A biosensor and electrochemical detection method for detecting staphylococcus aureus enterotoxin a

By modifying the electrode with MXene/AuNPs nanocomposite material and designing chain displacement reaction, a biosensor was constructed, which solved the problems of complex operation and low sensitivity of existing SEA detection methods, and realized efficient and simple SEA detection.

CN122361561APending Publication Date: 2026-07-10NANJING FORESTRY UNIV

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
NANJING FORESTRY UNIV
Filing Date
2026-04-20
Publication Date
2026-07-10

AI Technical Summary

Technical Problem

Existing methods for detecting Staphylococcus aureus enterotoxin A (SEA) are cumbersome, costly, and have low sensitivity, making them unsuitable for food safety monitoring.

Method used

Electrodes were modified with MXene/AuNPs nanocomposite materials, and biosensors were designed using chain substitution reaction (SDR). The chain substitution reaction was triggered by the specific binding of the SEA aptamer to the P1 probe, forming a P2/P4 double chain, which was fixed on the electrode surface by Au-S covalent bonds to achieve signal amplification.

Benefits of technology

It significantly improves detection sensitivity and stability, simplifies the operation process, and can quickly respond to and distinguish target SEA from interfering substances, making it suitable for actual sample detection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122361561A_ABST
    Figure CN122361561A_ABST
Patent Text Reader

Abstract

This invention discloses a biosensor and electrochemical detection method for detecting Staphylococcus aureus enterotoxin A (SEA). The biosensor includes an electrode modified with an MXene / AuNPs nanocomposite material, a recognition probe complex, a signal probe complex, and a capture probe. This invention increases the electrode's conductivity and specific surface area by modifying the electrode surface with the MXene / AuNPs complex. Simultaneously, it introduces a chain substitution reaction signal amplification strategy, achieving efficient amplification of the electrochemical signal and significantly improving detection sensitivity. This sensor combines the excellent properties of nanomaterials with a nucleic acid signal amplification strategy, exhibiting good specificity, stability, and repeatability in SEA detection. Furthermore, this sensor requires no complex pretreatment, has a rapid response, and shows great potential for detection in practical food samples.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a biosensor and an electrochemical detection method, and more particularly to a biosensor and an electrochemical detection method for detecting Staphylococcus aureus enterotoxin A. Background Technology

[0002] Foodborne illnesses caused by bacterial contamination have a significant impact on human health and food safety. Staphylococcal enterotoxins (SEs) are key virulence factors leading to Staphylococcus aureus food poisoning incidents, with clinical symptoms including abdominal pain, vomiting, diarrhea, and muscle spasms. Among known SEs, Staphylococcal enterotoxin A (SEA) has attracted considerable attention due to its prominent pathogenicity. Epidemiological data show that over 70% of staphylococcal food poisoning cases are closely related to SEA. SEA possesses extremely high biotoxicity, thermal stability, strong resistance to proteases, and superantigenic activity. These characteristics allow SEA to persist throughout food production, processing, storage, transportation, and sales, primarily contaminating high-protein foods such as poultry products, eggs, and dairy products.

[0003] Given the serious hazards of enterotoxin A (SEA), establishing efficient and sensitive detection technologies is of significant public health importance. Currently, routine SEA detection methods mainly include chromatographic analysis, molecular biological detection, and immunological analysis. Although these methods exhibit good detection sensitivity, their practical application still faces certain limitations: chromatographic techniques involve cumbersome and time-consuming pretreatment; molecular biological methods are susceptible to false negative results; and immunoassays are costly. These shortcomings severely restrict their widespread adoption in food safety monitoring. Therefore, there is an urgent need for a simple-to-operate, rapid-response, and highly sensitive biosensor for detecting Staphylococcus aureus enterotoxin A.

[0004] In recent years, electrochemical sensors have shown broad application prospects in the field of bacterial toxin detection due to their advantages such as rapid response, ease of operation, high sensitivity, and low cost. This technology is expected to break through the bottlenecks of traditional methods and provide new solutions for food safety detection. Efficient signal amplification strategies are a key element in constructing high-performance electrochemical biosensors. Currently, researchers have developed various nucleic acid-based signal amplification techniques and applied them to the field of biosensing, significantly improving detection sensitivity. Among these techniques, the chain substitution reaction (SDR)-based signal amplification method has attracted much attention due to its unique advantages. The core mechanism of SDR is the Watson-Crick base complementarity pairing principle. During the reaction, a free nucleic acid chain (i.e., the invading chain) partially hybridizes with the target chain in the double-stranded nucleic acid structure. Due to the stronger binding affinity between the invading chain and the target chain (having a longer complementary region or higher GC content), it can gradually competitively displace the other chain in the double strand, ultimately forming a thermodynamically more stable double-stranded complex with the target chain. SDRs exhibit high specificity, with their strand substitution process strictly adhering to the base complementary pairing rule. This characteristic enables the designed nucleic acid recognition elements to accurately identify target nucleic acid sequences, thereby significantly reducing the risk of false positives caused by nonspecific binding. Efficiently enriching nucleic acid probes onto the electrode surface through cyclic reactions can generate significant electrochemical signal amplification. However, most reported SEA electrochemical biosensors rely on expensive antibodies or complex conformational changes of DNA probes, which often leads to unstable results, low sensitivity, or complex operation. Summary of the Invention

[0005] Objectives of the invention: The first objective of this invention is to provide a biosensor for detecting Staphylococcus aureus enterotoxin A that is easy to operate, has a fast response, and is highly sensitive; the second objective of this invention is to provide an electrochemical detection method for Staphylococcus aureus enterotoxin A.

[0006] To achieve the aforementioned first objective, the technical solution for the biosensor provided by this invention is as follows:

[0007] This invention provides a biosensor for detecting Staphylococcus aureus enterotoxin A, comprising an electrode modified with MXene / AuNPs nanocomposite material, a recognition probe complex, a signal probe complex, and a capture probe; wherein, the recognition probe complex comprises an SEA aptamer and a P1 probe, the P1 probe being partially complementary to the SEA aptamer chain to form an aptamer / P1 double-stranded structure; the signal probe complex comprises a P2 probe and a P3 probe, the P2 probe being modified with a signal reporter molecule, and the P2 probe hybridizing with the P3 probe to form a P2 / P3 double-stranded structure; the capture probe comprises a P4 probe, the P4 probe being modified with a -SH group, the -SH group being used to fix it on the electrode surface via Au-S covalent bonds; wherein, after the recognition probe complex dissociates and releases the P1 probe, the P2 probe detaches from the P3 probe and hybridizes sequentially with the P1 probe and the P4 probe, ultimately obtaining a P2 / P4 double-stranded structure.

[0008] The sequence of the SEA aptamer is shown in SEQ No. 1; the sequence of the P1 probe is shown in SEQ No. 2; the sequence of the P2 probe is shown in SEQ No. 3; the sequence of the P3 probe is shown in SEQ No. 4; and the sequence of the P4 probe is shown in SEQ No. 5.

[0009] Specifically, the sequence of the SEA aptamer is shown in SEQ No. 1:

[0010] CCTAACCGATATCACACTCACAGTATACCGCTCCACCAGTGTGATATCGGGATCTGCTGACGTTGGTCGTCATTGGAGTATC;

[0011] The sequence of probe P1 is shown in SEQ No. 2: GAACTGTGAGTGTGATA;

[0012] The sequence of the P2 probe is shown in SEQ No. 3: MB-GGCTGTATCACACTCACAGTTC;

[0013] The sequence of the P3 probe is shown in SEQ No. 4: GTGAGTGTGATACAG;

[0014] The sequence of the P4 probe is shown in SEQ No. 5: GTGAGTGTGATACAGCC-(CH2)6-SH.

[0015] When the target analyte, Staphylococcus aureus enterotoxin A, is present, Staphylococcus aureus enterotoxin A binds to the SEA aptamer chain, and the P1 probe is released from the aptamer / P1 double chain. The released P1 probe binds to the P2 probe in the P2 / P3 double chain to form the P1 / P2 double chain, releasing the P3 probe. The P4 probe binds to the P2 probe in the P1 / P2 double chain to form the P2 / P4 double chain, and the P1 probe is released from the P1 / P2 double chain to re-enter the cyclic reaction. The P2 / P4 double chain is bound to the electrode surface through Au-S covalent bonds.

[0016] The electrode modified with MXene / AuNPs nanocomposite material includes an electrode and the MXene / AuNPs nanocomposite material modified on the electrode surface. Using MXene / AuNPs nanocomposite material as a substrate material to modify the electrode not only significantly improves the electrode's conductivity but also greatly increases its effective specific surface area, providing numerous binding sites for DNA probes and effectively enhancing sensor sensitivity. MXene is a two-dimensional transition metal carbide / nitride.

[0017] The preparation method of MXene / AuNPs nanocomposite material is as follows: a mixed solution of HCl and LiF is used as an etching solution to etch Ti3AlC2 powder to obtain monolayer MXene nanosheets; MXene is dispersed in water to obtain MXene dispersion; HAuCl4 solution is added dropwise to MXene dispersion; after the reaction is completed, MXene / AuNPs nanocomposite material is obtained.

[0018] The electrode is a glassy carbon electrode.

[0019] The signal reporting molecule is methylene blue (MB).

[0020] To achieve the second objective mentioned above, the technical solution of the electrochemical detection method provided by the present invention is as follows:

[0021] This invention provides an electrochemical detection method for Staphylococcus aureus enterotoxin A using the above-mentioned biosensor, comprising the following steps:

[0022] (1) The SEA aptamer and the P1 probe are annealed to obtain the aptamer / P1 double-chain structure, i.e., the recognition probe complex.

[0023] (2) The P2 probe and the P3 probe undergo an annealing reaction to obtain the P2 / P3 double chain, which is the signal probe complex;

[0024] (3) Add the test solution to the recognition probe complex obtained in step (1), incubate, and the P1 probe is released; then add the signal probe complex and P4 probe obtained in step (2) to carry out a chain substitution reaction to generate a P2 / P4 double-stranded complex; the P2 / P4 double-stranded complex contains a signal reporter molecule and a -SH group;

[0025] (4) The P2 / P4 double-chain complex obtained in step (3) is drop-coated onto the electrode surface and incubated. The P2 / P4 double-chain complex is fixed on the electrode by the -SH group. This electrode is used as the working electrode to measure the electrochemical signal.

[0026] (5) Replace the test solution in step (3) with a series of Staphylococcus aureus enterotoxin A standard solutions of varying concentrations, repeat steps (1)-(4), and plot a standard curve with the logarithm of concentration as the abscissa and the electrochemical signal value as the ordinate; substitute the signal value measured in the test solution into the standard curve to calculate the concentration of Staphylococcus aureus enterotoxin A in the test sample.

[0027] In step (1), the molar concentration ratio of the SEA aptamer to the P1 probe is 1:0.5-1.5.

[0028] Preferably, the molar concentration ratio of the SEA aptamer to the P1 probe is 1:0.75-1.5, and more preferably, the molar concentration ratio is 1:1-1.25.

[0029] In step (3), the incubation time between the identification probe complex and the test solution is at least 40 min.

[0030] Preferably, the incubation time between the identification probe complex and the test solution is 40-60 min.

[0031] In step (3), the reaction time for the chain displacement reaction is at least 60 minutes.

[0032] Preferably, the reaction time for the chain displacement reaction is 60-75 min.

[0033] In step (4), the incubation time for the P2 / P4 double-chain complex to be drop-coated onto the electrode surface is at least 90 min.

[0034] Preferably, the incubation time for the P2 / P4 double-chain composite drop-coated onto the electrode surface is 90-120 min.

[0035] In step (4), when measuring the electrochemical signal, a glassy carbon electrode is used as the working electrode, a saturated calomel electrode is used as the reference electrode, and a platinum wire electrode is used as the counter electrode.

[0036] Invention Principle: When the target compound SEA is present in the detection system, it specifically binds to the aptamer, causing the dissociation of the aptamer / complementary chain (P1) double-chain structure and releasing the initial trigger chain P1. Subsequently, the P1 chain undergoes a chain substitution reaction with the MB-modified P2 / P3 double chain, forming a P1 / P2 double chain and releasing the P3 single chain. Further introduction of the thiol-modified (-SH) capture probe P4 leads to the dissociation of the P1 / P2 double-chain structure due to the higher thermodynamic stability between P2 and P4. P2 and P4 form a more stable double-chain complex, while the released P1 chain can re-enter the reaction cycle, thus achieving exponential signal amplification. Finally, the P2 / P4 double-chain complex, simultaneously modified with MB and -SH, is introduced into the MXene / AuNPs-modified electrode surface via Au-S covalent bonds. High-sensitivity detection of SEA is achieved by measuring the electrochemical signal generated by MB.

[0037] Beneficial Effects: Compared with existing technologies, this invention has the following significant advantages: By using MXene / AuNPs nanocomposite materials as the electrode substrate to construct the electrochemical sensing interface, the conductivity and effective specific surface area of ​​the electrode are significantly improved, providing a large number of binding sites for DNA probes and effectively enhancing sensor sensitivity; the ingeniously designed SDR signal amplification system outputs a large number of signal-tagged DNA double-stranded probes through target-triggered strand displacement reactions, realizing electrochemical signal amplification; this sensor exhibits excellent sensitivity, repeatability, and stability, while also demonstrating good distinguishing ability between target SEAs and other interfering substances; it shows good applicability in actual sample detection, and is simple to operate and has a fast response, providing an efficient analytical method for SEA detection. Attached Figure Description

[0038] Figure 1 This is a schematic diagram of the SEA electrochemical biosensor based on the MXene / AuNPs cooperative chain substitution reaction.

[0039] Figure 2 The figures show the characterization results of MXene and MXene / AuNPs materials from Example 1. (A) Transmission electron microscopy images of MXene and (B) MXene / AuNPs. (C) Zeta potential measurements of MXene and MXene / AuNPs. (D) X-ray diffraction patterns of Ti3AlC2, MXene, and MXene / AuNPs. (E) UV-Vis absorption spectra of HAuCl4, MXene, and MXene / AuNPs.

[0040] Figure 3 This is a diagram showing the results of the principle verification. The solution was prepared in 5 mM [Fe(CN)6] containing 0.1 M KCl. 3- / 4-(A) EIS curves and (B) CV curves obtained after stepwise scanning of the electrode in solution: (a) bare GCE, (b) MXene / AuNPs / GCE, (c) P2 / P4 double-stranded / MXene / AuNPs / GCE. (C) DPV curves in the absence of SEA (curve a) and in the presence of 100 ng / mL SEA (curve b). (D) DNA strand displacement reaction verified by 15% polyacrylamide gel electrophoresis (PAGE).

[0041] Figure 4 The results of the optimized experimental conditions are shown in the figure. (A) The molar ratio of aptamer to P1, (B) SEA incubation time, (C) DNA strand displacement reaction time, and (D) the binding time of the P2 / P4 double strands to the electrode have an effect on the change in current value. Error bars represent the standard deviation of three parallel experiments.

[0042] Figure 5 The results of quantitative detection of SEA are shown in the figure. (A) DPV curves for different concentrations of SEA (from a to g: 0.001 ng / mL, 0.01 ng / mL, 0.1 ng / mL, 1 ng / mL, 10 ng / mL, 100 ng / mL, 1000 ng / mL). (B) Relationship between peak current and SEA concentration. The inset shows the linear relationship between peak current and the logarithm of SEA concentration. Error bars represent the standard deviation of three parallel experiments.

[0043] Figure 6 Figure 1 shows the performance evaluation results of the electrochemical biosensor in Example 5. (A) Specificity study by measuring the DPV response of different interfering substances. The mixture consisted of BSA, OTA, AFB1, SEB, and SEA. The concentrations of the interfering substances and SEA were both 100 ng / mL. (B) Stability study of the electrochemical biosensor. (C) Repeatability study of the electrochemical biosensor. Error bars represent the standard deviation of three parallel experiments. Detailed Implementation

[0044] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0045] This invention presents a novel electrochemical biosensor based on the MXene / AuNPs synergistic strand displacement reaction, achieving efficient detection of SEA (Sexually Activated Acid). By using the MXene / AuNPs nanocomposite material as the electrode substrate to construct the electrochemical sensing interface, the conductivity and effective specific surface area of ​​the electrode are significantly improved, providing numerous binding sites for DNA probes and effectively enhancing sensor sensitivity. Simultaneously, a cleverly designed SDR signal amplification system outputs a large number of signal-labeled DNA double-stranded probes through the target-triggered strand displacement reaction, achieving electrochemical signal amplification. This sensor exhibits excellent repeatability and stability, while demonstrating good distinguishing ability between the target SEA and other interfering substances. It shows good applicability in actual sample detection, is simple to operate, and has a rapid response, providing a novel and efficient analytical method for SEA detection.

[0046] This invention provides a biosensor for detecting Staphylococcus aureus enterotoxin A, comprising an electrode with an MXene / AuNPs nanocomposite material surface-modified, a recognition probe complex, a signal probe complex, and a capture probe. The recognition probe complex includes an SEA aptamer and a P1 probe, with the P1 probe partially complementary to the SEA aptamer chain to form an aptamer / P1 double-stranded structure. The signal probe complex includes a P2 probe and a P3 probe, with the P2 probe modified with a signal reporter molecule, and the P2 probe hybridizing with the P3 probe to form a P2 / P3 double-stranded structure. The capture probe includes a P4 probe, which is modified with a -SH group, used to fix it to the electrode surface via Au-S covalent bonds. After the recognition probe complex dissociates and releases the P1 probe, the P2 probe detaches from the P3 probe and sequentially hybridizes with the P1 and P4 probes to ultimately obtain a P2 / P4 double-stranded structure.

[0047] The detection principle of the biosensor in this invention embodiment is as follows: Figure 1As shown, Ti3AlC2 was first selectively etched and exfoliated using an HCl / LiF mixed solution to obtain monolayer MXene nanosheets. Then, utilizing the strong reducing properties of the MXene nanosheets, chloroauric acid was directly reduced to gold nanoparticles (AuNPs) via an in-situ reduction method, and these nanoparticles were uniformly loaded onto the MXene surface. The prepared MXene / AuNPs nanocomposite material, used as a substrate material to modify the electrode, not only significantly improves the electrode's conductivity but also greatly increases its effective specific surface area, thereby enhancing the sensor's detection sensitivity. When the target compound SEA is present, it specifically binds to the aptamer, causing the dissociation of the aptamer / complementary chain (P1) double-chain structure and releasing the initial trigger chain P1. Subsequently, the P1 chain undergoes a chain substitution reaction with the MB-modified P2 / P3 double chain, forming a P1 / P2 double chain and releasing the P3 single chain. Further introduction of the thiol-modified (-SH) trapping probe P4 leads to the dissociation of the P1 / P2 double-chain structure due to the higher thermodynamic stability between P2 and P4. P2 and P4 form a more stable double-chain complex, while the released P1 chain can re-enter the reaction cycle, thus achieving exponential signal amplification. Finally, the P2 / P4 double-chain complex, simultaneously modified with MB and -SH, is introduced into the MXene / AuNPs-modified electrode surface via Au-S covalent bonds. High-sensitivity detection of SEA is achieved by measuring the electrochemical signal generated by MB.

[0048] All oligonucleotide chains involved in the embodiments of this invention were custom-synthesized by Sangon Biotech (Shanghai) Co., Ltd. Five oligonucleotide chains were designed in the embodiments of this invention: SEA aptamer chain, P1 probe, P2 probe, P3 probe, and P4 probe. The specific oligonucleotide chain sequences are shown in Table 1.

[0049] Table 1. Oligonucleotide chain sequences

[0050] Oligonucleotide chains Sequence (5'-3') SEA aptamers CCTAACCGATATCACACTCACAGTATACCGCTCCACCAGTGTGATATCGGGATCTGCTGACGTTGGTCGTCATTGGAGTATC P1 probe GAACTGTGAGTGTGATA P2 probe MB-GGCTGTATCACACTCACAGTTC P3 probe GTGAGTGTGATACAG P4 probe <![CDATA[GTGAGTGTGATACAGCC-(CH2)6-SH]]>

[0051] The electrochemical tests in this embodiment of the invention were performed using a three-electrode system, with a glassy carbon electrode as the working electrode, a saturated calomel electrode as the reference electrode, and a platinum wire electrode as the counter electrode. Electrochemical characterization was performed using cyclic voltammetry (CV), electrochemical impedance spectroscopy (EIS), and differential pulse voltammetry (DPV).

[0052] Example 1 Synthesis of MXene / AuNPs nanocomposites

[0053] This embodiment provides a method for synthesizing MXene / AuNPs nanocomposite materials. Based on existing literature reports, MXene materials can be prepared by selectively etching the Al atomic layers in a Ti3AlC2 precursor. An HCl / LiF mixed solution was used as the etching agent in the experiment. The specific experimental steps are as follows: First, 1.6 g of LiF was pre-mixed with 20 mL of HCl solution in a polytetrafluoroethylene (PTFE) reaction vessel and stirred at 500 rpm / min for 10 min. Then, 1 mg of Ti3AlC2 powder was added to the above mixed solution in small, repeated additions, and the etching reaction was carried out at a constant temperature of 50 °C for 48 h. After the reaction was completed, the precipitate was obtained by centrifugation (3500 rpm / min, 5 min). To remove residual LiF, the mixture was washed repeatedly with 1 M HCl solution until the supernatant became colorless and transparent. Subsequently, the mixture was repeatedly washed with ultrapure water until the pH of the system stabilized above 6. To obtain monolayer MXene nanosheets, the precipitate was subjected to ultrasonic treatment (ultrasonic power 240 W, duration 2 h) under nitrogen protection and ice-water bath conditions during the subsequent exfoliation process. The supernatant was then collected by centrifugation at 3500 rpm / min for 30 min. Finally, MXene powder samples were obtained by vacuum freeze-drying (48 h) for subsequent use.

[0054] MXene / AuNPs nanocomposites were prepared by an in-situ reduction method. First, 1 mg of MXene was dispersed in 5 mL of ultrapure water and sonicated for 20 min to ensure uniform dispersion. Then, 1 mL of HAuCl4 solution (20 mM) was added dropwise under continuous stirring (500 rpm / min). After reacting for 5 min, the precipitate was collected by centrifugation (6000 rpm / min, 5 min) and washed three times with ultrapure water to remove excess reactants. Finally, the obtained precipitate was freeze-dried under vacuum for 48 h to obtain the MXene / AuNPs nanocomposites.

[0055] The morphology of the prepared nanomaterials was characterized using transmission electron microscopy (TEM). Figure 2 As shown in A, the TEM image shows that MXene exhibits a typical two-dimensional sheet structure with a lateral dimension of approximately 1 μm and good dispersion. Figure 2 Figure B indicates that after in-situ reduction, a high density of AuNPs is uniformly distributed on the surface of the MXene sheets, while maintaining the two-dimensional morphology of MXene. Furthermore, to verify the successful synthesis of MXene / AuNPs, Zeta potential analysis was performed. The test results are as follows... Figure 2As shown in C, the Zeta potential of MXene is -29.9 mV, while the Zeta potential of MXene / AuNPs increases to -25.4 mV. This is due to the increased potential of Au... 3+ During the in-situ reduction process, MXene acts as an electron donor to reduce Au. 3+ Restore to Au 0 Simultaneously, the electron transfer effect leads to a decrease in the negative charge density on the MXene surface, resulting in a change in the Zeta potential. This potential change confirms the successful loading of AuNPs on the MXene surface, corroborating the TEM results and fully demonstrating the successful preparation of the MXene / AuNPs nanocomposite material.

[0056] The crystal structure of the prepared nanomaterials was characterized by X-ray diffraction (XRD) analysis. Figure 2 (D in the text). Compared with the Ti3AlC2 precursor, the diffraction pattern of MXene shows two significant structural feature changes: first, the intensity of the characteristic diffraction peak corresponding to Al at 2θ = 39° is significantly weakened; second, the (002) crystal plane diffraction peak shifts from 9.5° to a lower angle direction to 6.8°, while the peak intensity decreases significantly. These structural evolution features fully confirm that the phase transformation from Ti3AlC2 to MXene was successfully achieved through selective etching. In the XRD pattern of the MXene / AuNPs composite material, four characteristic diffraction peaks at 38.3°, 44.6°, 64.7°, and 77.7° can be observed, corresponding to the (111), (200), (220), and (311) crystal planes of face-centered cubic gold, respectively. It is worth noting that the characteristic diffraction peak positions of MXene in the composite material are highly consistent with those of pure MXene, indicating that the in-situ loading process of AuNPs did not significantly affect the crystal structure of MXene. XRD analysis results strongly confirm the successful preparation of MXene / AuNPs nanocomposites from a crystallographic perspective.

[0057] The MXene / AuNPs composite material was further characterized using ultraviolet-visible absorption spectroscopy (UV-vis). Figure 2 As shown in Figure E, MXene exhibits typical absorption characteristics in the 250–350 nm range, with a characteristic absorption peak at 756 nm, which is related to the electronic transition behavior in its two-dimensional layered structure. After the addition of HAuCl4, the UV-Vis absorption spectrum of MXene / AuNPs shows a decrease in the characteristic absorption peak of MXene, and an absorption peak appears at 550 nm. This is due to the surface plasmon absorption of AuNPs, indicating that AuNPs were formed in situ on the MXene surface through reduction. These results confirm the successful synthesis of the MXene / AuNPs nanocomposite material.

[0058] Example 2: Fabrication of a biosensor

[0059] This embodiment provides the preparation of a biosensor for detecting Staphylococcus aureus enterotoxin A, which includes the following steps:

[0060] (1) Pretreatment and modification of glassy carbon electrode

[0061] The glassy carbon electrode (GCE) was polished to a mirror finish on a chamois plate using alumina polishing powders of different particle sizes (1 μm, 0.3 μm, and 0.05 μm). After rinsing with ultrapure water, it was ultrasonically cleaned in anhydrous ethanol and ultrapure water to remove residual polishing powder and contaminants. It was then dried under nitrogen. Next, it was electrochemically activated in a 5 mM H₂SO₄ solution using cyclic voltammetry until symmetrical and reversible redox peaks were obtained. The electrode was then removed, rinsed with ultrapure water, and dried under nitrogen for later use.

[0062] 1 mg of MXene / AuNPs was uniformly dispersed in 1 mL of ultrapure water to prepare a 1 mg / mL MXene / AuNPs dispersion. Then, 10 μL of the above dispersion was drop-coated onto the pretreated GCE surface and allowed to air dry at room temperature to obtain an MXene / AuNPs / GCE modified electrode, which will be used for subsequent biosensor assembly and electrochemical testing.

[0063] (2) Biosensor assembly

[0064] Preparation of recognition probe complex: 2.5 μL of SEA aptamer (2 μM) was mixed with an equal volume of P1 complementary chain (2 μM), heated at 95 ℃ for 5 min, and slowly cooled to room temperature (1 h) to form a stable aptamer / P1 double chain structure.

[0065] Signal probe complex preparation: Equimolar concentrations of P2 and P3 (2.5 μL each, 2 μM) were mixed and subjected to the same treatment to form a P2 / P3 double-stranded structure.

[0066] Target recognition and strand displacement reaction: 2.5 μL of SEA solution of different concentrations was added to the aptamer / P1 solution and incubated at 37 °C for 40 min. Specific binding induced conformational changes in the aptamer, releasing different amounts of P1 strands. Then, P2 / P3 double-stranded solution and P4 solution (2.5 μL, 2 μM) were added and mixed, and incubated at 37 °C for 60 min. A strand displacement reaction generated a P2 / P4 double-stranded DNA complex with both MB and -SH modifications.

[0067] Electrode modification: The composite was drop-coated onto the surface of MXene / AuNPs / GCE and incubated for 90 min. The Au-S bond was used to fix the composite onto the electrode surface, and the resulting electrode was used as the working electrode for subsequent electrochemical signal detection.

[0068] (3) Electrochemical measurement

[0069] Electrochemical measurements were performed using a three-electrode system, with the modified glassy carbon electrode finally prepared in step (2) as the working electrode, a saturated calomel electrode as the reference electrode, and a platinum wire electrode as the counter electrode. Electrochemical characterization was performed using cyclic voltammetry (CV), electrochemical impedance spectroscopy (EIS), and differential pulse voltammetry (DPV). CV measurements were conducted in 5 mM [Fe(CN)6] containing 0.1 M KCl. 3- / 4- The tests were performed in solution, with a scan potential range of -0.2 to 0.6 V and a scan rate of 100 mV / s. EIS measurements were conducted using the same electrolyte system within a frequency range of 0.1 Hz to 10 kHz, with a bias potential of 0.265 V and an amplitude of 5 mV. DPV measurements were performed in 20 mM Tris-HCl buffer (pH 7.4), with a potential scan range of 0 to -0.6 V, using a pulse amplitude of 50 mV and a pulse width of 50 ms. All experiments were performed in triplicate. The error bars in the figure represent the standard deviation.

[0070] The modification process and electrochemical properties of the electrode interface were investigated using electrochemical impedance spectroscopy (EIS) and cyclic voltammetry (CV). In the EIS tests ( Figure 3 In curve A), the semicircular diameter in the high-frequency region of the Nyquist spectrum corresponds to the electron transfer resistance (Ret), while the linear portion in the low-frequency region reflects the diffusion-controlled process. Experimental results show that the Ret value (100 Ω) of the MXene / AuNPs-modified electrode (curve b) is significantly lower than that of the bare glassy carbon electrode (curve a, 250 Ω). This is attributed to the synergistic effect of MXene and the noble metal nanomaterial AuNPs, which significantly improves the electrode's conductivity. Further modification of the electrode surface with double-stranded DNA generated by the strand displacement reaction enhances the conductivity due to the negative charge of the DNA phosphate backbone and [Fe(CN)6]. 3- / 4- Due to electrostatic repulsion, the Ret value increases significantly. CV test results ( Figure 3 B) further validated this modification process: the bare GCE exhibited typical reversible redox peaks; after modification with MXene / AuNPs, the redox peak current increased significantly, indicating enhanced electrode conductivity; while after double-stranded DNA modification, the redox peak current decreased significantly due to the negatively charged DNA molecules hindering electron transfer. This phenomenon is consistent with the EIS test results, jointly confirming the successful construction of the electrochemical biosensor.

[0071] Furthermore, the feasibility of this biosensor was verified using differential pulse voltammetry (DPV), and the experimental results ( Figure 3 As shown in Figure C), without the addition of the target substance SEA (curve a), the aptamer / P1 double-stranded structure remains stable, preventing the subsequent strand displacement reaction from being triggered. This results in the absence of P2 / P4 double-stranded DNA probes carrying MB and -SH, thus only a weak background current signal is observed. When the target SEA is present in the system (curve b), its specific binding to the aptamer promotes the release of the P1 strand, thereby triggering a strand displacement amplification reaction. This ultimately produces a large number of P2 / P4 double-stranded DNA probes carrying MB and -SH. Through Au-S covalent bonding, the P2 / P4 double-stranded DNA probes are efficiently anchored on the MXene / AuNPs-modified electrode surface, generating a significantly enhanced electrochemical response signal.

[0072] The DNA strand displacement reaction process was validated using 15% polyacrylamide gel electrophoresis (PAGE). Specific sample loading protocols for each lane are detailed in Table 2. Figure 3 As shown in lane D, lane M is a 20 bp DNA marker. Lane 1 confirms that in the presence of SEA, the aptamer specifically binds to SEA, releasing a high-mobility P1 single strand. Upon the addition of P2 / P3 double strands (lane 2), the P1 strand undergoes a strand displacement reaction with the P2 / P3 double strand, forming a lower-mobility P1 / P2 double strand, while simultaneously releasing a high-mobility P3 single strand. Upon the introduction of the P4 strand (lane 3), the P4 strand undergoes a strand displacement reaction with the P1 / P2 double strand, producing a P2 / P4 double strand and re-releasing the P1 single strand. Clear P2 / P4 double-stranded bands and P1 and P3 single-stranded bands are visible within the lane. As a control, in the absence of SEA (lane 4), bands of the P2 / P3 double strand and free P4 single strands can be observed. These results not only confirm the successful execution of the strand displacement reaction but also validate the specific response of the detection system to SEA at the molecular level.

[0073] Table 2 Sample loading protocol for each lane of 15% polyacrylamide gel electrophoresis (PAGE)

[0074] M 1 2 3 4 5 6 SEA + + + - - - Aptamer + + + + - - P1 + + + + - - P2 - + + + + + P3 - + + + - + P4 - - + + + -

[0075] Example 3: Optimization of Key Conditions in Biosensor Fabrication

[0076] To achieve optimal detection performance for the target analyte SEA, key conditions in the biosensor fabrication were optimized using DPV. The main optimized conditions were: the molar ratio of aptamer to complementary strand P1, SEA incubation time, DNA strand displacement reaction time, and the binding time of the P2 / P4 double strands to the electrode.

[0077] The optimization process for the molar concentration ratio of aptamer to complementary chain P1 is as follows: 2.5 μL of SEA aptamer (2 μM) was mixed with 0.5 times, 0.75 times, 1 times, 1.25 times, and 1.5 times the concentration of P1 complementary chain (2.5 μL), respectively, that is, the molar concentration ratio of SEA aptamer to P1 complementary chain was 1:0.5, 1:0.75, 1:1, 1:1.25, and 1:1.5, respectively, to obtain a series of recognition probe complexes. The signal probe complex preparation steps, target recognition and chain replacement reaction steps, and electrode modification steps were the same as in Example 2. Finally, a series of biosensors were prepared and electrochemical tests were performed.

[0078] The optimization process for SEA incubation time is as follows: The preparation steps for the recognition probe complex and the signal probe complex are the same as in Example 2. In the target recognition and strand displacement reaction steps, 2.5 μL of SEA solution is added to the aptamer / P1 solution and incubated at 37 °C for 10 min, 20 min, 30 min, 40 min, and 50 min, respectively. Then, P2 / P3 double-stranded solution and P4 solution (2.5 μL, 2 μM) are added and mixed, and incubated at 37 °C for 60 min. A series of P2 / P4 double-stranded DNA complexes modified with MB and -SH are generated through the strand displacement reaction. The electrode modification steps are the same as in Example 2. Finally, a series of biosensors are obtained and electrochemical tests are performed.

[0079] The optimization process for the DNA strand displacement reaction time is as follows: The preparation steps for the recognition probe complex and the signal probe complex are the same as in Example 2. In the target recognition and strand displacement reaction steps, 2.5 μL of SEA solution is added to the aptamer / P1 solution and incubated at 37 °C for 40 min. Then, P2 / P3 double-stranded solution and P4 solution (2.5 μL, 2 μM) are added and mixed, and incubated at 37 °C for 15 min, 30 min, 45 min, 60 min, and 75 min, respectively. A series of P2 / P4 double-stranded DNA complexes modified with MB and -SH are generated through the strand displacement reaction. The electrode modification steps are the same as in Example 2. Finally, a series of biosensors are prepared and electrochemical tests are performed.

[0080] The optimization process for the binding time of P2 / P4 double strands to the electrode is as follows: The preparation steps of the recognition probe complex and the signal probe complex are the same as in Example 2. In the electrode modification step, the complex is drop-coated onto the surface of MXene / AuNPs / GCE and incubated for 30 min, 45 min, 60 min, 90 min and 120 min respectively. The P2 / P4 double strands are fixed on the electrode surface through Au-S bonds. The resulting electrode is the working electrode. Finally, a series of biosensors are prepared and electrochemical tests are performed.

[0081] This embodiment optimized the molar ratio of aptamer to complementary chain P1. P1, as the triggering chain for the chain substitution reaction, directly affects the accuracy of the experiment. In the presence of SEA, the aptamer specifically binds to SEA, releasing P1 and triggering the subsequent chain substitution reaction. Experiments showed that insufficient P1 concentration leads to a weakened signal response, while excessively high concentrations result in free P1 chains in the system, directly triggering the chain substitution reaction and increasing the background signal. Optimization results (…) Figure 4 A) indicates that when the molar ratio of aptamer to P1 is 1:1, the current difference ΔI (ΔI = I - I0, where I and I0 represent the current response values ​​with and without SEA, respectively) reaches its peak, thus this ratio is determined to be the optimal condition. Subsequently, the effect of SEA incubation time on the electrochemical signal was investigated, and the results ( Figure 4 As shown in B), the peak current increases with increasing incubation time, and then stabilizes after 40 minutes; therefore, 40 minutes was chosen as the optimal incubation time. In the chain displacement reaction time optimization experiment, it was observed that the current response value increases with increasing reaction time. Figure 4 The reaction reached stability after 60 min (C in the formula), indicating that the reaction was basically complete. Finally, the binding time of the P2 / P4 double-stranded DNA probe generated by the strand displacement reaction to the electrode was optimized. The experimental results (…) Figure 4 The D in the diagram shows that the signal reaches its maximum at 90 minutes.

[0082] In summary, the optimal conditions for biosensor fabrication are: a molar ratio of aptamer to P1 of 1:1, an SEA incubation time of 40 min, a DNA strand displacement reaction time of 60 min, and a P2 / P4 double-strand binding time to the electrode of 90 min.

[0083] Under optimal experimental conditions, a biosensor was prepared using the same steps and conditions as in Example 2, and the quantitative detection performance of the electrochemical biosensor for different concentrations of SEA was investigated. Figure 5 As shown in Figure A, the peak current exhibits a significant increasing trend with increasing SEA concentration. At 1×10⁻⁶... -3 Within a concentration range of ~100 ng / mL, the current response value showed a good linear relationship with the logarithm of the SEA concentration. Figure 5 (B) has a linear regression equation of y = 0.49x + 2.75, and a correlation coefficient R0. 2 The limit of detection (LOD) reached 0.9995. Based on S / N = 3 (where S represents the standard deviation of the blank signal and N is the slope of the calibration curve), the LOD of this sensor was calculated to be as low as 4.75 × 10⁻⁶. -5 ng / mL.

[0084] Comparative Example 1

[0085] Comparative Example 1 uses a plasma biosensor, which is described in detail in "AIT MAMMAR W, WILSON A, MICHE A, et al. Smartphone-assisted plasmonic biosensors for rapid on-site detection of foodborne pathogens and allergens[J]. Talanta, 2025, 291: 127864."

[0086] Comparative Example 2 uses an electrochemical aptasensor, which is described in detail in "SINGH S, AGRAWAL RK, NARA S. Electrochemical aptasensor for sensitive detection of staphylococcal enterotoxin type A in milk and fruit juice [J]. Microchimica Acta, 2024, 191(10): 636."

[0087] Comparative Example 3 used light scattering immunoassay, which is described in detail in "TONG W, DU Y, YAO M, et al. Gold nanocubes etching enhanced light scattering immunoassay for highly sensitive detection of Staphylococcusaureus enterotoxin A [J]. Food Chemistry, 2025, 479: 143713."

[0088] Comparative Example 4 used lateral flow immunoassays, which are detailed in “DUAN H, ZHAO L, WANG J, et al. Integrating lateral flow device with controllable gold in situ growth for sensitive detection of staphylococcalenterotoxin A in milk [J]. Analytica Chimica Acta, 2024, 1329: 343233.”.

[0089] Comparative Example 5 used a sandwich immunoassay, which is detailed in “CUI Y, WANG X, WU H, et al. A "one to two" novel sandwich immunoassay based on nanobodies for detection of staphylococcal enterotoxin A in food samples [J]. Food Control, 2024, 160: 110313.”

[0090] Comparative Example 6 used a fluorescent aptasensor, which is described in detail in "MA X, MENG R, YU M, et al. Label-free and low-background fluorescent structure-switching aptasensor for sensitive detection of staphylococcalenterotoxin A based on graphene oxide-assisted separation of ssDNA [J]. FoodControl, 2024, 155: 110105."

[0091] As shown in Table 3, compared with the SEA detection methods of Comparative Examples 1-6, the electrochemical biosensor established in this invention exhibits significant advantages, with a wider linear detection range and a lower detection limit. This superior detection performance is mainly attributed to the high conductivity, large specific surface area, and good biomolecule immobilization ability of the MXene / AuNPs modified electrode; simultaneously, signal amplification is achieved through the ingenious design of target-triggered chain displacement reactions.

[0092] Table 3 Comparison of this biosensor with the SEA detection methods of Comparative Examples 1-6

[0093] method Detection range (ng / mL) Detection limit (ng / mL) Comparative Example 1 2.8 ~ 45.5 0.6 Comparative Example 2 0.01 ~ 100 0.0124 Comparative Example 3 0.01 ~ 100 0.01039 Comparative Example 4 0.244 ~ 250 0.061 Comparative Example 5 0.5 ~ 512 0.43 Comparative Example 6 1 ~ 8000 0.899 Example 2 0.001 ~ 100 <![CDATA[4.75 × 10 -5 ]]>

[0094] Example 4: Detection of SEA in food samples

[0095] In this embodiment, milk and pork were selected as typical food samples for SEA spiked recovery experiments. Milk sample pretreatment was as follows: 10 mL of whole milk sample was diluted 10-fold with 20 mM Tris-HCl buffer (pH 7.4) to obtain a matrix solution. SEA standards were then added to prepare a series of milk spiked sample solutions with final concentrations of 0.01, 0.1, 1, 10, and 100 ng / mL. Pork sample pretreatment was as follows: 5 g of homogenized pork sample was accurately weighed and added to 10 mL of 3% (w / v) trichloroacetic acid solution. After ultrasonic-assisted extraction (240 W, 10 min), the sample was centrifuged at 10,000 rpm for 10 min at 15 ℃. The supernatant was collected, filtered through a 0.22 μm microporous membrane, and the pH of the filtrate was adjusted to neutral with 1 M NaOH solution. Finally, the filtrate was diluted 10-fold with 20 mM Tris-HCl buffer (pH 7.4). Prepare SEA-spiked pork sample solutions of 0.01 ~ 100 ng / mL as described above. Finally, the pretreated samples were detected using the prepared electrochemical biosensor under optimized conditions (the same electrochemical biosensor preparation conditions as in Example 2), the recovery rate was calculated, and the analytical performance of the sensor in actual samples was evaluated.

[0096] Given that SEA-contaminated food can cause serious gastrointestinal damage and lead to public health and safety issues such as food poisoning, this embodiment collected milk and pork, two typical food samples susceptible to SEA contamination, and investigated the analytical performance of the constructed electrochemical biosensor in actual food samples. A spiked recovery experiment was conducted, adding SEA standards to milk and pork samples to prepare sample solutions of different concentrations (0.01, 0.1, 1, 10, 100 ng / mL). The established electrochemical biosensor was then used to determine the SEA in the samples. The results showed that the recovery rate in milk samples was 96.61%–101.60%, with a relative standard deviation (RSD) of 2.34%–4.78%; the recovery rate in pork samples was 99.53%–109.80%, with an RSD of 1.50%–3.39% (Table 4). These results indicate that the sensor exhibits good accuracy in different food samples, effectively overcoming interference from complex food matrices, and demonstrating good potential for practical application.

[0097] Table 4. Detection results of SEA in milk and pork samples by electrochemical biosensor

[0098] Food samples Dosage (ng / mL) Detection volume (ng / mL) Recovery rate (%) Relative standard deviation (%) milk 0.01 0.009661 96.61 2.64 0.1 0.1014 101.40 4.78 1 1.016 101.60 2.34 10 10.02 100.20 2.83 100 100.32 100.32 3.27 pork 0.01 0.009953 99.53 3.31 0.1 0.1001 100.10 3.39 1 1.048 104.80 3.26 10 10.98 109.80 2.78 100 100.94 100.94 1.50

[0099] Example 5

[0100] The purpose of this embodiment is to examine the specificity, stability, and repeatability of the electrochemical biosensor.

[0101] A series of electrochemical biosensors were prepared using the same method as in Example 2 for the evaluation of specificity, stability and repeatability. The electrochemical testing methods were the same as in Example 2.

[0102] Specifically, in the specificity experiment, bovine serum albumin (BSA), ochratoxin A (OTA), aflatoxin B1 (AFB1), and staphylococcal enterotoxin B (SEB) were selected as interfering agents for the control experiment. Specifically, 20 mM Tris-HCl buffer solution (pH 7.4), 100 ng / mL BSA solution, 100 ng / mL OTA solution, 100 ng / mL AFB1 solution, 100 ng / mL SEB solution, 100 ng / mL SEA solution, and a mixed solution (composed of BSA, OTA, AFB1, SEB, and SEA in a concentration ratio of 1:1:1:1:1) were used to replace the SEA solution in the target recognition and chain displacement reaction step of Example 2. The remaining steps were the same as in Example 2. Experimental results ( Figure 6As shown in A), only SEA can generate a significant electrochemical response signal, and the signal intensity of each interfering substance is not significantly different from that of the blank control group. Furthermore, in the system where SEA and interfering substances coexist, the detection signal remains at a level comparable to that of a single SEA sample, which fully demonstrates the excellent specificity and anti-interference capability of this sensor.

[0103] In the stability experiment, the response signal of the electrochemical biosensor was measured after 1, 2, 3, 4, 5, 6, and 7 days, with the day the electrochemical biosensor was prepared being recorded as day 1. Stability experiment results ( Figure 6 As shown in B), the sensor retained 80.3% of its initial response signal within 7 days under storage conditions of 4 °C, indicating that it has good storage stability.

[0104] In the repeatability experiment, the same electrode was used to perform five repeated measurements on a 100 ng / mL SEA sample, and the relative standard deviation (RSD) of the current response was only 1.63%. Figure 6 (C in the figure) demonstrates that the method has excellent detection repeatability.

[0105] This invention presents a novel electrochemical biosensor based on a synergistic chain substitution reaction of MXene / AuNPs nanocomposite materials for efficient detection of foodborne inflammatory lesions (SEA). This sensor utilizes the unique electrochemical properties of the MXene / AuNPs composite material. By modifying the electrode surface with the MXene / AuNPs complex, the conductivity and specific surface area of ​​the electrode are increased. Simultaneously, a chain substitution reaction signal amplification strategy is introduced to achieve efficient amplification of the electrochemical signal, thereby significantly improving detection sensitivity. This sensor combines the superior properties of nanomaterials with a nucleic acid signal amplification strategy, exhibiting good specificity, stability, and repeatability in SEA detection. Furthermore, the sensor has a rapid response, demonstrating great potential for detection in practical food samples. This biosensor is expected to provide a new method for bacterial toxin detection and can be extended to the rapid detection of other foodborne microbial toxins by modifying the nucleic acid sequence.

Claims

1. A biosensor for detecting Staphylococcus aureus enterotoxin A, characterized in that, The invention comprises an electrode modified with MXene / AuNPs nanocomposite material, a recognition probe complex, a signal probe complex, and a capture probe. The recognition probe complex includes an SEA aptamer and a P1 probe, with the P1 probe partially complementary to the SEA aptamer chain to form an aptamer / P1 double-stranded structure. The signal probe complex includes a P2 probe and a P3 probe, with the P2 probe modified with a signal reporter molecule, and the P2 probe hybridizing with the P3 probe to form a P2 / P3 double-stranded structure. The capture probe includes a P4 probe, which is modified with a -SH group, used to fix it to the electrode surface via Au-S covalent bonds. The P2 probe is used to detach from the P3 probe and hybridize sequentially with the P1 and P4 probes after the recognition probe complex dissociates and releases the P1 probe, ultimately yielding a P2 / P4 double-stranded structure. The sequence of the SEA aptamer is shown in SEQ No. 1; the sequence of the P1 probe is shown in SEQ No. 2; the sequence of the P2 probe is shown in SEQ No. 3; the sequence of the P3 probe is shown in SEQ No. 4; and the sequence of the P4 probe is shown in SEQ No.

5.

2. The biosensor for detecting Staphylococcus aureus enterotoxin A according to claim 1, characterized in that, The electrode is a glassy carbon electrode.

3. The biosensor for detecting Staphylococcus aureus enterotoxin A according to claim 1, characterized in that, The signal reporting molecule is methylene blue.

4. An electrochemical detection method for Staphylococcus aureus enterotoxin A using the biosensor described in any one of claims 1-3, characterized in that, Includes the following steps: (1) The SEA aptamer and the P1 probe are annealed to obtain the aptamer / P1 double-chain structure, i.e., the recognition probe complex. (2) The P2 probe and the P3 probe undergo an annealing reaction to obtain the P2 / P3 double chain, which is the signal probe complex; (3) Add the test solution to the recognition probe complex obtained in step (1), incubate, and the P1 probe is released; then add the signal probe complex and P4 probe obtained in step (2) to carry out a chain substitution reaction to generate a P2 / P4 double-stranded complex; the P2 / P4 double-stranded complex contains a signal reporter molecule and a -SH group; (4) The P2 / P4 double-chain complex obtained in step (3) is drop-coated onto the electrode surface and incubated. The P2 / P4 double-chain complex is fixed on the electrode by the -SH group. This electrode is used as the working electrode to measure the electrochemical signal. (5) Replace the test solution in step (3) with a series of Staphylococcus aureus enterotoxin A standard solutions of varying concentrations, repeat steps (1)-(4), and plot a standard curve with the logarithm of concentration as the abscissa and the electrochemical signal value as the ordinate. Substitute the signal value measured in the test solution into the standard curve to calculate the concentration of Staphylococcus aureus enterotoxin A in the test sample.

5. The electrochemical detection method for Staphylococcus aureus enterotoxin A according to claim 4, characterized in that, In step (1), the molar concentration ratio of the SEA aptamer to the P1 probe is 1:0.5-1.

5.

6. The electrochemical detection method for Staphylococcus aureus enterotoxin A according to claim 4, characterized in that, In step (3), the incubation time between the identification probe complex and the test solution is at least 40 min.

7. The electrochemical detection method for Staphylococcus aureus enterotoxin A according to claim 4, characterized in that, In step (3), the reaction time for the chain displacement reaction is at least 60 minutes.

8. The electrochemical detection method for Staphylococcus aureus enterotoxin A according to claim 4, characterized in that, In step (4), the incubation time for the P2 / P4 double-chain complex to be drop-coated onto the electrode surface is at least 90 min.

9. The electrochemical detection method for Staphylococcus aureus enterotoxin A according to claim 4, characterized in that, In step (4), when measuring the electrochemical signal, a glassy carbon electrode is used as the working electrode, a saturated calomel electrode is used as the reference electrode, and a platinum wire electrode is used as the counter electrode.