Plant stress resistance gene MsPAP22 and application thereof

Abstract

This invention discloses a plant stress resistance gene, MsPAP22, and its applications. When overexpressed in plants (such as alfalfa), the MsPAP22 gene screened in this invention can maintain longer taproots and lateral roots, as well as higher biomass (fresh weight) under salt stress, enhancing the plant's antioxidant defense capabilities and maintaining cell membrane integrity, thereby effectively improving its salt tolerance. MsPAP22 overexpression can effectively alleviate the inhibition of aboveground and root growth caused by low phosphorus stress, increase root length to expand the phosphorus absorption range, and improve phosphorus absorption or utilization efficiency. Under low phosphorus stress, it can maintain higher chlorophyll content, better preserving leaf greenness and photosynthetic system stability.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering and plant breeding technology, specifically relating to a plant stress resistance gene MsPAP22 and its application. Background Technology

[0002] Alfalfa (Medicago sativa), as an important forage and ecological crop, combines high yield and high nutritional value, making it one of the world's most important legume forage crops. Rich in protein, vitamins, and minerals, it possesses extremely high feed value and nutritional quality, playing an irreplaceable role in ensuring the healthy development of animal husbandry. Alfalfa has excellent nitrogen-fixing capabilities and a deep root system, playing a vital role in improving soil structure, preventing soil erosion, and enhancing the ecosystem services of farmland. Currently, most major cultivated varieties are selected for high-yield, water- and fertilizer-rich conditions, and have limited adaptability to harsh soil environments such as moderate to high salinity (soil salinity > 0.3%) or severe phosphorus deficiency (available phosphorus < 5 mg / kg). This leads to problems such as difficulty in germination, low seedling survival rates, and unstable yields when planted on marginal lands that constitute a large proportion of arable land. This severely limits the expansion of its planting area. Currently, the high, stable, and high-quality production of alfalfa is increasingly challenged by severe global abiotic stresses. Salt stress inhibits alfalfa growth through osmotic and ion toxicity, while low phosphorus levels limit nutrient uptake and yield. Soil salinization and available phosphorus deficiency have become two key limiting factors restricting the improvement of alfalfa yield and quality, as well as the development of the alfalfa industry.

[0003] Purple acid phosphatases (PAPs) are a class of enzymes containing Fe. 3+ -M 2+ Dinuclear metal-centered phosphorylases (PAPs), belonging to the metallophosphatase superfamily, catalyze the hydrolysis of phosphate monoesters or acid anhydrides, releasing inorganic phosphate (Pi). PAPs exhibit high catalytic activity in acidic environments (pH 4.0–7.0), hydrolyzing various phosphorus-containing compounds to release Pi, making them core enzymes in plant responses to low phosphorus stress. Furthermore, PAPs participate in plant salt stress and antioxidant processes. Studies have shown that NaCl, osmotic, and oxidative treatments can induce the expression of the soybean GmPAP3 gene, indicating that the mitochondrial-localized GmPAP3 may play a role in salt stress tolerance by enhancing ROS scavenging. In rice research, the expression of the GmPAP3 gene has been shown to enhance the salt tolerance of rice; compared with untransformed wild-type and control, transgenic rice plants have higher germination rates, longer branches and roots, and higher survival rates under salt stress; transgenic plants also show increased superoxide dismutase (SOD) and catalase (CAT) activities, proline content, water content, and chlorophyll content, but decreased leaf electrolyte leakage and malondialdehyde content.

[0004] Plant stress resistance is mostly a complex quantitative trait controlled by multiple genes, and it is often negatively correlated with yield and quality traits. Improving plants through conventional hybridization and phenotypic selection is not only time-consuming but also inefficient and lacks predictability. Although stress resistance genes such as ZxNHX and MsAKR1 have been discovered, key genes that can be directly used for breeding are still lacking in actual breeding practices, especially given the complex genetic background of tetraploid alfalfa. Summary of the Invention

[0005] To address the aforementioned technical problems, effectively mitigate the impact of soil salinization and available phosphorus deficiency on the development of the alfalfa industry, and improve alfalfa yield and quality, this invention provides the following technical solution.

[0006] In a first aspect, the present invention provides a plant stress resistance gene MsPAP22, wherein the nucleic acid sequence of MsPAP22 is as shown in SEQ ID NO.1 or has more than 90% identity with it.

[0007] Preferably, the nucleic acid sequence shown in SEQ ID NO.1 is as follows:

[0008]

[0009] Preferably, the above-mentioned 90% or more identity refers to at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

[0010] In a second aspect, the present invention provides a carrier comprising the MsPAP22 described in the first aspect.

[0011] Preferably, the vector includes a cloning vector or an overexpression vector.

[0012] Furthermore, the cloning vector is pTOPO-TA, pEASY-T5 Zero, or pMD18-T, more preferably pTOPO-TA.

[0013] Furthermore, the overexpression vector is pCAMBIA3301 or pCAMBIA1302, more preferably pCAMBIA3301.

[0014] Thirdly, the present invention provides a host cell comprising the vector described in the second aspect.

[0015] Preferably, the host cell includes plant cells, Escherichia coli competent cells, or Agrobacterium tumefaciens competent cells.

[0016] Furthermore, the plant cells are selected from any one or more of tobacco, Arabidopsis thaliana, alfalfa, or clover cells, preferably clover cells.

[0017] Furthermore, the competent Escherichia coli cells include Trans1-T1 or DH5α, more preferably Trans1-T1.

[0018] Furthermore, the competent Agrobacterium tumefaciens cells are EHA105.

[0019] Fourthly, the present invention provides a callus tissue, characterized in that the callus tissue comprises the host cells described in the third aspect.

[0020] Fifthly, the present invention provides the use of MsPAP22 as described in the first aspect, the vector as described in the second aspect, the host cell as described in the third aspect, or the callus tissue as described in the fourth aspect.

[0021] Preferably, the application includes at least one of the following:

[0022] (1) Application in improving the ability of plants to resist salt stress;

[0023] (2) Application in improving the ability of plants to resist oxidative stress;

[0024] (3) Application in improving the ability of plants to resist low phosphorus stress.

[0025] Furthermore, MsPAP22 is overexpressed in the plant.

[0026] Furthermore, the plant is alfalfa, more preferably alfalfa.

[0027] Furthermore, based on KH₂PO₄ concentration, the term "low phosphorus" refers to KH₂PO₄ ≤ 50 μM (μmol·L⁻¹). -1 ), for example: 50 μM, 40 μM, 30 μM, 20 μM.

[0028] Furthermore, based on the NaCl concentration, the NaCl under the salt stress is ≥100 mM, for example: 100 mM, 125 mM, 150 mM, 175 mM, 200 mM, 250 mM.

[0029] Sixthly, the present invention provides a method for constructing a MsPAP22 gene overexpressing plant, comprising the following steps:

[0030] S1, Cultivation of plant materials;

[0031] Construction of S2, MsPAP22 gene cloning vector;

[0032] Construction of S3, MsPAP22 gene overexpression vector;

[0033] S4, transformation of Agrobacterium tumefaciens;

[0034] S5, the transformed Agrobacterium tumefaciens-positive engineered bacteria infect plant tissues, and the MsPAP22 gene overexpressing plants are obtained by culturing.

[0035] Preferably, the plant material in step S1 is young leaves propagated by alfalfa cuttings.

[0036] Furthermore, the alfalfa mentioned is "Zhongmu No. 4".

[0037] Preferably, step S2 includes the following sub-steps:

[0038] S2-1, Gene Cloning: Total RNA was extracted from plant tissues, reverse transcribed into cDNA, and then subjected to PCR to obtain a DNA fragment carrying MsPAP22.

[0039] Preferably, the PCR primers in step S2-1 are:

[0040] MsPAP22-F: CTTCCTACCACAACTCCATTTAAAGAAA (SEQ ID NO. 3).

[0041] MsPAP22-R: CCTCAACTTTACATTATTTGTGCAA (SEQ ID NO. 4).

[0042] S2-2, Cloning vector ligation and transformation: The PCR product purified in S2-1 was ligated with the cloning vector (pTOPO-TA) and then transformed into E. coli competent cells (Trans1-T1). The positive cloning vector (pTOPO-TA-MsPAP22) was obtained by colony PCR identification.

[0043] Preferably, the PCR primers in step S2-2 are M13F and M13R.

[0044] Preferably, step S3 includes the following sub-steps:

[0045] S3-1, Amplification of the MsPAP22 gene fragment with homologous arms: Using the cloning vector pTOPO-TA-MsPAP22 as a template, and p3301-MsPAP22-F / R with homologous arms of the pCAMBIA3301 vector as primers, PCR amplification was performed using high-fidelity DNA polymerase, followed by identification and purification to obtain the MsPAP22 gene fragment with homologous arms (p3301-MsPAP22-PCR).

[0046] Preferably, the primer sequence is as follows:

[0047] p3301-MsPAP22-F: ATGGCAAAATGCGCAAAGTC (SEQ ID NO. 5).

[0048] p3301-MsPAP22-R: CAGCTCTTGATGAGCAACTT (SEQ ID NO. 6).

[0049] S3-2, pCAMBIA3301 vector linearization: The empty pCAMBIA3301 plasmid was digested with the restriction endonuclease Nco I to obtain the linearized vector fragment (pCAMBIA3301-Cut).

[0050] S3-3, Seamless Cloning Ligation Reaction: The MsPAP22 gene fragment with homologous arms (p3301-MsPAP22-PCR) and the linearized vector (pCAMBIA3301-Cut) were seamlessly cloned and ligated to obtain the ligation product (pCAMBIA3301-MsPAP22-Ligation).

[0051] Preferably, the molar ratio of p3301-MsPAP22-PCR to pCAMBIA3301-Cut is 1 to 5:1, for example: 1:1, 2:1, 3:1, 4:1, 5:1, and more preferably 3:1.

[0052] S3-4, Transformation and identification of ligation product into E. coli: The ligation product (pCAMBIA3301-MsPAP22-Ligation) was added to Trans1-T1 chemocompetent cells, subjected to ice bath, heat shock, and ice bath again, and then inoculated into LB medium. Single colonies were identified by PCR to obtain the overexpression vector (pCAMBIA3301-MsPAP22).

[0053] Preferably, the primers for PCR identification are p3301-MsPAP22-F and GUS-R.

[0054] GUS-R:AGTTTTTTGATTTCACGGGTTGGGG (SEQ ID NO.7)

[0055] Preferably, step S4 includes the following sub-steps:

[0056] S4-1, Thawing of competent cells: Place EHA105 competent cells stored in an ultra-low temperature freezer at -80℃ on the surface of an ice box and allow them to thaw naturally.

[0057] S4-2, Transformation of competent cells: The overexpression vector (pCAMBIA3301-MsPAP22) was introduced into the thawed suspension of Agrobacterium tumefaciens competent cells of EHA105 and gently mixed by pipetting. The mixture was then subjected to ice bath, flash freezing in liquid nitrogen, heat shock, and ice bath again.

[0058] S4-3, Recovery Culture: Add the transformed mixture to YEB liquid medium, mix well, and then transfer to a constant temperature shaker for recovery culture.

[0059] S4-4, Plating and Cultivation of Resuscitated Bacterial Fluid: After resuscitation, the bacterial fluid was centrifuged, and part of the supernatant was discarded. The bacterial precipitate was resuspended and plated on the surface of YEB solid medium containing 50 mg / L rifampicin and 50 mg / L kanamycin. Single colonies were obtained after cultivation.

[0060] S4-5, PCR identification of colonies: Single colonies were picked and inoculated into YEB liquid medium containing 50 mg / L rifampicin and 50 mg / L kanamycin, respectively, and cultured with shaking. A small amount of bacterial culture was used as a template for colony PCR identification using primers (p3301-MsPAP22-F and GUS-R), yielding Agrobacterium-positive engineered strains.

[0061] Preferably, in step S5, the Agrobacterium-mediated leaf disc method is used to transform the positive Agrobacterium EHA105 containing pCAMBIA3301-MsPAP22 into the young leaves of alfalfa. After induction culture, callus tissue is obtained, and then complete transgenic seedlings are obtained through induced bud differentiation and rooting.

[0062] The beneficial effects of this invention are:

[0063] I. When the plant stress resistance gene MsPAP22 screened in this invention is overexpressed in plants (such as alfalfa), it can maintain longer taproots and lateral roots and higher biomass (fresh weight) under salt stress. By enhancing the plant's antioxidant defense capacity and maintaining cell membrane integrity, it can effectively improve its salt tolerance.

[0064] II. When MsPAP22 is overexpressed in plants (such as alfalfa), it can effectively alleviate the inhibition of plant growth on the aboveground parts and taproots caused by low phosphorus stress. It can increase the absorption range by increasing root length, thereby improving phosphorus absorption or utilization efficiency. It can also better maintain leaf greenness and photosynthetic system stability by maintaining higher chlorophyll content under low phosphorus stress.

[0065] Third, this invention transforms MsPAP22 into plants (such as alfalfa), providing new resources and methods for molecular breeding of stress resistance genes, and providing solid technology for effectively alleviating the impact of soil salinization and available phosphorus deficiency on the development of the alfalfa industry and improving alfalfa yield and quality. Attached Figure Description

[0066] Figure 1 The image shows the electrophoretic bands of MsPAP22;

[0067] Figure 2 The results show the identification of alfalfa overexpressing MsPAP22; A is the map of the MsPAP22 overexpressing vector; B is the tissue culture process of alfalfa transformed with the MsPAP22 overexpressing vector, (a, b) is callus induction culture, (c) is shoot induction and regeneration culture, (d) is shoot culture, (e, f) is rooting culture; C is the PCR identification of plants overexpressing MsPAP22, "-" is the negative control (WT), "+" is the positive control (pCAMBIA3301-MsPAP22); D is the relative expression level of positive alfalfa plants overexpressing MsPAP22.

[0068] Figure 3 The image shown is a photograph of alfalfa plants overexpressing MsPAP22 under salt stress.

[0069] Figure 4The figure shows the phenotypic and growth index analysis of alfalfa overexpressing MsPAP22 under salt stress; a is plant height; b is fresh weight; c is relative water content; d is total chlorophyll content.

[0070] Figure 5 The image shows the effects of salt stress on the antioxidant system and membrane lipid peroxidation of alfalfa overexpressing MsPAP22; a is CAT (catalase) activity; b is POD (peroxidase) activity; c is MDA (malondialdehyde) content; d is relative conductivity.

[0071] Figure 6 The figure shows the accumulation of reactive oxygen species in leaves of different genotypes of alfalfa under salt stress; a is the NBT staining result of leaves of the MsPAP22 overexpressing line; b is the DAB staining result of leaves of the MsPAP22 overexpressing line.

[0072] Figure 7 The figures show the growth phenotypes and physiological parameters of MsPAP22-overexpressing alfalfa under normal phosphorus and low phosphorus stress; a is a comparison of the growth phenotypes of wild-type (WT) and MsPAP22-overexpressing lines (OE1, OE10, OE13) under normal phosphorus supply (NP) and low phosphorus stress (LP) conditions; be and be are the plant height, root length, aboveground fresh weight, and root fresh weight of each line under different treatments, respectively.

[0073] Figure 8 The images show the leaf chlorophyll content analysis of alfalfa overexpressing MsPAP22 under low phosphorus stress; a) shows the leaf phenotype of wild-type and overexpressing alfalfa under low phosphorus stress; b) shows the total chlorophyll content analysis of wild-type and overexpressing alfalfa under low phosphorus stress. Detailed Implementation

[0074] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments and accompanying drawings. The described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0075] It should be noted that, unless otherwise specified, the reagents and methods used in the embodiments are understood to be conventional reagents and methods in the art.

[0076] The materials and reagents used in the examples are as follows:

[0077] Wild type (WT) alfalfa (Medicago sativa): This study mainly used the alfalfa variety “Zhongmu No.4” (Medicagosativa cv.Zhongmu No.4) bred by the forage breeding and cultivation innovation team of Beijing Institute of Animal Husbandry and Veterinary Medicine, Chinese Academy of Agricultural Sciences.

[0078] Culture medium formulation:

[0079] LB medium: 5 g yeast extract, 10 g tryptone, 15 g agar powder, and ddH2O to a final volume of 1 L.

[0080] YEB medium: 1 g yeast extract, 10 g tryptone, 5 g sucrose, 1 g MgSO4·7H2O, and ddH2O to a final volume of 1 L.

[0081] SH3a medium: S&H Modified basal medium 13.2 g, sucrose 20 g, iron salt 1 mL, vitamin 1 mL, inositol (50 mg / mL) 2 mL, 2,4-D (100 mg / mL) 5 mL, 6-BA (1 mg / mL) 250 μL, ddH2O to a final volume of 1 L.

[0082] Iron salt formula: 4.88 g of ferric citrate, diluted to 1 L with ddH2O.

[0083] Vitamin formulation: Weigh 500 mg each of niacin, thiamine hydrochloride, and pyridoxine hydrochloride, dissolve in ddH2O and bring the volume to 100 mL, filter and sterilize, then store at 4°C.

[0084] MSBK medium: MS basal medium 4.43 g, sucrose 30 g, Kinetin (1 mg / mL) 1 mL, 6-BA (1 mg / mL) 500 μL, ddH2O to a final volume of 1 L.

[0085] SH9a medium: 13.2 g S&H Modified basal medium, 10 g sucrose, 1 mL iron salt, 1 mL vitamin, 2 mL inositol (50 mg / mL), and ddH2O to a final volume of 1 L.

[0086] 1 / 2 Hoagland nutrient solution formula (µmol·L) -1): KNO3 2500, CaCl2·2H2O 250, MgSO4·7H2O 1000, KH2PO4 500, H3BO3 30, MnSO4·H2O 5, ZnSO4·7H2O 1, CuSO4·5H2O 1, Na2MoO4·2H2O 0.7, FeSO4·7H2O 100, EDTA-Na2 100, pH adjusted to 5.8~6.0.

[0087] Example 1: Obtaining the MsPAP22 gene

[0088] (1) Experimental materials and treatment

[0089] The alfalfa variety "Zhongmu No. 4" was used in this experiment. Plump and uniform alfalfa seeds were selected and surface-sterilized for 5 minutes with 75% alcohol in a clean bench, followed by rinsing five times with sterile distilled water. The sterilized seeds were then evenly spread in glass petri dishes containing three layers of filter paper moistened with sterile water, sealed, and placed in a 4°C refrigerator for 2 days of vernalization. After vernalization, the petri dishes were transferred to an artificial climate incubator for germination. The photoperiod was 16 hours of light / 8 hours of darkness; the light intensity was 80 µmol·m⁻¹. -2 ·s -1 The day / night temperature was 26℃ / 22℃; the relative humidity was 60%. Seven days after seed germination, alfalfa seedlings with uniform growth were selected and transplanted into hydroponic boxes containing 1 / 2 Hoagland nutrient solution (Beijing Ximeijie Technology Co., Ltd.). The nutrient solution was changed every 4 days. At four weeks of seedling age, young leaf samples were collected, flash-frozen in liquid nitrogen, and stored at -80℃.

[0090] (2) Cloning of the MsPAP22 gene

[0091] 1) RNA Extraction and cDNA Synthesis: Approximately 0.1 g of young leaves were ground in liquid nitrogen and total RNA was extracted using a plant RNA extraction kit (Beijing Guangda Hengyi Technology Co., Ltd.). RNA concentration and purity (A260 / A280 ≈ 1.8~2.0) were measured using an ultra-micro spectrophotometer. 1 µg of high-quality total RNA was used for reverse transcription to synthesize first-strand cDNA using the HiScript III All-in-one RTSuperMix Perfect for qPCR kit (Nanjing Novizan Biotechnology Co., Ltd.).

[0092] 2) PCR amplification: Using cDNA as a template and MsPAP22-F / R as primers, PCR amplification reaction was performed using high-fidelity DNA polymerase (Extaq enzyme).

[0093] The specific primer sequences, reaction system, and reaction conditions are as follows:

[0094] MsPAP22-F: CTTCCTACCACAACTCCATTTAAAGAAA (SEQ ID NO. 3).

[0095] MsPAP22-R: CCTCAACTTTACATTATTTGTGCAA (SEQ ID NO. 4).

[0096] Table 1 PCR amplification system

[0097]

[0098] PCR amplification program: 95℃ for 5 min; 95℃ for 30 s; 52℃ for 30 s; 72℃ for 3:15 s; 29 cycles; 72℃ for 5 min. PCR products were electrophoresed on a 1% agarose gel for 10 min to obtain the MsPAP22 band (see...). Figure 1 ).

[0099] 3) Product Recovery and Cloning: After PCR product detection by 1% agarose gel electrophoresis, the target band was excised and purified using a gel recovery kit. The purified product was ligated with the pTOPO-TA linearized vector (Hieff Clone™ Zero TOPO-TACloning Kit, Yisheng Biotechnology (Shanghai) Co., Ltd.) at room temperature for 5-10 minutes, and then transformed into Trans-T1 (all-gold) chemocompetent cells. The cells were plated on LB agar plates containing the appropriate antibiotics and incubated overnight at 37°C.

[0100] 4) Positive clone screening and sequencing: Single colonies were selected for colony PCR verification. Positive clones were sent to a sequencing company for Sanger sequencing. The sequencing results were compared with the reference sequence (SEQ ID NO.2) using DNAMAN or SeqMan software to obtain the correct full-length coding sequence of the MsPAP22 gene (SEQ ID NO.1). The specific sequence is as follows:

[0101]

[0102]

[0103] Example 2: Construction of the MsPAP22 overexpression vector and obtaining MsPAP22 genetic transformation materials

[0104] 1. Plant materials and treatment

[0105] This study used alfalfa 'Zhongmu No. 4' as the recipient material for genetic transformation. The explants used for Agrobacterium-mediated leaf disc transformation were vigorous, healthy young leaves. The specific preparation method is as follows:

[0106] 1.1 Plant culture for leaf disc method

[0107] The mother plants used to provide young leaves were obtained through propagation by cuttings. Healthy branches of the 'Zhongmu No. 4' variety were selected, and stem segments with one internode were cut and inserted into a sterilized mixture of vermiculite and potting soil (volume ratio 2:1). The plants were cultured in an artificial climate chamber (photoperiod 16 h / 8 h, day / night temperature 26℃ / 22℃, relative humidity 60%) for approximately 4–6 weeks, with regular watering. When the plants were growing vigorously, the young, fully unfolded leaves at the top were cut as explants for Agrobacterium infection.

[0108] 1.2 Wild-type and transgenic control materials

[0109] The wild-type (WT) control used in this experiment is the aforementioned "Zhongmu No. 4" alfalfa. The MsPAP22 gene overexpression positive lines (such as OE1, OE10, and OE13) obtained through subsequent genetic transformation will be used together with the wild-type for subsequent functional verification experiments under salt stress and low phosphorus stress.

[0110] 2. Construction of expression vector

[0111] 2.1 Gene Cloning

[0112] 2.1.1 Gene Amplification: Total RNA was extracted from plant tissues (e.g., mature leaves), and cDNA was obtained using a reverse transcription kit. Using the cDNA as a template and MsPAP22-F / R as primers, PCR amplification was performed using ExTaq enzyme. The reaction system and procedure are as follows:

[0113] Table 2 MsPAP22 PCR amplification system

[0114]

[0115] PCR amplification program: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 100 s, for a total of 30 cycles; 72℃ final extension for 5 min; storage at 16℃. PCR products were detected by 1% agarose gel electrophoresis.

[0116] 2.1.2 PCR product gel extraction and recovery: The target band was purified and recovered using the EasyPure® Quick Gel Extraction Kit, as follows:

[0117] Cut off the agarose gel containing the target band and weigh it. Add 3 volumes of GSB dissolution buffer and incubate at 55°C until the gel is completely dissolved. Transfer the solution to a centrifugal adsorption column, incubate at room temperature for 60 s, centrifuge at 10,000×g for 60 s, and discard the filtrate. Add 650 µL of WB washing buffer, centrifuge at 10,000×g for 60 s, and repeat once. Centrifuge the empty column at 10,000×g for 2 min, and dry at room temperature for 5 min after opening the cap. Add 30 µL of preheated (65°C) sterile ultrapure water to the center of the adsorption membrane, incubate for 60 s, centrifuge at 10,000×g for 60 s, and collect the purified product. Determine the concentration using a spectrophotometer and store at -20°C.

[0118] 2.2 Cloning vector ligation and transformation

[0119] The purified PCR product was ligated into the cloning vector (pTOPO-TA). The ligation and transformation steps are as follows:

[0120] Table 3 Cloning vector ligation system

[0121]

[0122] Gently mix and ligate at 37°C for 15 min. Take 5 µL of the ligation product and add it to 50 µL of freshly thawed *E. coli* competent cells (Trans1-T1). Gently mix and incubate on ice for 30 min. Heat shock in a 42°C water bath for 30–60 s, then immediately incubate on ice for 2 min. Add 500 µL of antibiotic-free LB liquid medium and incubate at 37°C with shaking at 200 rpm for 1 h. Spread an appropriate amount of bacterial culture onto LB agar plates containing antibiotic (Kan 50 mg / L) and incubate upside down at 37°C for 12–16 h to obtain pTOPO-TA-MsPAP22 colonies.

[0123] 2.3 Identification and sequencing of positive clones

[0124] 2.3.1 Bacterial PCR: A single colony of pTOPO-TA-MsPAP22 was picked from the plate and inoculated into 500 μL of LB liquid medium containing antibiotic (Kan 50 mg / L). The culture was incubated at 37℃ with shaking at 220 rpm for 2–4 h. One μL of the bacterial culture was then used directly as a PCR template, and PCR was performed using universal primers (such as M13F and M13R) from the cloning vector. The reaction system and procedure are as follows:

[0125] Table 4. PCR reaction system of pTOPO-TA-MsPAP22 bacterial culture

[0126]

[0127] PCR program: 95℃ for 5 min; 95℃ for 30 s, 55℃ for 30 s, 72℃ for 1 min / kb, 30 cycles; 72℃ for 5 min.

[0128] 2.3.2 Electrophoresis identification: PCR products were subjected to 1% agarose gel electrophoresis. Positive clones with the same size as the target fragment were selected and sent to the company for bidirectional sequencing.

[0129] 2.3.3 Preservation: The strains whose sequencing results matched the reference sequence correctly were added to 40% sterile glycerol at a ratio of 1:1 (bacterial solution: glycerol) and stored at -80℃ for later use. The plasmid was named pTOPO-TA-MsPAP22 and was used for subsequent overexpression vector construction.

[0130] 2.4 Construction of vector overexpressing MsPAP22 gene

[0131] To study the function of the MsPAP22 gene, a plant overexpression vector needs to be constructed. The MsPAP22 gene sequence was cloned, and the plant binary expression vector pCAMBIA3301 was selected to construct the overexpression vector using a seamless cloning method.

[0132] 2.4.1 Amplification of the MsPAP22 gene fragment with homologous arms

[0133] Using the cloning vector pTOPO-TA-MsPAP22 plasmid as a template, and p3301-MsPAP22-F / R containing the homologous arm of the pCAMBIA3301 vector as primers, PCR amplification was performed using high-fidelity DNA polymerase. The primer sequences, reaction system, and procedure are as follows:

[0134] p3301-MsPAP22-F: ATGGCAAAATGCGCAAAGTC (SEQ ID NO. 5).

[0135] p3301-MsPAP22-R: CAGCTCTTGATGAGCAACTT (SEQ ID NO. 6).

[0136] Table 5 PCR amplification system of MsPAP22 gene fragment

[0137]

[0138] PCR reaction procedure: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 100 s, for a total of 30 cycles; final extension at 72℃ for 5 min. After PCR product detection by 1% agarose gel electrophoresis, it was purified by gel extraction using a DNA gel extraction kit, named p3301-MsPAP22-PCR, and stored at -20℃.

[0139] 2.4.2 Linearization of pCAMBIA3301 vector

[0140] The empty vector pCAMBIA3301 plasmid was linearized by single digestion with the restriction endonuclease Nco I, enabling seamless cloning. The digestion system is as follows:

[0141] Table 6. Enzyme digestion system of pCAMBIA3301 vector

[0142]

[0143] After gently mixing, the mixture was placed in a PCR instrument and reacted at 37°C for 15 min. The enzyme digestion product was subjected to 1% agarose gel electrophoresis, and the linearized vector fragment was recovered and purified by gel extraction and named pCAMBIA3301-Cut.

[0144] 2.4.3 Seamless Clonal Ligation Reaction

[0145] The purified target gene fragment (p3301-MsPAP22-PCR) and the linearized vector (pCAMBIA3301-Cut) were seamlessly ligated at a molar ratio (fragment:vector ≈ 3:1). The reaction system is as follows:

[0146] Table 7 pCAMBIA3301-MsPAP22 Seamless Cloning System

[0147]

[0148] Gently pipette to mix, incubate in a PCR instrument at 50°C for 30 min, then immediately place on ice. The ligation product was named pCAMBIA3301-MsPAP22-Ligation.

[0149] 2.4.4 Transformation and identification of ligation products into Escherichia coli

[0150] Take 5 µL of the ligation product and add it to 50 µL of freshly thawed Trans1-T1 chemocompetent cells. Incubate on ice for 30 min, heat shock at 42℃ for 45 s, and immediately incubate on ice for 2 min. Add 500 µL of sterile LB liquid medium and incubate at 37℃ with shaking at 200 rpm for 1 h. Spread an appropriate amount of bacterial culture onto LB solid medium containing 50 mg / L kanamycin (Kan) and incubate upside down at 37℃ overnight. Pick single colonies and perform colony PCR identification using primers p3301-MsPAP22-F and GUS-R. Send positive clones to the company for sequencing to verify the correctness of the inserted sequence and the accuracy of the reading frame. Expand the culture of the correctly sequenced strain, extract the plasmid to obtain the overexpression vector pCAMBIA3301-MsPAP22, and store it at -80℃ with 40% glycerol at a 1:1 ratio (bacterial culture:glycerol) for later use.

[0151] GUS-R sequence: AGTTTTTTGATTTCACGGGTTGGGG (SEQ ID NO.7)

[0152] 2.5 Agrobacterium-mediated transformation

[0153] To perform plant genetic transformation, the correctly constructed overexpression vector pCAMBIA3301-MsPAP22 was introduced into *Agrobacterium tumefaciens* competent cells. The purified plasmid was transformed into EHA105 competent cells using a freeze-thaw method. The transformed bacterial culture was plated on YEB agar plates containing 50 mg / L rifampicin and 50 mg / L kanamycin and incubated at 28°C in the dark for 2-3 days. Single clones were picked and identified by PCR using vector- or gene-specific primers. Positive clones were screened and stored at -80°C for later use. The specific operational steps are as follows:

[0154] 2.5.1 Thawing of competent cells: Place EHA105 competent cells stored in an ultra-low temperature freezer at -80℃ on the surface of an ice box and allow them to thaw naturally.

[0155] 2.5.2 Transformation of competent cells: Using a micropipette, the target plasmid DNA (pCAMBIA3301-MsPAP22) was introduced into the thawed suspensions of GV3101 and EHA105 competent cells, respectively, and gently mixed by pipetting. The mixture was placed in an ice bath for 10 minutes, then flash-frozen in liquid nitrogen for 5 minutes, immediately transferred to a 37°C water bath for heat shock for 5 minutes, and finally placed in an ice bath for 5 minutes again.

[0156] 2.5.3 Resuscitation and Cultivation:

[0157] In a clean bench, add 700 µL of antibiotic-free YEB liquid medium to each tube of conversion mixture and mix gently. Transfer the bacterial culture to a constant temperature shaker and incubate at 28°C and 200 rpm for 2 hours.

[0158] 2.5.4 Plate coating and incubation:

[0159] Centrifuge the revived bacterial culture at 4000 rpm for 1 minute, carefully discard a portion of the supernatant, and retain 200 μL of bacterial pellet. Resuspend the bacterial pellet in antibiotic-free YEB liquid medium, and evenly spread the entire resuspended solution onto the surface of YEB solid medium containing two antibiotics (rifampin 50 mg / L and kanamycin 50 mg / L). Seal the petri dishes with sealing film, invert them in a 28°C dark incubator, and incubate for 2-3 days until single colonies with a diameter of approximately 2-3 mm grow.

[0160] 2.5.5 Colony PCR identification:

[0161] Pick 3-5 single colonies and inoculate them into 1 mL of YEB liquid medium containing 50 mg / L rifampicin and 50 mg / L kanamycin, respectively, and incubate at 28°C with shaking for 12 hours. Use a small amount of bacterial culture as a template and perform colony PCR identification using primers p3301-MsPAP22-F and GUS-R.

[0162] PCR conditions: 95℃ for 5 min; 95℃ for 30 s, 55℃ for 30 s, 72℃ for 100 s, 30-34 cycles; 72℃ for 5 min. The PCR products were subjected to 1% agarose gel electrophoresis, and positive bands were compared. Colonies with band sizes matching the expected values ​​were selected as Agrobacterium-positive engineered strains.

[0163] 2.5.6 Strain preservation: After expanding the culture of the positively identified bacterial suspension, mix it with an equal volume of sterile 40% glycerol. Clearly label the strain name, vector, and date, aliquot, and store in an ultra-low temperature freezer at -80℃ for later use.

[0164] 2.6 Obtaining overexpression lines

[0165] 2.6.1 Alfalfa Conversion

[0166] 2.6.1.1 Preparation of bacterial culture: Transformation was performed using the Agrobacterium-mediated leaf disc method. A positive strain of Agrobacterium tumefaciens EHA105 containing the recombinant plasmid pCAMBIA3301-MsPAP22 was activated in YEB liquid medium at 28°C and 220 rpm. The bacterial culture was then further activated in 50 mL of double-antibiotic YEB medium (containing 50 mg / L rifampicin and 50 mg / L kanamycin), and cultured at 28°C with shaking (200 rpm) until the OD value reached (50 mg / L). 600 ≈0.8) will OD 600 The bacterial culture, having reached an OD of 0.8, was centrifuged at 4700 rpm for 10 min, and the bacterial cells were collected. The cells were then resuspended in SH3a liquid medium. The OD of the resuspended bacterial culture was then measured. 600 It reaches 0.3~0.4.

[0167] 2.6.1.2 Explant Preparation: Young alfalfa leaves were cut and sterilized by shaking with 10% sodium hypochlorite solution for 10 min, followed by rinsing with sterile water 5 times. The sterilized leaves were then immersed in SH3a bacterial suspension and sonicated until the leaf margins turned dark green. A vacuum system (-0.08 MPa) was then used for infiltration for 10 min. After removal, the leaves were incubated in the dark with low-speed shaking (70 rpm) for 15 min. The bacterial suspension on the leaf surface was blotted dry with sterile filter paper, and the underside of the leaves was placed on SH3a solid co-culture medium and pre-cultured in the dark for 24 h.

[0168] 2.6.1.3 Selective Regeneration Culture: The leaves from the previous step were washed 3-5 times with water containing 2 mg / L cefotaxime (Cef) and then applied to SH3a solid medium containing resistance (2 mg / L Cef + 2 mg / L phosmet (PPT)) to induce callus formation. Subculture was performed every 14 days. After callus formation, the leaves were transferred to MSBK medium containing resistance (2 mg / L Cef + 2 mg / L PPT) for light culture to induce shoot differentiation. Once shoots formed, they were transferred to SH9a medium containing resistance (2 mg / L Cef + 2 mg / L PPT) to induce rooting, ultimately obtaining complete transgenic seedlings. The seedlings were then transferred to vermiculite for hardening. When the seedlings were in good condition, leaves were taken for positive seedling identification.

[0169] 2.7 Identification of genetically transformed materials

[0170] 2.7.1 Identification of Alfalfa

[0171] Transgenic alfalfa plants obtained through tissue culture were selected, and genomic DNA was extracted from young leaves using a plant genomic DNA extraction kit. Specific procedures were performed according to the kit's instructions (Plant Genomic DNA Extraction Kit, Tiangen). The extracted DNA was stored at -20°C for later use. PCR amplification was performed using primers MsPAP22-F and GUS-R. The DNA from the test plant was used as a template for amplification, with wild-type (WT) alfalfa DNA as a negative control and the pCAMBIA3301-MsPAP22 recombinant plasmid as a positive control. After 1% agarose gel electrophoresis, if the test plant amplified the target band consistent with the positive control, it was considered a positively transformed plant.

[0172] To further verify the overexpression of the MsPAP22 gene at the RNA level, RNA was extracted from the DNA-positive plants using the Eastep Super Total RNA Extraction Kit. The specific steps were as follows: lysis buffer was added, the mixture was shaken, centrifuged, the supernatant was mixed with ethanol, column chromatography was performed, followed by DNase I digestion and washing. Finally, the RNA was eluted with sterile water, and the RNA concentration and purity were determined using a micro-spectrophotometer. Total RNA was reverse transcribed into cDNA using the HiScript III All-in-one RT SuperMix Perfect for qPCR kit (Nanjing Novizan Biotechnology Co., Ltd.). Using cDNA as a template, real-time quantitative PCR was performed using the Taq ProUniversal SYBR qPCR Master Mix (Nanjing Novizan Biotechnology Co., Ltd.). The MsPAP22 quantitative primer was qMsPAP22-F / R, and the alfalfa MsActin gene was used as an internal control (primer MsActin-F / R). The reaction was performed on a BIO-RAD CFX96 Touch real-time PCR instrument.

[0173] qMsPAP22-F: AACAATGGGGGAGCATACCTC (SEQ ID NO. 8).

[0174] qMsPAP22-R: CTGGACCTAAACCACCACAC (SEQ ID NO. 9).

[0175] MsActin-F: CAAAAGATGGCAGATGCTGAGGAT (SEQ ID NO. 10).

[0176] MsActin-R: CATGCACCAGTATGACGAGGTCG (SEQ ID NO. 11).

[0177] Reaction system: 10 µL Master Mix, 0.4 µL forward primer, 0.4 µL reverse primer, 2 µL cDNA (diluted to approximately 100 ng / µL), 7.2 µL sterile water.

[0178] Reaction program: 95℃ for 2 min; 95℃ for 5 s, 60℃ for 30 s, for a total of 40 cycles. Three biological replicates were set up for each sample, and the relative expression level of the gene was calculated using the 2-ΔΔCt method.

[0179] like Figure 2 As shown in Figure A, the pCAMBIA3301-MsPAP22 vector uses pCAMBIA3301 as its backbone and expresses the target gene MsPAP22 under the drive of the CaMV 35S constitutive promoter (Pro35S). It also contains the GUS reporter gene and the kanamycin resistance selection marker (KanR), with T-DNA left and right boundaries (LB, RB) on both sides.

[0180] like Figure 2 As shown in Figure B, the recombinant vector was transformed into alfalfa 'Zhongmu No. 4' using the Agrobacterium-mediated leaf disc method. After a series of tissue culture processes, including explant pre-culture, Agrobacterium co-infection, resistance screening, callus induction, somatic embryogenesis, and plant regeneration, regenerated transgenic seedlings were finally obtained.

[0181] like Figure 2 As shown in C, multiple independent transformant lines (such as OE1, OE3, OE4, OE5, OE6, OE7, OE9, etc.) were able to amplify the target band consistent with the positive control, while the wild type (Col-0) did not have this band, which preliminarily proves that the MsPAP22 gene has been integrated into the alfalfa genome.

[0182] like Figure 2 As shown in Figure D, compared with the wild type (Col-0), the expression level of the MsPAP22 gene was significantly upregulated in all the transgenic lines tested. Among them, the OE13 line showed the highest expression level, while the OE1 and OE10 lines also showed high expression levels. These three lines were selected for subsequent stress resistance experiments.

[0183] Example 3: Effects of MsPAP22 gene overexpression on stress resistance of transformed plants

[0184] 3.1 Functional validation of the MsPAP22 gene in alfalfa under salt stress

[0185] 3.1.1 Plant materials and treatment

[0186] Wild-type alfalfa (WT, "Zhongmu No. 4") and alfalfa MsPAP22 gene overexpression lines (OE1, OE10, OE13) obtained in Example 2 were used as materials. Cuttings with consistent growth were selected and transplanted into 1 / 2 Hoagland nutrient solution. After approximately 4 weeks of growth, salt stress treatment was applied, with separate salt stress treatment and control groups. The treatment group was watered with 1 / 2 Hoagland nutrient solution with a final NaCl concentration of 200 mM, while the control group was watered with an equal amount of normal 1 / 2 Hoagland nutrient solution. After approximately one week of treatment, once significant differences in plant growth were observed, leaves of similar size from the same layer were flash-frozen in liquid nitrogen and stored at -80°C for later use.

[0187] 3.1.2 Growth phenotype determination and analysis

[0188] 3.1.2.1 Measurement of plant height and root length

[0189] About two weeks after salt treatment, select plants with uniform growth and measure their height using a clearly graduated centimeter ruler. Plant height is measured as the vertical distance from the base of the plant to the top, with the remaining portion representing the actual root length. At least 5–10 plants from each treatment are randomly selected for measurement, and the average value is taken as the plant height phenotypic value for that treatment.

[0190] 3.1.2.2 Determination of Fresh and Dry Weight of Aboveground Parts / Roots

[0191] Immediately after measuring plant height and root length, samples were taken. Using sharp scissors or a blade, the above-ground parts (stems and leaves) of the plant were completely separated from the underground parts (roots) at the root collar. Free moisture on the surface of the above-ground parts and roots was quickly and gently blotted dry with absorbent paper. Using a precision electronic balance of 0.0001 g, the weight (g) of the above-ground parts and roots was measured separately, and the shoot fresh weight (SFW) and root fresh weight (RFW) were recorded. At least three biological replicates were set up for each treatment.

[0192] 3.1.2.3 Determination of Relative Moisture Content (RWC)

[0193] Take alfalfa leaves in physiologically consistent state after treatment and quickly weigh approximately 0.5 g (fresh weight, FW) using an analytical balance. Completely immerse the weighed sample in a centrifuge tube containing 50 mL of distilled water (the leaves can be cut open, but not shredded, to ensure accurate subsequent weighing), and allow to absorb water at room temperature for 4–6 hours (until the sample no longer gains weight). Then remove the leaves, gently blot the surface moisture with filter paper, and weigh again, recording the saturated fresh weight (TW). Place the same sample in a weighing dish and put it in an oven. Dry at 80℃ for 48–72 hours until constant weight. After removal, cool to room temperature in a desiccator and weigh immediately, recording the dry weight (DW). Calculate the relative water content (RWC) using the following formula. Three biological replicates were set up for each treatment. Data are expressed as mean ± standard deviation. Perform statistical analysis on the data.

[0194] 3.1.2.4 Determination of photosynthetic pigment content

[0195] (1) Sampling and processing: Take leaves of similar size from the same layer of alfalfa to be tested, rinse quickly with deionized water and blot dry with filter paper. Accurately weigh 0.1 g of fresh leaf tissue, carefully cut the leaves into small pieces with scissors, and put them into a 15 mL capped centrifuge tube. Add 10 mL of 95% ethanol to the centrifuge tube. Wrap the centrifuge tube with aluminum foil to protect it from light, and let it stand at room temperature for 48 h for extraction, during which it can be gently shaken until the leaf tissue completely loses its chlorophyll and turns white.

[0196] (2) Absorbance determination: After extraction, the extract was thoroughly mixed. The absorbance values ​​of the sample extract were measured at wavelengths of 645 nm and 663 nm using a UV-Vis spectrophotometer (A645, A663), with three biological replicates for each treatment. The instrument was zeroed with 95% ethanol, and the total chlorophyll content was calculated using the following formula.

[0197] Total chlorophyll content = (20.2 × A) 645 +8.2×A 663 )×V / (1000×W)

[0198] In the formula:

[0199] A 645 and A 663 The absorbance values ​​are at wavelengths of 645 nm and 663 nm, respectively.

[0200] V represents the total volume of the chlorophyll extract (unit: mL).

[0201] W represents the fresh weight of the plant sample used (in g).

[0202] 1000 is the conversion factor from milligrams per liter (mg / L) to milligrams per gram (mg / g).

[0203] like Figure 3 and Figure 4 As shown, after 7 days of treatment with 200 mM salt stress, plant height decreased significantly for all genotypes. The plant height of OE10 was significantly higher than that of WT (…). Figure 4 a). After salt stress, the aboveground fresh weight of all lines decreased, with the WT decreasing significantly, while the overexpression lines did not show a significant decrease. The aboveground fresh weight of WT was significantly different from that of the overexpression lines. Figure 4 b). After salt stress, the relative water content of all lines decreased, with WT decreasing significantly, while the decrease was not significant in the overexpression lines. The difference in relative water content between WT and the overexpression lines was significant. Figure 4 c). After salt stress, the total chlorophyll content of all lines decreased significantly, and the difference in total chlorophyll content between WT and the overexpression lines was significant. Figure 4 d). This indicates that under salt stress, the overexpression lines maintained the best plant height, relative water content, and chlorophyll content, and were less inhibited than the WT lines, suggesting that the overexpression lines had the strongest salt tolerance.

[0204] 3.1.2.5 Measurement of cell membrane damage and oxidative stress indicators

[0205] (1) Measurement of relative conductivity

[0206] Sample preparation: Take the leaf to be tested (select mature leaves with consistent physiological state) and rinse thoroughly with deionized water. Use scissors to take 0.1 g of uniformly sized leaf tissue (weigh accurately).

[0207] Initial conductivity determination: The weighed leaf samples were placed in 15-20 mL centrifuge tubes containing 15 mL of ultrapure water (ddH2O). A centrifuge tube containing only an equal volume of ultrapure water was set up as a blank control. The centrifuge tubes were placed on a shaker and shaken at 150 rpm at 25°C for 24 h. After shaking, the conductivity of the sample solution was measured using a conductivity meter and recorded as R1, and the conductivity of the blank solution was measured and recorded as R0.

[0208] Complete conductivity determination: After measuring R1, tightly cap the centrifuge tube (containing the sample) and the blank tube (containing ultrapure water), and boil them in a boiling water bath for 30 min to kill the tissue and completely release intracellular electrolytes. After cooling to room temperature, equilibrate again on a shaker for 1 hour to ensure uniform temperature. Using the same conductivity meter, measure the conductivity of the sample solution separately, denoted as R2, and measure the conductivity of the blank solution at this time, denoted as R0'.

[0209] Calculate the relative conductivity: Calculate the relative conductivity of the sample using the following formula, expressed as a percentage (%) of the relative degree of cell membrane damage.

[0210] Relative conductivity (%) = [(R1-R0) / (R2-R0')] × 100%

[0211] Where R1-R0 represent the electrolytes leaked from the damaged tissue of the sample, and R2-R0' represent the total amount of electrolytes completely released from the tissue cells. Each treatment was performed in at least three biological replicates, and the final results are expressed as mean ± standard error.

[0212] (2) Determination of malondialdehyde (MDA) content

[0213] The malondialdehyde (MDA) content was determined using the malondialdehyde (MDA) content detection kit from Beijing Solarbio Science & Technology Co., Ltd.

[0214] Sample preparation: Take approximately 0.1 g of fresh leaves from WT and overexpressing plants OE1, OE10, and OE13 after different treatments, place them in a 2 mL centrifuge tube, and grind them thoroughly with liquid nitrogen. Add 1 mL of the kit extraction buffer and homogenize on ice. Centrifuge at 8000 g, 4℃ for 10 min, collect the supernatant, and immediately place it on ice for testing.

[0215] (3) Assay of antioxidant enzyme (CAT, POD) activity

[0216] The catalase (CAT) activity assay kit and peroxidase (POD) activity assay kit from Beijing Solarbio Science & Technology Co., Ltd. were used for the assays.

[0217] Sample preparation is the same as for MDA determination.

[0218] (4) Detection of superoxide dismutase (SOD) activity

[0219] Superoxide dismutase (SOD) activity was measured using a superoxide dismutase (SOD) activity assay kit from Beijing Solarbio Science & Technology Co., Ltd. Sample processing was the same as for MDA assay.

[0220] (5) Histochemical staining of reactive oxygen species (ROS)

[0221] DAB staining (for H2O2 detection): Take leaves (first trifoliate leaf from the top downwards) from the control and salt-stressed alfalfa. Gently wash the leaf surface with distilled water, then immerse in sufficient DAB staining solution under vacuum for 20 minutes. Incubate at room temperature in the dark for 6 hours, shaking the solution occasionally to ensure complete immersion. Discard the staining solution and transfer the leaves to anhydrous ethanol. Heat in a boiling water bath for 30 minutes, shaking intermittently to remove chlorophyll. Remove the leaves and transfer them to a dish soaked in 95% ethanol for morphological preparation and photography. DAB reacts with H2O2 under the catalysis of peroxidase to form a water-insoluble brown polymer. The staining depth is directly proportional to the H2O2 content. The brown precipitate area indicates H2O2 accumulation, and the color intensity is positively correlated with H2O2 content.

[0222] Preparation of DAB staining solution: Weigh 0.05 g of DAB powder (purchased from Solarbio) and dissolve it in 45 mL of distilled water. Add 25 µL of Tween 20 and 500 µL of 1 M disodium hydrogen phosphate solution, and adjust the pH to 3.8 using hydrochloric acid. This staining solution should be prepared fresh and stored away from light.

[0223] NBT staining (detection) The specific process is the same as DAB staining, except that the DAB staining solution is replaced with NBT staining solution.

[0224] NBT can be with The reaction produces a water-insoluble blue formazan precipitate; the staining depth reflects... Accumulation level. The treated leaves show a blue precipitate area, which is... Accumulation sites.

[0225] Preparation of NBT staining working solution: Weigh 0.1 g NBT powder (purchased from Solarbio) and dissolve it in 50 mL of freshly prepared 50 mM PBS buffer. This staining solution should be prepared fresh before use and stored protected from light.

[0226] like Figure 5 As shown in Figure a, under normal conditions, there was no significant difference in CAT activity among the different genotypes. After salt stress treatment, the CAT activity of all genotypes decreased significantly. Among them, the decrease in CAT activity was the most significant in WT; while the decrease in CAT activity in the three overexpression lines (OE1, OE10, and OE13) was significantly smaller than that in WT, and they maintained relatively high CAT levels under salt stress.

[0227] like Figure 5As shown in b, under salt stress, POD activity was reduced in all plants compared to the normal control. The POD activity of the three overexpression lines (OE1, OE10, and OE13) was not significantly different from the control, but was significantly higher than that of the control. This indicates that overexpression of MsPAP22 can more effectively activate POD to reduce the effects of salt stress.

[0228] like Figure 5 As shown in c, salt stress led to an increase in MDA content in WT, indicating that the cell membrane was damaged by oxidation. In contrast, the MDA content of the three overexpression lines decreased, and the difference between them and WT was statistically significant, indicating that the MsPAP22 overexpression lines were not affected by membrane lipid peroxidation damage.

[0229] like Figure 5 As shown in Figure d, under salt stress, the relative conductivity of all plants increased significantly, indicating increased membrane permeability and impaired membrane integrity. However, the relative conductivity of WT increased the most. In contrast, the relative conductivity values ​​of the three overexpression lines were significantly lower than those of WT, indicating that their cell membranes suffered less damage under salt stress and their membrane systems were more stable.

[0230] Figure 5 The results show that MsPAP22 overexpression can enhance the antioxidant defense capacity of alfalfa and maintain cell membrane integrity, effectively improving its salt tolerance.

[0231] like Figure 6 As shown in a~b, under control conditions, the leaves of WT and all overexpression lines showed very pale colors after NBT and DAB staining, only very light blue or very light brown, indicating that under normal growth conditions, the ROS levels in plants of all genotypes were maintained at a very low steady-state level, with no obvious oxidative stress. Under 200 mM NaCl salt stress, ROS accumulation in all leaves increased significantly, but there were significant differences between different genotypes. The leaves of wild-type WT showed a very deep blue-black color after NBT staining and a deep reddish-brown color after DAB staining, indicating that its leaves showed significant ROS accumulation under salt stress. The accumulation of large amounts of H2O2 led to severe oxidative stress. The leaves of the overexpressing lines were lighter in color than those of the WT lines, indicating that overexpression of MsPAP22 can reduce the oxidative stress caused by salt stress on the plants.

[0232] 3.2 Functional validation of the MsPAP22 gene in alfalfa under low phosphorus stress

[0233] 3.2.1 Plant materials and treatment

[0234] Wild-type alfalfa (WT, "Zhongmu No. 4") and the obtained alfalfa MsPAP22 gene overexpression lines (OE1, OE10, OE13) were used as materials. Cuttings with consistent growth were selected and transplanted into 1 / 2 Hoagland nutrient solution for cultivation. When the plants reached a suitable growth stage (approximately 3 weeks), low phosphorus stress was applied. A low phosphorus treatment group and a control group were set up. The low phosphorus treatment group (Low phosphorus, LP) was irrigated with 500× low phosphorus modified Hoagland nutrient solution (50 µmol·L⁻¹). -1 KH2PO4, and the control group was irrigated with an equal volume of 1 / 2 Hoagland nutrient solution (500 µmol·L⁻¹). -1 KH₂PO₄ was used to cultivate the plants in an artificial climate incubator (16 h light / 8 h dark, temperature 26℃ / 22℃, relative humidity 60%), with the nutrient solution changed every 4 days. Once the plants exhibited a clear phenotype, leaves of similar size from the same layer were flash-frozen in liquid nitrogen and stored at -80℃ for later use. Various phenotypic and physiological indicators were then measured.

[0235] 3.2.2 Growth phenotype analysis

[0236] Plant height (PH) and root length (RL) were measured using a ruler, and the root / shoot ratio (R / S) was calculated. The plants were carefully divided into aboveground parts (stems and leaves) and roots. The roots were rinsed thoroughly with distilled water, blotted dry with sterile filter paper, and the aboveground fresh weight (SFW) and root fresh weight (RFW) were measured separately. The samples were then placed in an oven and blanched at 105°C for 30 min, followed by drying at 75°C to constant weight. The aboveground dry weight (SDW) and root dry weight (RDW) were measured separately. Each treatment had 6–8 biological replicates.

[0237] like Figure 7 As shown, under low phosphorus conditions, the growth of all plants was affected, but the overexpression lines were less affected by low phosphorus stress than the wild type, especially OE13. Figure 7 a). Compared to normal phosphorus treatment, plant height and root length were significantly reduced in WT under low phosphorus conditions, but the reduction in plant height and root length was not significant in overexpression lines. Figure 7(b~c). The plant height of overexpressing lines OE1 and OE13 was significantly greater than that of the wild type, and the root length of overexpressing lines OE1 and OE10 was significantly longer than that of the wild type. This indicates that overexpression of MsPAP22 may promote root growth under low phosphorus stress, thereby enhancing phosphorus uptake. Low phosphorus stress caused a decrease in the aboveground fresh weight of all plants, and the aboveground fresh weight of the overexpressing lines (OE1, OE10, OE13) was significantly higher than that of the wild type. Figure 7 d). Low phosphorus stress caused a decrease in root fresh weight in all plants. The decrease in root fresh weight in the overexpression lines (OE1, OE10, OE13) was significantly smaller than that in the total root weight (WT). Under low phosphorus stress, there was no significant difference between OE13 and plants under normal phosphorus conditions. Figure 7 e) may be an adaptive response of the root system to obtain more phosphorus.

[0238] Figure 7 The results showed that under low phosphorus stress (LP), compared with wild-type alfalfa (WT), the overexpression lines (OE1, OE10, OE13) exhibited stronger low phosphorus tolerance by maintaining higher plant height, longer root systems, and greater aboveground and root biomass. This indicates that the MsPAP22 gene can improve the phosphorus uptake or utilization efficiency of alfalfa, thereby enhancing its ability to adapt to low phosphorus stress.

[0239] 3.2.3 Leaf color observation and photosynthetic pigment content determination

[0240] Mature leaves (especially older leaves at the base) from each treatment group were collected, and the leaf color was observed.

[0241] The specific procedure for determining photosynthetic pigment content is the same as in 3.3.2.4, except that 0.15 g of fresh leaves are weighed.

[0242] like Figure 8 As shown in Figure a, under normal phosphorus conditions, the leaves of both the wild-type WT and the overexpression lines (OE1, OE10, and OE13) were healthy green, with no significant difference in leaf color. After 14 days of low phosphorus stress, the overall growth of all lines was inhibited. However, leaf differentiation emerged. Mature leaves of the wild-type WT (especially the older leaves at the base) showed obvious chlorosis and yellowing, indicating severe damage to its photosynthetic organs. However, the leaves of the overexpression lines maintained a relatively good green color, with significantly less yellowing than those of the WT lines, particularly the OE10 and OE13 lines.

[0243] like Figure 8 As shown in b, under normal phosphorus conditions, there was no significant difference in chlorophyll content between WT and the overexpression lines. Under low phosphorus stress, the total chlorophyll content of all lines decreased significantly, and the total chlorophyll content of WT leaves was significantly lower than that of the overexpression lines (OE1, OE10, OE13).

[0244] Figure 8 The results indicate that overexpression of MsPAP22 can maintain the chlorophyll content of plants under low phosphorus stress, thereby better maintaining leaf greenness and the stability of the photosynthetic system.

[0245] The above description is merely an embodiment of the present invention and does not limit the patent scope of the present invention. Any equivalent structural transformations made based on the content of the present invention specification, or direct or indirect applications in other related technical fields, are similarly included within the patent protection scope of the present invention.

Claims

1. A plant stress resistance gene MsPAP22, characterized in that, The nucleic acid sequence of MsPAP22 is as shown in SEQ ID NO.1 or has more than 90% identity with it.

2. A carrier, characterized in that, The carrier comprises MsPAP22 as described in claim 1.

3. The carrier according to claim 2, characterized in that, The vector includes a cloning vector or an overexpression vector.

4. The carrier according to claim 3, characterized in that, The cloning vector is pTOPO-TA, and the overexpression vector is pCAMBIA3301.

5. A host cell, characterized in that, The host cell comprises the vector described in any one of claims 2 to 4.

6. The host cell according to claim 5, characterized in that, The host cells include Trans1-T1, DH5α, or EHA105.

7. A type of callus tissue, characterized in that, The callus tissue comprises any of the host cells described in claims 5 to 6.

8. The application of MsPAP22 as described in claim 1, any of the vectors described in claims 2 to 4, any of the host cells described in claims 5 to 6, or the callus tissue described in claim 7.

9. The application according to claim 8, characterized in that, The application includes at least one of the following: (1) Application in improving the ability of plants to resist salt stress; (2) Application in improving the ability of plants to resist oxidative stress; (3) Application in improving the ability of plants to resist low phosphorus stress.

10. The application according to claim 9, characterized in that, MsPAP22 is overexpressed in the plant, preferably alfalfa.

Images