching and synergy between the targeted screening of GXGD-YZ-2548 Aspergillus niger strain and the distillers' grains substrate, increasing the proportion of acid-soluble protein in the distillers' grains to 8.45% and the crude protein content to over 30%, and the in vitro protein digestibility of the fermentation product reaches 56.4%, with an enhancement rate of 73.6%, which is much higher than that of untreated raw grains and conventionally fermented distillers' grains. It can effectively adapt to the digestive characteristics of monogastric animals, reduce the digestive energy consumption of animals, alleviate the problem of nutritional diarrhea in monogastric animals, and greatly improve the feed nutrient conversion efficiency.

[0037] (2) Eliminating the limiting factors of fermentation utilization of distillers' grains: Through the synergistic fermentation of strains and substrates, this invention naturally eliminates microbial inhibitory factors such as organic acids and fusel oils in distillers' grains, solving the core technical pain point of microbial growth inhibition in conventional distillers' grains fermentation. At the same time, it allows the mycelium of strains to fully penetrate and utilize the internal nutrients of distillers' grains, achieving efficient activation of protein nutrition. It also eliminates the original sour and alcoholic taste of distillers' grains, solving the industry problem of poor palatability of distillers' grains feed.

[0038] (3) Fermentation products are adapted to the feed requirements of monogastric animals: The core design process of this invention is to enhance acid-soluble protein. The fermentation products are rich in small peptides, free amino acids and other small molecule proteins, which perfectly match the physiological characteristics of monogastric animals, such as short digestive tract and weak ability to decompose large molecule proteins. The protein can be efficiently absorbed without the need for additional enzyme preparations, providing high-quality raw materials for the development of high-quality protein feed for monogastric animals, and has broad application prospects.

[0039] (4) The process is simple and easy to industrialize, and has both economic and environmental value: The fermentation process of the present invention has simple operation steps. Both the seed substrate and the fermentation substrate are made from the by-product of brewing industry, which is easy to obtain and has low cost. The key parameters such as temperature and time of cultivation and fermentation are easy to control. No complicated equipment is required, which is suitable for large-scale industrial production. At the same time, it realizes the resource recycling of brewing by-products, reduces the pollution of solid waste from the by-products, and has both significant economic and environmental value.

[0040] (5) The strain exhibits strong stability, facilitating industrial production applications: The GXGD-YZ-2548 Aspergillus niger strain screened in this invention demonstrates strong reproductive capacity, high efficiency in the directional synthesis of acid-soluble proteins, and extremely high cellulose degradation efficiency. This effectively promotes the conversion of non-protein nitrogen or macromolecular proteins into bacterial proteins and acid-soluble proteins, while significantly shortening the biotransformation cycle. It possesses extremely high industrial application value and commercial potential. After cultivation, it can be sealed and stored at room temperature without refrigeration, resulting in low transportation and storage costs. The strain's strong stability facilitates practical application and promotion in industrial production. Attached Figure Description

[0041] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments, and the advantages of the present invention in the above and / or other aspects will become clearer.

[0042] Figure 1 Cellulase activity data for four Aspergillus niger strains (GXGD-YZ-1764, GXGD-YZ-1847, GXGD-YZ-1972, and GXGD-YZ-2548).

[0043] Figure 2 This image shows the colony morphology of Aspergillus niger strain GXGD-YZ-2548.

[0044] Figure 3 The results show the cellulase activity of Aspergillus niger strain GXGD-YZ-2548 on four different seed substrates. Note: **** indicates extremely significant (P<0.0001), *** indicates extremely significant (P<0.001), ** indicates highly significant (P<0.01), * indicates significant (P<0.05), and ns indicates no significant (P>0.05). Detailed Implementation

[0045] The present invention will be further described in detail below with reference to specific embodiments, and the advantages of the present invention in the above and / or other aspects will become clearer.

[0046] Unless otherwise specified, the experimental methods described in the following examples are conventional methods; unless otherwise specified, the reagents and materials are commercially available.

[0047] In the following embodiments, the Maotai lees, Zunpeng lees, and Yixing lees are all commercially available baijiu lees from Guizhou Maotai Distillery (Group) Circular Economy Industry Investment and Development Co., Ltd., a subsidiary of Guizhou Maotai Distillery Co., Ltd.

[0048] In the following embodiments, aps represents acid-soluble protein, cp represents crude protein, cf represents crude fiber, and aps / cp represents the proportion of acid-soluble protein in crude protein.

[0049] Example 1: Screening of Aspergillus niger strains with high production of acid-soluble protein

[0050] Eight Aspergillus niger strains were retrieved from the strain collection of the Nanjing University of Technology-National Biochemical Engineering Technology Research Center laboratory and numbered GXGD-YZ-453, GXGD-YZ-679, GXGD-YZ-680, GXGD-YZ-1764, GXGD-YZ-1847, GXGD-YZ-1849, GXGD-YZ-1972 and GXGD-YZ-2548, respectively. A blank control group was also set up.

[0051] 1. Preparation of bran koji culture medium

[0052] Large pieces of wheat bran are used as raw material, and repeatedly washed with water until the washing water changes from cloudy to clear. The washed wheat bran is then squeezed to remove excess water. Squeeze the bran with moderate force until only water drips down the surface, without any continuous stream of water flowing out. At this point, the moisture content of the bran is 60-80%. The treated bran is used as a koji culture medium, and 40 g is placed in 1 L narrow-mouth Erlenmeyer flasks. The flasks are sealed with stoppers made of cotton and gauze, and a thin film is placed over the stoppers for further sealing. The sealed Erlenmeyer flasks are then autoclaved at 121°C for 1 hour. After sterilization, they are cooled to room temperature for later use.

[0053] 2. Inoculation and culture of Aspergillus niger strains

[0054] Take a small piece (about the size of a little fingernail) from each strain's test tube and inoculate it into PDA solid medium. Incubate at a constant temperature of 30-32℃ for 7 days, until the spores cover the entire plate. Pick 3-4 pieces from the incubated plate and inoculate them onto bran koji medium, then place them in a constant temperature environment of 30-32℃ for static incubation. During the first two days, turn the bran every 12 hours to ensure aeration for the strain's growth. After two days, no turning is necessary. The total incubation period is 8 days. After incubation, store the confluent Erlenmeyer flasks sealed at room temperature; do not refrigerate.

[0055] 3. Spore count, crude protein (cp), and acid-soluble protein (asp) content determination.

[0056] Weigh 1 g of the cultured Aspergillus niger bran koji sample and place it in a 500 mL sterile container. Add 100 mL of sterile physiological saline and mix thoroughly to prepare a bacterial suspension. Transfer the bacterial suspension and any remaining solids in the container to a 500 mL sterile container containing a layer of sterile glass beads. Vortex the container for 5 minutes to disperse the spores using the impact of the glass beads. Perform a 10-fold serial dilution on the dispersed bacterial suspension. -4 10 -5 10 -6 The diluted bacterial suspension was added dropwise to a hemocytometer, and spores were counted under a microscope. The number of spores for each strain was recorded.

[0057] The Aspergillus niger bran koji samples that had undergone spore counting were dried in a 65℃ oven. After drying, the crude protein and acid-soluble protein contents of each sample were determined. The crude protein content was determined strictly according to GB / T6432-2018 "Determination of Crude Protein in Feed - Kjeldahl Method", and the acid-soluble protein content was determined strictly according to NY / T3801-2020 "Determination of Acid-Soluble Protein in Feed Ingredients".

[0058] Table 1. Results of spore count, crude protein, and acid-soluble protein content determination.

[0059]

[0060] The results are shown in Table 1. Among the eight strains, strain GXGD-YZ-2548 (No. 9) exhibited the strongest protein degradation and transformation capabilities, with an acid-soluble protein content of 6.66% and a protein conversion rate of 35.43%. Both key indicators ranked first in the group, making it an ideal choice for deep fermentation. Strain GXGD-YZ-1972 (No. 8) showed significant advantages in growth and metabolism, with a spore count of 2.79 × 10⁻⁶. 9The CFU / g and crude protein content reached 19.85%, the highest in the group. Strain No. 6, GXGD-YZ-1847, ranked second in spore count, and its acid-soluble protein and conversion rate were both among the top tier. With a standard deviation of only 0.02, it also exhibited excellent process stability. Although strain No. 5, GXGD-YZ-1764, had a limited increase in crude protein, its protein conversion efficiency was extremely high, with an asp / cp value of 32.35%, demonstrating potential as a functional additive. In summary, the above four strains showed significant application prospects in terms of improving nutritional value, viable cell count, and metabolic depth, and can be considered as preferred strains for subsequent fermentation experiments in this invention.

[0061] Example 2: Comparison of cellulase activity in Aspergillus niger

[0062] This embodiment further uses filter paper enzyme activity (FPA) and carboxymethyl cellulase activity (CMC) as indicators to evaluate the differences in enzyme production capacity among the four selected Aspergillus niger strains (GXGD-YZ-2548, GXGD-YZ-1972, GXGD-YZ-1847 and GXGD-YZ-1764) in Example 1, and to screen out high-yielding enzyme strains.

[0063] Among them, the filter paper enzyme activity (FPA) was determined according to GB / T 23881-2009 "Determination of Cellulase Activity in Feed - Filter Paper Method", using Whatman No.1 filter paper as the substrate and the reducing sugar colorimetric method; the carboxymethyl cellulase activity was determined according to the agricultural industry standard NY / T 912-2020 "Determination of Cellulase Activity in Feed Additives - Spectrophotometric Method", using sodium carboxymethyl cellulose (CMC-Na) as the substrate and the DNS colorimetric method.

[0064] A standard curve equation for glucose was established using linear regression analysis. Data analysis showed that the standard curve exhibited excellent linearity, with a correlation coefficient R0. 2 ≥0.999. This indicates that under this detection system, the absorbance OD... 540 There is a high linear correlation between the value and the reducing sugar content, which can ensure the accuracy of subsequent enzyme activity conversion.

[0065] The filter paper enzyme activity (FPA) and carboxymethyl cellulase activity (CMCase) of different Aspergillus niger strains under the same fermentation conditions are shown in Table 2 and 3. Figure 1 As shown.

[0066] Table 2 Results of cellulase activity determination

[0067]

[0068] From Table 2 and Figure 1It was found that strains GXGD-YZ-1847 and GXGD-YZ-2548 exhibited high filter paper enzyme activity, while strains GXGD-YZ-1764 and GXGD-YZ-2548 showed high carboxymethyl cellulase activity. Specifically, the carboxymethyl cellulase activity of GXGD-YZ-2548 reached 29.35 ± 0.52 U / mL, significantly different from other strains. Strain GXGD-YZ-1972 showed low filter paper enzyme and carboxymethyl cellulase activities. These results indicate that strain GXGD-YZ-2548 possesses extremely high cellulose degradation efficiency.

[0069] Example 3: Morphological and gene sequence identification of strain GXGD-YZ-2548

[0070] The GXGD-YZ-2548 strain was spread onto PDA plates, sealed with sealing film, and incubated statically at 32°C for 7 days. Figure 2 It can be observed that strain GXGD-YZ-2548 exhibits black spores, no exudate production, no soluble pigment production, uniform colony texture, velvety surface, clear edges, and relatively consistent colony size and shape on PDA plates, which conforms to the typical colony morphology characteristics of Aspergillus niger.

[0071] The cultured GXGD-YZ-2548 strain PDA plates were sent to General Biotechnology (Anhui) Co., Ltd. for gene sequence detection and homology comparison. The ITS sequence information of this strain is shown in SEQ ID NO.1. The sequence was compared with the NCBI official database (www.ncbi.nlm.nih.gov), and the results confirmed that the strain is Aspergillus niger, and the gene sequence matching degree meets the standard requirements.

[0072] The strain GXGD-YZ-2548 was deposited at the Guangdong Provincial Center for Microbial Culture Collection, classified and named Aspergillus niger, strain number GXGD-YZ-2548, deposited on March 9, 2026, with accession number GDMCCNo: 67893, and deposited at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0073] SEQ ID NO.1:

[0074] TAGGTGAACCTGCGGAAGGATCATTACCGAGTGCGGGTCCTTTGGGCCCAACCTCCCATCCGTGTCTATTATACCCTGTTGCTTCGGCGGGCCCGCCGCTTGTCGGCCGCCGGGGGGGCGCCTTTGCCCCCCGGGCCCGTGCCCGC CGGAGACCCCAACACGAACACTGTCTGAAAGCGTGCAGTCTGAGTTGATTGAATGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAAT TCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTTGGGTCGCCGTCCCTCTCCGGGGGGACGGGCCCGAAAGGCAG CGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTAGGATTGGCCGGCGCCTGCCGACGTTTTTCCAACCATTTTTTCCAGGTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATA

[0075] Example 4: Screening of seed culture media (seed substrate selection)

[0076] Using strain GXGD-YZ-2548 as the experimental strain, three different types of baijiu lees (Maotai lees, Zunpeng lees, and Yixing lees) from the cyclical production and input of Guizhou Maotai Distillery Co., Ltd. were selected as seed substrates, with the bran koji group serving as the control group. The components of the three different baijiu lees were measured, and the results are shown in Table 3.

[0077] Table 3. Results of the determination of components in the lees of three types of baijiu.

[0078]

[0079] The pH value of the above three types of baijiu lees was adjusted using NaOH weak alkaline solution, and the pH value of all lees samples was adjusted to about 4.5. The pH value was strictly determined in accordance with "T / SDFA002.3-2023 Fermented Feed Raw Materials Part 3".

[0080] The GXGD-YZ-2548 strain was prepared at a rate of 2 × 10⁻⁶. 8 Spores / dry substrate were inoculated into three different groups of baijiu lees and bran koji after pH adjustment, and cultured at a suitable temperature of 30-32℃ for 5 days. After culture, the number of spores in each substrate was recorded to characterize the growth and reproduction capacity of the strains; the cellulase activity was also recorded to characterize the ability of the strains to degrade cellulose. The spore counting method was the same as in Example 1, and the cellulase activity method was the same as in Example 2.

[0081] The spore count results are shown in Table 4. Comparing the growth of GXGD-YZ-2548 in four different substrates, this strain showed the best growth and reproduction activity in bran koji culture, comparable in Maotai lees and Yixing lees, and the lowest growth and reproduction capacity in Zunpeng koji.

[0082] The cellulase activity results are shown in Table 5 and Figure 3 As shown, when using Maotai lees as seed substrate, the filter paper enzyme activity was the highest and significantly higher than other groups, followed by the bran koji group; when using bran koji as seed substrate, the carboxymethyl cellulase activity was the highest and significantly higher than other groups, followed by Zunpeng lees.

[0083] Therefore, the fermentation effects of different liquor lees as fermentation substrates were compared by using bran koji, Maotai liquor lees, and Zunpeng liquor lees as seed culture media for strain GXGD-YZ-2548.

[0084] Table 4. Effects of different seed substrates on spore number and cellulase activity of strain GXGD-YZ-2548

[0085]

[0086] Table 5. Effects of different seed substrates on cellulase activity of strain GXGD-YZ-2548

[0087]

[0088] Example 5: Screening of fermentation culture medium (fermentation substrate selection)

[0089] This embodiment further constructs nine parallel fermentation systems based on the compatibility of the GXGD-YZ-2548 strain with the seeds and fermentation substrates of the fermentation process, namely, “seed substrate (wheat bran koji, Maotai lees, Zunpeng lees) × fermentation substrate (Zunpeng lees, Maotai lees, and Heyixing lees)”. The synergistic effect of the strain and substrate and the protein-directed transformation law during the fermentation process are analyzed with acid-soluble protein enhancement rate and crude protein enhancement rate as the core indicators.

[0090] Specifically, the GXGD-YZ-2548 strain was prepared at a rate of 2 × 10⁻⁶. 8Spore / dry substrate inoculum was inoculated into seed culture media containing wheat bran koji, Maotai distillers' grains, and Zunpeng distillers' grains at a pH of approximately 4.5 for activation culture. After culture, spore counts were performed, and then the samples were subcultured at 2×10⁶ samples each. 8 Solid-state fermentation was conducted on three types of lees substrates: Zunpeng lees, Maotai lees, and Heyixing lees, using spores / dry substrates. The pH of the substrates was adjusted to 4.5–5.0, with 4.7 being preferred. A total of nine parallel experimental groups were set up, specifically: wheat bran koji group-Zunpeng lees, wheat bran koji group-Maotai lees, wheat bran koji group-Heyixing lees, Maotai lees-Zunpeng lees, Maotai lees-Maotai lees, and Maotai lees-Heyixing lees.

[0091] Nine parallel experimental groups were subjected to solid-state fermentation at a constant temperature of 30-32℃ for 60 h. After fermentation, the acid-soluble protein content and crude protein content of each group were measured, and the acid-soluble protein enhancement rate and crude protein enhancement rate were accurately calculated. The methods for determining the acid-soluble protein content and crude protein content were the same as in Example 1. The detection of crude fiber (cf) was strictly carried out in accordance with the requirements of GB / T 6434-2022 Determination of Crude Fiber Content in Feed.

[0092] The results are shown in Table 6. It can be seen that in all nine fermentation systems, strain GXGD-YZ-2548 achieved significant protein enhancement. Compared with the raw material control group, the acid-soluble protein enhancement rate in each group was ≥29.93%, and the crude protein enhancement rate remained at a high level between 24.42% and 43.82%. This fully demonstrates that strain GXGD-YZ-2548 has excellent substrate adaptability and can effectively utilize baijiu lees from different sources for nutritional enhancement.

[0093] In terms of efficiency improvement, Group 4, using Moutai lees as the seed substrate and Zunpeng lees as the fermentation substrate, exhibited the best overall performance. This group showed a 64.08% increase in acid-soluble protein, a 37.49% increase in crude protein, and a 17.46% reduction in crude fiber, indicating that this heterologous combination significantly stimulated the metabolic activity of the strain. Regarding crude protein improvement, Group 9, composed of Zunpeng lees as the seed substrate and Yixing lees as the fermentation substrate, showed the strongest performance, with an improvement rate of 43.82%, indicating that Zunpeng lees as the seed substrate was more conducive to the accumulation of strain biomass. Furthermore, Groups 4 and 3 also led in acid-soluble protein improvement, both exceeding 60%, confirming that the GXGD-YZ-2548 strain can achieve targeted conversion to acid-soluble proteins under specific substrate induction.

[0094] Furthermore, it was found that groups 2 and 4, which had higher crude fiber reduction rates, generally exhibited better protein conversion effects. This indicates that while degrading cellulose to release energy, the strain effectively promoted the conversion of non-protein nitrogen or macromolecular proteins into cell proteins and acid-soluble proteins, demonstrating a good synergistic effect between cell wall disruption degradation and nutrient synthesis.

[0095] In summary, strain GXGD-YZ-2548 exhibited optimal performance under the synergistic effect of using Moutai lees as the seed substrate and Zunpeng lees as the fermentation substrate, achieving the best balance in enhancing the efficiency of acid-soluble protein and crude protein. Experiments demonstrate that optimizing the compatibility of the seed substrate and fermentation substrate can significantly enhance the strain's protein-directed transformation ability. In particular, using Moutai lees to cultivate seeds not only increased the fermentation depth but also significantly accelerated the fiber degradation process, providing a precise technological pathway for the high-value bio-utilization of baijiu lees.

[0096] Table 6. Results of compatibility screening for different fermentation substrates

[0097]

[0098] Example 6: Sensory Evaluation

[0099] The German Agricultural Association's scoring method is the "gold standard" for sensory evaluation of fermented feed and food worldwide. Evaluation indicators include odor (14 points), texture (4 points), and color (2 points), for a total of 20 points. See Table 7 for specific scoring criteria. Based on the total score, fermentation quality is divided into four levels: 16-20 points for excellent (Level 1), 10-15 points for good (Level 2), 5-9 points for average (Level 3), and 0-4 points for spoilage (Level 4). The German Agricultural Association's scoring method was used to conduct a sensory evaluation of the fermented feed from distillers' grains after optimizing the above-mentioned solid-state fermentation process.

[0100] Table 7 German Agricultural Association Scoring Method

[0101]

[0102] The experimental data are shown in Table 8. The "Moutai lees + Zunpeng lees" group, using Moutai lees as the seed substrate, maintained a high score of 19 points after 60 hours of solid-state fermentation, and did not exhibit the ammonia odor found in the "bran koji + Zunpeng lees" group. This indicates that the Moutai lees seed source showed better metabolic stability and delayed fermentation potential in the Zunpeng lees substrate. Furthermore, the "Moutai lees + Zunpeng lees" group formed elastic clumps in the later stages of fermentation, reflecting the tight bond between Aspergillus niger mycelium and lees fibers. This not only facilitates subsequent drying and pulverization but also indicates that the accumulation of acid-soluble proteins in the material has reached an ideal level.

[0103] Table 8 Sensory scores of the three fermentation combination products

[0104]

[0105] Example 7: In vitro digestion simulation

[0106] This embodiment simulates the natural digestive environment of gastric juice in monogastric animals by preparing a pepsin solution containing 20 U / mL and adjusting the pH of the pepsin solution to 2.0 using acid to construct a standardized in vitro digestion system. The determination of in vitro simulated digestibility was strictly in accordance with GB / T17811—2025 Determination of pepsin digestibility of animal-derived protein feed by filtration method.

[0107] The 20 U / mL pepsin solution is prepared fresh before use: Weigh an appropriate amount of pepsin (derived from pig stomach, CAS number 9001-75-6), dissolve it in hydrochloric acid solution heated to 42~45℃ in a water bath, so that the pepsin activity concentration in the solution is 20 U / mL.

[0108] The fermentation product of strain GXGD-YZ-2548 of this invention in the Maotai lees-Zunpeng lees group was used as the experimental group, and the product in the unfermented Zunpeng lees group was used as the blank group. Two parallel experiments were conducted. 1 g (accurate to 0.1 mg) of defatted sample was weighed and placed in a 250 mL stoppered ground glass bottle. 150 mL of pepsin solution preheated to 45°C was added to completely submerge the sample. The bottle was tightly sealed and digested on a shaker at 45±1°C for 16 h. The protein digestibility was measured after digestion. A blank enzyme solution was used as a titration blank to calculate the protein digestibility of each group of samples.

[0109] The test results are shown in Table 9: the in vitro protein digestibility of the experimental group reached 56.2%, which was significantly higher than that of the blank group (32.4%), with an improvement rate of 73.8%. This result fully demonstrates that the proportion of acid-soluble protein in the fermented grains after targeted treatment by the fermentation process of this invention is greatly increased, and the protein digestibility is qualitatively improved. It can accurately adapt to the digestive physiological characteristics of monogastric animals and has extremely high nutritional value for monogastric animals.

[0110] Table 9 Results of in vitro protein digestion

[0111]

[0112] This invention provides a method and approach for targeted, high-yield acid-soluble protein solid-state fermentation of distiller's grains. Many methods and approaches exist for implementing this technical solution; the above description is merely a preferred embodiment of the invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principles of this invention, and these improvements and modifications should also be considered within the scope of protection of this invention. All components not explicitly stated in this embodiment can be implemented using existing technologies.

Claims

1. A method for solid-state fermentation of distiller's grains to simultaneously produce high-yield acid-soluble proteins and degrade cellulose, characterized in that, Using Maotai lees as the sole seed substrate and Zunpeng lees as the sole fermentation substrate, Aspergillus niger strains were inoculated into Maotai lees for activation culture, and then transferred to Zunpeng lees for solid-state fermentation culture, thus obtaining a fermented lees product that produces high levels of acid-soluble proteins and degrades cellulose.

2. The solid-state fermentation method for distiller's grains according to claim 1, characterized in that, The strain of Aspergillus niger is classified as Aspergillus niger, strain number GXGD-YZ-2548, and was deposited on March 9, 2026 at the Guangdong Provincial Center for Microbial Culture Collection, with accession number GDMCC No: 67893, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

3. The solid-state fermentation method for distiller's grains according to claim 1, characterized in that, The inoculation dose is 1~5×10 8 Spores / dry substrate; inoculation was performed after spore counting, with an inoculum size of 2 × 10⁻⁶. 8 Spores / Dry substrate.

4. The solid-state fermentation method for distiller's grains according to claim 1, characterized in that, Adjust the pH value of the Maotai lees and Zunpeng lees to 4.0~5.

0.

5. The solid-state fermentation method for distiller's grains according to claim 1, characterized in that, The activation culture is carried out under the following conditions: activation culture at a constant temperature of 30~32℃ for 5~8 days.

6. The solid-state fermentation method for distiller's grains according to claim 1, characterized in that, The solid-state fermentation culture is carried out under the following conditions: solid-state fermentation at a constant temperature of 30~32℃ for 3~5 days.

7. The fermented lees product prepared by the solid-state fermentation method of any one of claims 1 to 6.

8. The use of the fermented distillers' grains product according to claim 7 in the preparation of monogastric animal feed, wherein, The monogastric animal is a pig or a poultry, and the poultry includes chickens, ducks, and geese.

9. A strain that directionally produces high levels of acid-soluble proteins while simultaneously degrading cellulose, characterized in that, The strain is a *Aspergillus niger* strain, classified as *Aspergillus niger*, strain number GXGD-YZ-2548. It was deposited on March 9, 2026, at the Guangdong Provincial Center for Microbial Culture Collection, with accession number GDMCC No: 67893. The deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

10. The application of the strain of claim 9 in solid-state fermentation of distiller's grains.