Animal cytochrome p450 oxidoreductase from corals and uses thereof
By using coral-derived cytochrome P450 oxidoreductase for chromosome integration expression in yeast, combined with optimized fermentation conditions, the problem of drug shortage in marine animals was solved, and efficient P450 oxidation reaction and biosynthesis of target products were achieved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SHANDONG UNIV
- Filing Date
- 2026-05-20
- Publication Date
- 2026-06-30
AI Technical Summary
The extremely low molecular content of marine animal-derived drugs in existing technologies leads to a shortage of drug sources, which limits the in-depth development and clinical translation of marine animal-derived drugs. Furthermore, the reaction efficiency of existing cytochrome P450 oxidoreductases is insufficient, making it difficult to efficiently drive the P450 oxidation reaction.
Using cytochrome P450 oxidoreductase (CPR) derived from coral, a chromosome integration vector was constructed to stably express it in yeast. Combined with optimized fermentation culture conditions, efficient electron transfer and synergistic catalysis of P450 oxidase were achieved.
It significantly improved the conversion rate of the target product, realized the efficient biosynthesis of active compounds from marine animals, solved the problem of drug source shortage, and provided a practical and feasible technical basis for the biosynthesis of marine animal drugs.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the technical fields of genetic engineering and fermentation engineering, specifically relating to an animal cytochrome P450 oxidoreductase derived from coral and its applications. Background Technology
[0002] Marine animal-derived natural products are a vital source of innovative drugs. Of the 17 marine-derived drugs currently on the market, more than half are directly derived from marine animals. These drugs, with their strong targeting and high efficacy, demonstrate irreplaceable clinical value in areas such as anti-tumor and analgesia. However, the scarcity of drug sources due to the extremely low concentration of these molecules in marine animals has become a limiting factor hindering their further development and clinical translation. Therefore, systematically conducting biosynthetic research on marine animal drug molecules to achieve their efficient heterologous preparation is crucial to overcoming this bottleneck.
[0003] Redox reactions are the main type of reaction in the synthesis of natural products derived from marine animals. Oxidation reactions involving P450 oxidases are dominant. The function of P450 oxidases requires the participation of cytochrome P450 reductases (CPRs). The discovery of enzymes capable of efficiently transferring electrons is of great significance for the characterization of P450 and the biosynthesis of marine natural products. Summary of the Invention
[0004] The coral-derived cytochrome P450 oxidoreductase in this invention is used for the heterologous biosynthesis of active compounds derived from marine animals. Compared to existing cytochrome P450 oxidoreductases and reaction systems derived from plants and microorganisms, the enzyme in this invention exhibits higher reaction efficiency for animal-derived P450 oxidases, thereby improving synthesis efficiency.
[0005] To achieve the above objectives, the technical solution of the present invention is as follows: This invention proposes an animal cytochrome P450 oxidoreductase derived from coral, the amino acid sequence of which is shown in SEQ ID NO:1.
[0006] The gene encoding the animal cytochrome P450 oxidoreductase (CPR) has the nucleotide sequence shown in SEQ ID NO:2.
[0007] A recombinant expression vector containing the aforementioned gene.
[0008] Furthermore, the vector is a chromosome integration vector, preferably the pCfB2904 vector.
[0009] A recombinant host bacterium comprising the nucleotide sequence described herein, or comprising the recombinant expression vector described herein.
[0010] The host microorganism is yeast, preferably Saccharomyces cerevisiae CEN.PK2-1C.
[0011] A method for producing a target product by biocatalysis or fermentation using the recombinant host bacteria includes the following steps: (1) The recombinant host bacteria are inoculated into a seed culture medium and cultured. (2) The seed culture was transferred to a fermentation medium for fermentation culture to induce the expression of the CPR and its paired P450 enzyme, which catalyzes the conversion of the substrate into the target product; (3) Collect the fermentation broth, extract and separate the target product.
[0012] Furthermore, the fermentation medium formulation includes: 10-20 g / L peptone, 10-20 g / L yeast extract, 10-30 g / L galactose, 10-30 ml / L glycerol, 10-30 ml / L ethanol, and 1-5 g / L glucose; the fermentation conditions are: temperature 25-35℃, rotation speed 150-250 rpm, and culture time 3-7 days.
[0013] Furthermore, the preferred fermentation conditions are 30°C, 200 rpm, and 5 days.
[0014] This invention also proposes the application of the cytochrome P450 oxidoreductase (CPR), the nucleic acid molecule, the recombinant expression vector, and the recombinant host bacteria in biocatalysis or natural product biosynthesis.
[0015] Compared with the prior art, the beneficial effects of the present invention are as follows: 1. A highly efficient electron transfer element was discovered, which significantly improves the efficiency of the rate-limiting step in catalysis.
[0016] This invention successfully identified and applied a coral-derived cytochrome P450 oxidoreductase (CPR). This CPR exhibits amino acid sequence specificity (SEQ ID NO:1) and demonstrates excellent electron transport capabilities, solving a key bottleneck restricting P450 enzyme activity and catalytic yield, and providing a possibility for efficient catalysis of difficult-to-convert substrates.
[0017] 2. A stable expression system for chromosome integration was constructed, achieving optimal expression results.
[0018] This invention innovatively utilizes the recombinant vector pCfB2904 to specifically integrate the CPR gene into the chromosome of *Saccharomyces cerevisiae* CEN.PK2-1C. Compared to traditional plasmid-free expression systems, the chromosome integration strategy avoids genetic instability caused by plasmid loss, ensuring the long-term stable inheritance and expression of the CPR gene. Experiments have demonstrated that this integrated strain exhibits optimal enzyme activity and cell growth during fermentation, significantly improving the conversion rate of the target product (up to 0.44%), laying a solid foundation for industrial continuous fermentation.
[0019] 3. It is equipped with a proprietary fermentation process, which opens up the transformation pathway from genes to products.
[0020] This invention not only provides the core gene element but also develops a targeted fermentation and culture method. By optimizing the culture medium formulation (specific ratios of peptone, yeast extract, galactose, glycerol, ethanol, and glucose) and culture conditions (30°C, 200 rpm, 5 days), an optimal microenvironment is provided for the growth of the recombinant host bacteria and the synergistic catalysis of CPR and P450. This entire set of process parameters ensures the efficient operation of the electron transport chain, effectively driving the conversion of substrate to target product, and providing a practical technical foundation for the large-scale application of this CPR in P450 characterization, natural product biosynthesis, and synthetic biology. Attached Figure Description
[0021] Figure 1 Phylogenetic tree diagram of CPR protein; Figure 2 To construct the Saccharomyces cerevisiae insertion vector pCfB2904CPR; Figure 3 The effects of different CPR techniques on the target product; Figure 4 The effects of different expression modes of coral CPR on the target product. Detailed Implementation
[0022] The present invention will now be described in detail with reference to the embodiments and accompanying drawings.
[0023] Example 1: Discovery and Sequence Identification of Coral-Derived CPR Genes This embodiment is from coral. Antillogorgia elisabethae The specific steps for mining the amino acid sequence of CPR from the genome are as follows: 1. Data acquisition and preprocessing.
[0024] Download coral from NCBI (National Center for Biotechnology Information). Antillogorgia elisabethaeRaw genome (DNA-seq) and transcriptome (RNA-seq) sequencing data; Data format: The data mainly comes from the SRA (Sequence Read Archive) database and is in FASTQ format.
[0025] Quality control: The raw data was evaluated using the software Trimmomatic to remove adapter sequences and low-quality bases to ensure the accuracy of subsequent assembly.
[0026] The specific parameters are: java -jar trimmomatic-0.39.jar PE -phred33 Seq_1.fastqSeq_2.fastq u1.fq 1.single.fq u2.fq 2.single.fq ILLUMINACLIP:TruSeq3-PE-2.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:80.
[0027] 2. Assembly of transcriptome and genome.
[0028] The high-quality sequencing data obtained in step (1) are then assembled separately: Transcriptome assembly was performed using Spades software to splice RNA-seq data, resulting in a Unigene set consisting of tens of thousands of transcripts. The specific parameters were: rnaspades.py --pe1-1 u1.fq --pe1-2 u2.fq --pe1-ssingle.fq -o spades --only-assembler -t 80 -m 80; Genome assembly is performed using the Spades software to splice DNA-seq data, resulting in a genomic scaffold library consisting of hundreds to thousands of fragments. The specific parameters are: spades.py --pe1-1 u1.fq --pe1-2 u2.fq --pe1-s single.fq -o spades --only-assembler -t 80 -m 160.
[0029] Through the above steps, a system was constructed. Antillogorgia elisabethae The transcriptome Unigene database and the genomic Scaffold physical map were used as substrates for further mining.
[0030] 3. Database construction and gene prediction.
[0031] To transform the assembly results into a database that can be used for gene mining, the following processing is performed: Protein sequence prediction: The Unigene sequence and genomic Scaffold sequence obtained in step (2) are used to predict gene structure using the ORF (open reading frame) prediction software Prodigal, which identifies coding sequences (CDS) and translates them into corresponding amino acid sequences.
[0032] Local database construction: All predicted amino acid sequences were integrated and local protein databases were constructed using tools such as makeblastdb, which served as the basis for subsequent CPR gene homology searches.
[0033] 4. Discovery of the CPR gene.
[0034] Using the protein database constructed in the previous step, CPR gene screening was performed: (1) HMMSEARCH: Construct a probe sequence using the known CPR sequence (specific parameters are hmmbuildCPR.fasta CPR.hmm). Use this CPR probe to search the local protein database to obtain homologous proteins, specific parameters are hmmsearch -E 3e-50 CPR.hmm database.fasta. Remove incomplete and duplicate homologous proteins to obtain candidate homologous sequences.
[0035] (2) BLAST alignment: The candidate homologous proteins were compared with the online BLAST (NR database) of NCBI to confirm that the candidate sequences originated from corals.
[0036] (3) Domain identification: InterProScan software was used to analyze the protein domains of the candidate sequences. Sequences containing both flavin adenine dinucleotide (FAD) binding domain (PF00177) and nicotinamide adenine dinucleotide phosphate (NADP) binding domain (PF00258) were screened out.
[0037] 4. Screening and identification of target sequences (1) Multiple sequence alignment and evolutionary analysis The candidate sequences obtained in step 3 are then subjected to multiple sequence alignment with other known CPR sequences, and a phylogenetic tree is constructed to analyze the phylogenetic relationship between the candidate sequences and known CPR sequences. Figure 1 As shown.
[0038] (2) Experimental verification Candidate CPR genes were chemically synthesized and co-expressed heterologously with a specific P450 enzyme in yeast. Under identical conditions, the efficiency of the candidate CPR protein in catalyzing cytochrome C reduction and that of a reference CPR protein (other CPRs preserved by our research group) was determined. The candidate CPR was assembled with a specific P450 enzyme into a catalytic system, and substrate transformation experiments were performed to detect the amount of the target product generated.
[0039] Based on the experimental data, the sequence with the highest electron transfer efficiency and the highest conversion rate of the target product was selected as the final target CPR gene. The amino acid sequence and gene sequence of this CPR are shown in SEQ ID No. 1 and SEQ ID No. 2, respectively.
[0040] Example 2: Functional assessment and electron transport efficiency comparison of CPR under different expression strategies This embodiment aims to compare the electron transport efficiency and target product synthesis ability of coral-derived CPR (target CPR) under two strategies: plasmid expression and chromosome integration expression, by constructing different expression systems.
[0041] 1. Construction of CPR expression plasmid Using the coral CPR gene (SEQ ID NO:1) obtained in Example 1 as a template, specific primers containing homologous arms were designed and amplified. The primers are as follows: CPR-F: CAAGGAGAAAAAACCCCGGATCCATGTCTGATCCAAATGAAGAT (SEQ ID No. 3); CPR-R: CTTCTGTTCCATGTCGACGCCCGGGTATGACCAAACATCAAC (SEQ ID No. 4).
[0042] Amplification and ligation: PCR amplification yielded a gene fragment containing the CPR coding region (SEQ ID No. 2) and homologous arms at both ends. This fragment was then ligated to the linearized expression plasmid via homologous recombination to construct the recombinant expression plasmid, denoted as p-CPR.
[0043] 2. Construction of CPR-based Saccharomyces cerevisiae chromosome integration vector To achieve site-specific integration of the CPR gene into the chromosome of Saccharomyces cerevisiae, a CRISPR-Cas9 recombinant plasmid was constructed.
[0044] Primer design: Based on the CPR sequence in the expression plasmid (p-CPR) obtained in step 1, design specific primers containing the homologous arm of the pCfB2904 vector: Cas-F: GTATCTACCAACGGAATGCGTTTACTCGAGGTCTTCTTCGG (SEQ ID No. 5), Cas-R: GTTAGAGCGGATGAATGCACTCAGATCTTATCGTCGTCATCC (SEQ ID No. 6).
[0045] Amplification and Ligation: Using the expression plasmid p-CPR from step 1 as a template, a CPR fragment with homologous arms of pCfB2904 at both ends was obtained by PCR amplification using Cas-F / R primers; this PCR fragment was then homologously recombinated with the linearized pCfB2904 plasmid (CRISPR integration vector) to obtain the recombinant integration plasmid pCfB2904-CPR (e.g., ...). Figure 2 (As shown). This plasmid can be used to mediate the site-directed integration of the CPR gene into the yeast chromosome.
[0046] 3. Construction of recombinant Saccharomyces cerevisiae strains Transformation: The recombinant plasmid pCfB2904-CPR obtained in step 2, the Cas9 expression plasmid (expressing Cas9 protein), and the specific sgRNA plasmid (signal plasmid) were co-transformed into competent Saccharomyces cerevisiae cells (host strain: Saccharomyces cerevisiae CEN.PK2-1C).
[0047] Screening: A recombinant Saccharomyces cerevisiae strain that successfully integrated the CPR gene into a specific site on the chromosome was obtained through resistance screening and named Sc-CPR.
[0048] 4. Whole-cell catalysis and fermentation experiments 4.1 Plasmid Expression Group (Free Expression) Experimental Group A: The recombinant expression plasmid p-CPR (obtained in step 1), along with the P450 gene expression cassette and substrate synthesis-related gene expression cassette, was directly transformed into wild-type Saccharomyces cerevisiae competent cells. Positive transformants were obtained by screening on corresponding auxotrophic plates. This strain was used to assess the function of CPR under the simulated plasmid-free expression state.
[0049] This experiment also included multiple control groups and negative controls. Specifically, recombinant expression plasmids containing CPR from other sources were constructed according to the method in step 1. Control group 1 (CPR1) contained plant animal CPR, control group 2 (CPR2) contained yeast CPR, and control group 3 (CPR3) contained other animal CPR. The negative control was an empty plasmid without CPR.
[0050] 4.2 Chromosomal integrase (stable expression) Experimental Group B: Select the recombinant Saccharomyces cerevisiae strain Sc-CPR obtained in step 3 (i.e., the CPR gene has been site-directedly integrated into the chromosome via the pCfB2904 system) to prepare competent cells.
[0051] 4.3 Co-transformation, culture and induction The strains obtained from the plasmid expression genome and the chromosome integration genome were then subjected to subsequent co-transformation and fermentation experiments, respectively. The specific steps are as follows: (1) Co-transformation The P450 gene expression cassette and substrate synthesis-related gene expression cassette were co-transformed into the above groups, including wild-type Saccharomyces cerevisiae + p-CPR in the plasmid expression group, as well as yeast competent cells in the control and negative control groups, and yeast competent cells in the Sc-CPR chromosome group in the chromosome integration group. The cells were cultured on the corresponding auxotrophic plates to obtain positive transformants.
[0052] (2) Cultivation and Induction The obtained positive transformants were inoculated into auxotrophic liquid medium and cultured overnight at 30°C and 200 rpm. Subsequently, 2% of each transformant was inoculated into 50 mL of fermentation medium (formulation: 15 g / L peptone, 15 g / L yeast extract, 20 g / L galactose, 20 mL / L glycerol, 20 mL / L ethanol, 2 g / L glucose) and cultured for 5 days at 30°C and 200 rpm.
[0053] 4.4 Product Extraction and Analysis Extraction: After fermentation, the fermentation broth was extracted with ethyl acetate (1:1 volume ratio) and concentrated to obtain the crude product.
[0054] HPLC detection conditions: The instrument was an Agilent 1260 high-performance liquid chromatograph equipped with a diode array detector (DAD), and the chromatographic column was a Poroshell 120 EC-C18 column (C18, 4µm, 4.6×150mm, Agilent Technologies). The mobile phase was 0.1% trifluoroacetic acid-water (A) and acetonitrile (B), the flow rate was 1 ml / min, and the column temperature was 25℃.
[0055] The effect of chromosome expression electron transport in coral CPR was determined by high performance liquid chromatography.
[0056] 4.5 Results and Conclusions The peak area of the target product in each group (experimental group vs. control group) was analyzed by high performance liquid chromatography. Under the same conditions of P450 enzyme and other factors, the yield of the target product directly reflects the electron-donating ability of CPR. Figure 3 (Plasmid Expression Group): This demonstrates electron transport and product synthesis in coral CPR under free expression conditions. Figure 4 (Chromosome Integrase): This section demonstrates electron transport and product synthesis in coral CPR under stable expression conditions.
[0057] Screening phase ( Figure 3 First, through horizontal comparison, coral CPR was identified as the only electron donor capable of effectively driving this specific P450 reaction, eliminating interference from other conventional CPR sources. Optimization phase ( Figure 4 Based on the identification of coral CPR, further longitudinal comparison of expression strategies revealed that chromosome integration expression was superior to traditional plasmid expression, improving transformation efficiency by approximately 30% (from 0.34 to 0.44). Therefore, this invention not only discovered a highly efficient marine-derived CPR protein, but also a CPR derived from marine animals like corals. Compared to CPRs from other sources, this CPR can efficiently transfer electrons and synergistically work with P450 oxidases to complete oxidation reactions. Furthermore, an optimal engineered bacterial construction strategy was established, successfully achieving the efficient biosynthesis of the target product. This discovery has significant implications for the biosynthesis and combinatorial biosynthesis of bioactive natural products derived from marine animals.
[0058] The biosynthesis of the coral-derived clinical level II drug pseudoopterosins AD, as well as several animal-derived drugs, involves the participation of P450 oxidases. Therefore, the discovery of a CPR protein capable of efficiently transferring electrons and synergistically working with P450 oxidases to complete oxidation reactions is of great significance for the biosynthesis of marine animal drugs and other animal drugs.
[0059] It should be understood that although the present invention has been described by way of example according to its preferred embodiments, it should not be limited to the above embodiments. Various modifications and variations can be made to the present invention by those skilled in the art. The fermentation method of CPR can be adjusted and changed according to specific needs. Therefore, those skilled in the art can make several simple substitutions without departing from the concept and principles of the present invention, and these should all be included within the scope of protection of the present invention.
Claims
1. An animal cytochrome P450 oxidoreductase derived from coral, characterized in that, Derived from coral, the amino acid sequence of the cytochrome P450 oxidoreductase is shown in SEQ ID NO:
1.
2. The gene encoding the animal cytochrome P450 oxidoreductase as described in claim 1, characterized in that, The nucleotide sequence of the gene is shown in SEQ ID NO:
2.
3. A recombinant expression vector, characterized in that, It contains the nucleotide sequence as described in claim 2.
4. The recombinant expression vector as described in claim 3, characterized in that, The vector is a chromosome integration vector, preferably the pCfB2904 vector.
5. A recombinant host bacterium, characterized in that, It comprises the nucleotide sequence as described in claim 2, or the recombinant expression vector as described in claim 3.
6. The recombinant host bacterium as described in claim 5, characterized in that, The host microorganism is yeast, preferably Saccharomyces cerevisiae CEN.PK2-1C.
7. A method for producing a target product by biocatalysis or fermentation using the recombinant host bacteria as described in claim 5 or 6, characterized in that, Includes the following steps: (1) The recombinant host bacteria are inoculated into a seed culture medium and cultured. (2) The seed culture was transferred to a fermentation medium for fermentation culture to induce the expression of the CPR and its paired P450 enzyme, which catalyzes the conversion of the substrate into the target product; (3) Collect the fermentation broth, extract and separate the target product.
8. The method as described in claim 7, characterized in that, The fermentation medium is formulated with the following components: 10-20 g / L peptone, 10-20 g / L yeast extract, 10-30 g / L galactose, 10-30 ml / L glycerol, 10-30 ml / L ethanol, and 1-5 g / L glucose. The fermentation conditions are: temperature 25-35℃, rotation speed 150-250 rpm, and culture time 3-7 days.
9. The method as described in claim 8, characterized in that, The preferred fermentation conditions are 30℃, 200rpm, and 5 days.
10. The application of the animal cytochrome P450 oxidoreductase as described in claim 1, the gene as described in claim 2, the recombinant expression vector as described in claim 3 or 4, or the recombinant host bacteria as described in claim 5 or 6 in biocatalysis or natural product biosynthesis.