KASP molecular markers related to stem thickness of soybean and application thereof

Abstract

This invention discloses a KASP molecular marker related to the thickness of soybean main stem and its application, belonging to the field of molecular genetics and breeding technology. The nucleotide sequence of the KASP molecular marker is shown in SEQ ID NO.1, and a T / C base mutation exists at position 26 of the sequence shown in SEQ ID NO.1. Compared with traditional markers, the development of the KASP molecular marker of this invention significantly improves the detection throughput, allowing a large number of samples to be processed in a single reaction, greatly improving the efficiency of genotyping and breeding selection; it can accurately distinguish SNP variations, and the genotyping results are accurate and reliable.

Description

Technical Field

[0001] This invention belongs to the field of molecular genetic breeding technology, specifically involving KASP molecular markers related to the thickness of soybean main stems and their applications. Background Technology

[0002] Soybeans, an important dual-purpose crop for both grain and oil in my country, are often severely affected by lodging, which also poses significant challenges to mechanized harvesting. Increasing stem diameter is a key approach to improving soybean lodging resistance and increasing yield, and this effect is particularly pronounced in modern cultivation models such as intercropping. Stem diameter is significantly positively correlated with soybean lodging resistance. A thicker stem base diameter effectively enhances the plant's mechanical strength, improves its resistance to pressure and bending, and reduces the risk of lodging. Furthermore, thicker stems have more developed vascular bundles, which facilitates the transport of water and nutrients and promotes healthy plant growth. Therefore, genetic improvement of soybean stem diameter is of great significance for achieving high and stable soybean yields and adapting to mechanized harvesting.

[0003] In recent years, researchers have conducted systematic studies on soybean stem diameter traits using various genetic analysis methods such as genome-wide association analysis (GWAS) and QTL mapping. Some studies have identified SNP loci and QTL intervals associated with soybean stem diameter. For example, Zhang Youyi (Zhang Youyi. Genome-wide association analysis of yield-related traits in soybean micro-core germplasm populations [D]. Nanjing: Nanjing Agricultural University, 2017.) identified nine SNP loci significantly associated with stem diameter based on GWAS, distributed on chromosomes 2, 5, 10, 14, 15, and 18; Li Wenbin et al. (Li Wenbin, Wu Hang, Liu Ji et al. Genome-wide association analysis of lodging resistance-related traits in soybean [J]. Journal of Northeast Agricultural University, 2017.) 021, 52 (03): 1-12. ) Twenty SNP loci significantly associated with soybean stem diameter were detected by GWAS, and one important candidate gene was screened; Zhou Rong et al. (Zhou Rong, Chen Haifeng, Wang Xianzheng et al. Dynamic analysis of QTLs for soybean plant height and stem diameter at different developmental stages [J]. Journal of Plant Genetic Resources, 2010, 11 (03): 349-359.) used SSR markers to locate 19 stem diameter QTLs, of which one QTL was stably detected in 3-year repeated experiments; Sun et al. (SUN CY, YANG YM, JIA L, et al. QTL mapping of the genetic basis of stem diameter in soybean[J]. Planta, 2021, 253(5): 109.) used a recombinant inbred line population to perform fine QTL mapping of stem diameter and predicted three potential candidate genes; Chen et al. (CHEN L, LI F, LI L, et al. QTL Mapping and candidategene mining for stem diameter using genetic basis of cultivated soybean and wild soybean[J]. Agronomy, 2024, 14[5]: 1019.) used a chromosome segment replacement line population to locate one stem diameter-related gene.

[0004] Although existing technologies have identified some genetic loci associated with soybean stem diameter, most of these loci are only at the level of association analysis and have not been converted into molecular markers that can be directly applied to breeding practices. Competitive allele-specific PCR (KASP) is a highly efficient and accurate SNP genotyping technique with advantages such as low cost, high throughput, and strong specificity, and has been widely used in marker-assisted breeding of crops. However, there are currently no publicly reported KASP markers that can be stably used for screening soybean stem diameter.

[0005] In existing technologies, soybean lodging resistance breeding largely relies on phenotypic selection, which suffers from drawbacks such as long cycles, low efficiency, and susceptibility to environmental influences. Furthermore, existing stem diameter-related genetic loci lack corresponding functional molecular markers, hindering early and rapid screening for this trait. Therefore, developing KASP molecular markers that are closely associated with soybean stem diameter, possess good stability, and can be directly applied to address the shortcomings of current breeding technologies has become an urgent need in the field of soybean lodging resistance molecular breeding. Summary of the Invention

[0006] Technical problem solved: To address the above-mentioned technical problems, this invention provides a KASP molecular marker related to the thickness of soybean main stem and its application. This marker can quickly and accurately classify the genotype of soybean stem thickness, providing a practical tool for molecular-assisted selection breeding of soybean lodging resistance, shortening the breeding cycle and improving breeding efficiency.

[0007] Technical solution: In a first aspect, the present invention provides a KASP molecular marker related to the thickness of the main stem of soybean, wherein the nucleotide sequence of the KASP molecular marker is shown in SEQ ID NO.1, and a T / C base mutation exists at position 26 of the sequence shown in SEQ ID NO.1; SEQ ID NO.1 (KASP-S10): AAAAAAACTAAAACTGAATTTTACCTGGTAAAGAGTAATCTGAGTGAAAGTTATCATCGTTGTCCCTAATATTGAGCCACTTTCTTACATTAAATTTTGGCCACGAAGACTGTAACCCAAAAATGAAAAGAAAAATTGGGGTCAGGGAGATAATAAAGAACTTGTATGGCCAAAAGTGGAAGATAGCAAGGACATTTATGTTTCATACCTTGGATATCTTCTTCTTCAACTCTGTTCTC.

[0008] Preferably, the C allelic variation of the KASP molecular marker site is positively correlated with soybean stem diameter, and the stem diameter of soybean germplasm carrying the C allelic variation is significantly higher than that of soybean germplasm carrying the T allelic variation.

[0009] In a second aspect, the present invention provides a primer set for amplifying the molecular marker described in the first aspect, the primer set comprising the primers shown in SEQ ID NO.2-SEQ ID NO.4; SEQ ID NO.2 (S10_4019902-F1): GGAAGGTGACCAAGTTCATGCT CTAAAACTGAATTTTACCT; SEQ ID NO.3 (S10_4019902-F2): GAAGGTCGGAGTCAACGGATT CTAAAACTGAATTTTACCC; SEQ ID NO.4 (S10_4019902-R): GTTACAGTCTTCGTGGCCAAA; Note: Underlined sequences are fluorescent adapter sequences, and bolded sequences are SNP sites.

[0010] Thirdly, the present invention provides a kit for identifying the thickness of the main stem of soybean, comprising the primer set described in the second aspect.

[0011] Fourthly, the present invention provides the use of the KASP molecular marker described in the first aspect, the primer set described in the second aspect, or the kit described in the third aspect in any of the following: (1) Rapid screening of stem thickness trait in soybean germplasm resources; (2) Early selection of soybean hybrid offspring; (3) Cultivation of lodging-resistant soybean varieties.

[0012] Fifthly, the present invention provides a method for identifying the genotype of soybean main stem thickness, comprising the following steps: Using the genomic DNA of the soybean sample to be tested as a template, real-time quantitative PCR amplification was performed using the primer set shown in SEQ ID NO.2-SEQ ID NO.4. Genotyping was performed based on the fluorescence detection results of the amplified products to identify the thickness of the main stem of the soybean sample to be tested.

[0013] Preferably, if the fluorescence of the amplification product is consistent with the fluorescence of the fluorescent group labeled by the primer shown in SEQ ID NO.2, then the soybean sample to be tested is a soybean with a thinner stem; if the fluorescence of the amplification product is consistent with the fluorescence of the fluorescent group labeled by the primer shown in SEQ ID NO:3, then the soybean sample to be tested is a soybean with a thicker stem. If both fluorescence signals are detected at the same time, it indicates that it is a heterozygous genotype with moderate stem thickness.

[0014] Preferably, the volume ratio of primer F1 shown in SEQ ID NO.2, primer F2 shown in SEQ ID NO.3, and primer R shown in SEQ ID NO.4 in the reaction system of the real-time PCR amplification is 2:2:5, and the concentration of the stock solution of each primer is 10 μM.

[0015] Preferably, the reaction procedure for the quantitative real-time PCR amplification is as follows: hot-start enzyme activation at 95 ℃ for 1 min; followed by touch-down amplification: hot-start enzyme activation at 95 ℃ for 1 min; followed by touch-down amplification: denaturation at 95 ℃ for 15 s, annealing temperature decreasing by 0.6 ℃ per cycle from 60 ℃ to 54 ℃ for 15 s, extension at 72 ℃ for 20 s, for a total of 10 cycles; then normal cycle amplification: denaturation at 95 ℃ for 15 s, annealing at 54 ℃ or 57 ℃ for 15 s, extension at 72 ℃ for 20 s, for a total of 26–35 cycles; finally, incubation at 30 ℃ for 60 s, and reading the fluorescence signal.

[0016] Beneficial effects: Compared with traditional markers, the KASP molecular marker developed in this invention significantly improves the detection throughput, can process a large number of samples in a single reaction, and greatly improves the efficiency of genotyping and breeding selection; it can accurately distinguish SNP variations, and the genotyping results are accurate and reliable. Attached Figure Description

[0017] Figure 1 This is a schematic diagram for measuring stem diameter. Figure 2 The graph shows the frequency distribution of soybean stem diameter, where A is the normal distribution of stem diameter in Nanjing in 2024, and B is the normal distribution of soybean stem diameter in Yangzhou in 2024. Figure 3 This is a graph showing the GWAS analysis results of soybean stem diameter in a two-year environment. In the graph, A is the Manhattan plot of GWAS analysis of stem diameter in a 24-day Nanjing environment, and the solid line represents -log 10 (p)>5, indicating that this locus is significantly associated with soybean stem diameter (the same applies below); B is the QQ plot of GWAS analysis of stem diameter in Nanjing environment 24; C is the Manhattan plot of GWAS analysis of stem diameter in Yangzhou environment 24; D is the QQ plot of GWAS analysis of stem diameter in Yangzhou environment 24; Figure 4 This is a comparison of stem diameter haplotypes; Figure 5 This is a schematic diagram of the KASP classification. Detailed Implementation

[0018] The present invention will be described in detail below with reference to specific embodiments: Example 1: Identification of SNPs related to the thickness of soybean main stem This study used 283 natural soybean germplasm resources from China, provided by the Institute of Economic Crops, Jiangsu Academy of Agricultural Sciences. These included 212 cultivars, 52 local varieties, and 19 wild varieties, with no transgenic material. The 283 soybean germplasm accessions were planted in Nanjing and Yangzhou in 2024 using a randomized block design, with each germplasm accession planted in one row at a spacing of 0.5 meters, and normal field management was implemented. Due to limited seed germination, the actual number of varieties participating in the experiment was 274 in Yangzhou and 262 in Nanjing. At the R6 stage of soybean growth, 8 plants were randomly selected (5 plants were selected in Yangzhou due to population uniformity issues caused by a typhoon). The diameter of the internode below the cotyledon node was measured using calipers, which is the stem diameter. Measurement locations are shown below. Figure 1 As shown.

[0019] The stem diameter measurement data were processed using Excel software, and the standard deviation (SD) and extreme values ​​(maximum / minimum) were calculated. The coefficient of variation (CV), skewness, and kurtosis were calculated using SPSS Statistics 26 software, and ANOVA analysis and normality tests (Kolmogorov-Smirnov test) were performed. The results are shown in Table 1 below. Table 1. Statistics on stem diameter of soybean materials in two environments. , In the Yangzhou (24YZ) environment of 2024, the maximum soybean stem diameter (Max) was 10.36 mm and the minimum (Min) was 4.08 mm; in the Nanjing (24NJ) environment of 2024, the maximum soybean stem diameter was 16.92 mm and the minimum was 4.92 mm, indicating that stem diameter is influenced by the environment. Figure 2 As shown, the soybean stem diameter in both environments conforms to a normal distribution (Yangzhou p=0.2≥0.05, Nanjing p=0.00≤0.05, which is basically acceptable) and can be used for GWAS analysis.

[0020] A high-density physical map of a natural population containing 2,597,425 SNPs was used, with a linkage disequilibrium interval of 120 kb (ZHANG W, XU W, ZHANG H, et al. Comparative selective signature analysis and high-resolution GWAS reveal a new candidate gene controlling seed weight in soybean [J]. Theor Appl Genet, 2021, 134(5):1329-1341.). GWAS analysis was performed using a mixed linear model (MLM) based on the R software GAPIT 3.0 package. QQ plots and Manhattan plots were drawn using the qqman package, with the SNP's -log 10 (P)≥5 is the threshold for significant association.

[0021] The chromosome distribution of significant loci in the two environmental stem thickness GWAS analyses is shown in Table 2 below: Table 2. Chromosomal distribution of significant loci in stem thickness analysis under two environmental conditions using GWAS. , From Table 2 and Figure 3 It can be seen that in the Nanjing environment (E1) in 2024, significantly associated SNP sites were distributed on chromosomes 2, 3, 5, 6, 7, 8, 9, 10, 13, 14, 15, 16, 17, 18 and 19; in the Yangzhou environment (E2) in 2024, significantly associated SNP sites were distributed on chromosomes 1, 2, 3, 6, 10, 12, 13, 14, 15, 17 and 18; among them, SNP_3977824 (E1) and SNP_4019902 (E2) on chromosome 10 co-localized within a 120kb linkage disequilibrium interval, and the co-localized sites S10_3977824 and S10_4019902 were identified as stable SNP sites related to soybean stem diameter.

[0022] A comparison of stem diameters at different haplotypes on chromosome 10 (as shown in Table 3 below) was conducted, and the results are as follows: Figure 4 As shown, soybean germplasm carrying the T base has a smaller stem diameter than soybean germplasm carrying the C base.

[0023] Table 3 Comparison of stem diameter haplotypes , SNP site sequence verification: The upstream and downstream sequences of the S10_4019902 site were obtained from the Phytozome database and sequence alignment was performed using the NCBI database. This site is located in the gene... Glyma.10G045100A base substitution occurs, encoding the protein SF15-TYPE I INOSITOL POLYPHOSPHATE 5-PHOSPHATASE 8.

[0024] Example 2: Design and validation of KASP markers related to soybean stem diameter KASP primer design: Based on the SNP site (S10_4019902) identified in Example 1, specific primers for the KASP marker were designed using the NCBI online tool Primer-Blast (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi), as shown in Table 4 below: Table 4. KASP-labeled specific primers , Note: Underlined sequences are fluorescent adapter sequences, and bolded sequences are SNP sites.

[0025] Primer validation: 21 soybean germplasms with significant differences in stem diameter were selected (10 with relatively thick stems, 6 with relatively thin stems, and 5 with medium stems). Genomic DNA was extracted and PCR amplification and typing were performed using designed KASP-labeled specific primers.

[0026] Extraction of genomic DNA from soybean leaves (CTAB method): (1) Take 0.1-1g of fresh or liquid nitrogen-frozen tissue and grind it into fine powder in liquid nitrogen (the finer the better, in order to reduce the reaction time of DNase). (2) Transfer the powder into a centrifuge tube and immediately add CTAB lysis buffer preheated to 65°C (2% CTAB, 1.4M NaCl, 100mM Tris-HCl pH8.0, 20mM EDTA). (3) Bathe in a 65℃ water bath for 30-60 minutes, gently inverting and mixing 2-3 times during the process; (4) Add an equal volume of chloroform / isoamyl alcohol (24:1), shake vigorously for 2-3 minutes to emulsify, and centrifuge at 12000 rpm for 10 minutes; (5) Carefully aspirate the upper aqueous phase and add an equal volume of isopropanol to the supernatant, mix gently, and let stand at -20°C for 30 minutes; (6) Centrifuge at 12000 rpm for 10-15 minutes, discard the supernatant, and a white precipitate will be visible at the bottom of the tube; (7) Add 1 mL of 70%-75% ethanol to rinse the precipitate (to remove salt and residual organic reagents), gently tap the bottom of the tube to suspend the precipitate, centrifuge to discard the ethanol, and repeat once; (8) Invert the pellet at room temperature to air dry, then add 50-100 μL of TE buffer (pH 8.0) or sterile water to dissolve the DNA; (9) Use Nanodrop to measure the concentration of DNA.

[0027] The three primers in Table 4 were mixed in a volume ratio of F1:F2:R = 2:2:5, with each primer stock solution having a concentration of 10 μM. The resulting Primer Mix could be used directly in the reaction system. The PCR reaction system was prepared as shown in Table 5. The mixed PCR reaction system was amplified on a real-time PCR instrument (the amplification program is shown in Table 6 below), and the fluorescence signal was read. The excitation / detection channels were set to FAM (~520 nm) and HEX (~556 nm).

[0028] Table 5 PCR reaction system

[0029] Table 6 PCR Amplification Procedure

[0030] The verification results are as follows Figure 5 As shown, the KASP-S10 marker can clearly distinguish the T / C allelic variation at the S10_3977824 locus. The average stem diameter of the 10 germplasms carrying the C allelic variation was 8.25 mm, which was significantly higher than that of the 6 germplasms carrying the T allelic variation (average stem diameter 7.98 mm). The genotyping accuracy of the KASP molecular marker reached 95%, indicating that the designed KASP marker has high specificity and can be used for soybean stem diameter genotyping.

[0031] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A KASP molecular marker associated with stem thickness in soybean, characterized in that: The nucleotide sequence of the KASP molecular marker is shown in SEQ ID NO.1, and a T / C base mutation exists at position 26 of the sequence shown in SEQ ID NO.

1.

2. The KASP molecular marker related to soybean main stem thickness according to claim 1, characterized in that: The C allelic variation of the KASP molecular marker site was positively correlated with soybean stem diameter, and the stem diameter of soybean germplasm carrying the C allelic variation was significantly higher than that of soybean germplasm carrying the T allelic variation.

3. A primer set for amplifying the molecular marker according to claim 1 or 2, characterized in that: The primer set includes the primers shown in SEQ ID NO.2-SEQ ID NO.

4.

4. A kit for identifying the thickness of soybean main stem, characterized in that: Includes the primer set as described in claim 3.

5. The use of the KASP molecular marker related to soybean main stem thickness as described in claim 1, the primer set as described in claim 3, or the kit as described in claim 4, in any of the following: (1) Rapid screening of stem thickness trait in soybean germplasm resources; (2) Early selection of soybean hybrid offspring; (3) Cultivation of lodging-resistant soybean varieties.

6. A method for identifying the genotype of soybean main stem thickness, characterized in that, Includes the following steps: Using the genomic DNA of the soybean sample to be tested as a template, the primer set described in claim 3 is used for real-time quantitative PCR amplification. The genotype is determined based on the fluorescence detection results of the amplified products to identify the thickness of the main stem of the soybean sample to be tested.

7. The method for identifying the genotype of soybean main stem thickness according to claim 6, characterized in that: If the fluorescence of the amplification product is consistent with the fluorescence of the fluorescent group labeled by the primer shown in SEQ ID NO.2, then the soybean sample to be tested is a soybean with a relatively thin stem; if the fluorescence of the amplification product is consistent with the fluorescence of the fluorescent group labeled by the primer shown in SEQ ID NO.3, then the soybean sample to be tested is a soybean with a relatively thick stem. If both fluorescence signals are detected at the same time, it indicates that it is a heterozygous genotype with moderate stem thickness.

8. The method for identifying the genotype of soybean main stem thickness according to claim 6, characterized in that: The reaction procedure for quantitative real-time PCR amplification is as follows: hot-start enzyme activation at 95 ℃ for 1 min; followed by touchdown amplification: denaturation at 95 ℃ for 15 s, annealing temperature decreasing by 0.6 ℃ per cycle from 60 ℃ to 54 ℃ for 15 s, extension at 72 ℃ for 20 s, for a total of 10 cycles; then normal cycle amplification: denaturation at 95 ℃ for 15 s, annealing at 54 ℃ or 57 ℃ for 15 s, extension at 72 ℃ for 20 s, for a total of 26–35 cycles; finally, incubation at 30 ℃ for 60 s, and reading the fluorescence signal.

Images