A CPA primer probe set, kit, detection method and application for on-site rapid detection of citrus huanglongbing bacteria

Abstract

The application provides a CPA primer probe set, a kit, a detection method and application for rapidly detecting Candidatus Liberibacter aurantii in the field, and belongs to the technical field of molecular detection.The application provides a CPA primer probe set for detecting Candidatus Liberibacter aurantii, which comprises a primer set and a probe HLB-P; the primer set comprises HLB-FB, HLB-AP, HLB-OP, HLB-IP, HLB-CPR and HLB-RB, and the nucleotide sequences thereof are shown in SEQ ID NO:1 to SEQ ID NO:6 in sequence; and the nucleotide sequence of the probe HLB-P is shown in SEQ ID NO:7. The application further provides a kit, a device and a detection method for detecting Candidatus Liberibacter aurantii. The application provides a reliable technical means for diagnosing different tissues of Candidatus Liberibacter aurantii, and lays an important technical foundation for real-time monitoring of field diseases and development of prevention and control strategies.

Description

Technical Field

[0001] This invention belongs to the field of molecular detection technology, specifically relating to a CPA (Cross-priming Amplification) primer and probe set, kit, detection method, and application for rapid on-site detection of Huanglongbing (HLB) of citrus. Background Technology

[0002] Citrus Huanglongbing fungus ( Candidatus Liberibacter asiaticus is extremely destructive and seriously threatens the healthy development of the citrus industry. To date, pure in vitro culture of the citrus Huanglongbing pathogen has not been obtained. Its spread is mainly through short-distance transmission via insect vectors such as the citrus psyllid and the grapefruit psyllid, and long-distance transmission through seedlings and scions.

[0003] Currently, diagnostic methods for Huanglongbing (HLB) of citrus mainly include field symptom diagnosis, electron microscopy, and PCR technology. However, these methods generally suffer from problems such as being time-consuming, requiring complex equipment, and necessitating operation by professional personnel. Therefore, they are not suitable for rapid detection in the field, severely limiting the application and promotion of molecular detection technologies.

[0004] While isothermal amplification technologies, such as LAMP, reduce reliance on precision instruments and possess some potential for field applications, they still suffer from drawbacks such as cumbersome primer design, susceptibility to non-specific amplification interference, and strong subjectivity in product interpretation. They also exhibit insufficient stability in field samples, easily leading to false positives or false negatives, making it difficult to support large-scale, high-accuracy field screening needs. Furthermore, the currently used LAMP test strip detection method requires opening the reaction tube to aspirate the amplification product and adding it to the test strip, an operation highly susceptible to cross-contamination between samples, further increasing detection errors. Cross-primer amplification (CPA), an isothermal amplification technology independently developed in my country, has advantages in primer structure and amplification mechanism, exhibiting stronger specificity and anti-interference capabilities. However, this technology has stringent requirements for detection system parameters, and currently lacks mature supporting application solutions in the field of agricultural pathogen detection, as well as a mature and reliable rapid field detection solution for citrus Huanglongbing (HLB). Overall, existing technologies are either complex to operate and difficult to implement in the field, or lack stability and sensitivity, failing to simultaneously meet the application requirements of high sensitivity, high specificity, anti-interference, and ease of use. This severely restricts the early warning, accurate monitoring, and effective control of citrus Huanglongbing (HLB). Therefore, developing a rapid field detection method with high sensitivity and specificity, which can directly use crude nucleic acid extraction and requires no specialized equipment, is of great practical significance for achieving early detection, early treatment, and early control of HLB. Summary of the Invention

[0005] In view of this, the present invention provides a CPA primer and probe set for detecting Huanglongbing (HLB) of citrus, which can be used for rapid detection of HLB in the field. It is easy to operate and has the characteristics of high specificity and high sensitivity.

[0006] The present invention also provides a kit for detecting Huanglongbing (HLB) of citrus.

[0007] The present invention also provides a device for detecting Huanglongbing (HLB) of citrus.

[0008] The present invention also provides a method for detecting Huanglongbing fungus in citrus based on a fluorescence detection device.

[0009] To achieve the above objectives, the present invention provides the following technical solution: This invention provides a CPA primer and probe set for detecting Huanglongbing fungus in citrus, including a primer set and probe HLB-P; The primer set includes HLB-FB, HLB-AP, HLB-OP, HLB-IP, HLB-CPR, and HLB-RB; The nucleotide sequences of HLB-FB, HLB-AP, HLB-OP, HLB-IP, HLB-CPR and HLB-RB are shown in SEQ ID NO:1 to SEQ ID NO:6, respectively. The nucleotide sequence of the probe HLB-P is shown in SEQ ID NO:7.

[0010] Preferably, the 5' end of the probe HLB-P is labeled with a fluorescent group, and the 3' end of the probe HLB-P is labeled with a quenching group.

[0011] Preferably, the fluorescent group includes FAM, and the quenching group includes BHQ1.

[0012] This invention provides a kit for detecting Huanglongbing (HLB) of citrus, comprising the CPA primer and probe set, CPA reaction buffer, Bst DNA polymerase, dNTPs, betaine, and magnesium ions.

[0013] Preferably, the reaction system of the kit contains the following components at concentrations per 500 μL: HLB-FB 0.2 μM, HLB-AP 2 μM, HLB-OP 2 μM, HLB-IP 1 μM, HLB-CPR 2 μM, HLB-RB 0.2 μM, probe HLB-P 0.3 μM, 1×CPA reaction buffer, Bst DNA polymerase 6 U, dNTPs 0.3 mM, magnesium ions 6 mM, and betaine 1 M.

[0014] Preferably, it also includes crude DNA extract.

[0015] The present invention provides an apparatus for detecting Huanglongbing (HLB) of citrus, including the aforementioned reagent kit and a fluorescence detection device.

[0016] Preferably, the apparatus further includes a grinding device.

[0017] This invention provides a method for detecting Huanglongbing (HLB) of citrus based on a fluorescence detection device, comprising the following steps: Using the nucleic acid of the sample to be tested as a template, a CPA reaction is performed using the CPA primer and probe set, the kit, or the device to obtain the CPA reaction product; The fluorescence intensity of the CPA reaction product is measured, and the presence or absence of fluorescence intensity is used to determine whether the sample contains citrus Huanglongbing (HLB): when a fluorescence intensity signal is detected, it indicates that the sample is infected with HLB, otherwise it is not infected.

[0018] Preferably, the reaction procedure for the CPA reaction is: maintaining at 63°C for 15-30 minutes.

[0019] Compared with the prior art, the present invention has the following advantages: This invention provides a CPA primer-probe set for detecting *Citrus citrus Huanglongbing*, comprising a primer set and a probe HLB-P. The primer set includes nucleotide sequences as shown in SEQ ID NO:1~SEQ ID NO:6: HLB-FB, HLB-AP, HLB-OP, HLB-IP, HLB-CPR, and HLB-RB. The nucleotide sequence of the probe HLB-P is shown in SEQ ID NO:7. This invention designs multiple candidate probes targeting different positions of the target gene, and selects them one by one based on base structure and actual detection performance, ultimately choosing HLB-P for the entire detection system. The CPA primer-probe set is designed based on the conserved region sequence of the outer membrane protein (omp) of *Citrus citrus Huanglongbing*, exhibiting high specificity. It can specifically recognize *Citrus citrus Huanglongbing*, but does not recognize common citrus pathogens such as *Bacillus anthracis*, *Colletotrichum gloeosporioides*, *Xanthomonas citrus*, *Bacillus proliferatingis*, and four viruses (Citrus citrus degeneration virus, Citrus yellowing vein virus, Citrus leaf mottle virus, and Citrus peel cracking virus). The CPA primer-probe set has high sensitivity, with a minimum detection limit of 8.3 copies / μL for plasmid copy number and a minimum detection limit of 500 fg / μL for positive DNA concentration, while the corresponding detection limit of qPCR is 5 pg / μL. The detection sensitivity of the CPA primer-probe set of this invention is ten times higher than that of qPCR.

[0020] This invention provides a method for detecting Huanglongbing (HLB) of citrus based on a fluorescent base, comprising the following steps: Using the nucleic acid of the sample to be tested as a template, a CPA reaction is performed using the CPA primer and probe set, the kit, or the device to obtain the CPA reaction product. The fluorescence intensity of the CPA reaction product is measured, and the presence or absence of fluorescence intensity determines whether the sample contains *Citrus citrus Huanglongbing-related pathogen*: when a fluorescence intensity signal is detected, it indicates that the sample is infected with *Citrus citrus Huanglongbing-related pathogen*, otherwise it is not infected. This invention optimizes the concentration of Bst DNA polymerase used in the reaction system through gradient optimization, ultimately determining the optimal enzyme addition amount suitable for this detection system, ensuring amplification efficiency and detection stability. This invention develops a novel field detection technology for *Citrus citrus Huanglongbing-related pathogen*. This technology innovatively integrates cross-primer amplification (CPA) technology with molecular beacon probes, combined with a pocket-type fluorescence detection base, to establish a simple, rapid, and accurate field pathogen detection system for citrus. The method has the following advantages: First, it achieves specific and highly sensitive identification of the target pathogen, with a detection limit of 8.3 copies / μL and a detection limit of 500 fg / μL for the lowest positive DNA concentration; second, the detection process is simple and quick, involving two steps and a reaction time of 30 minutes (20 minutes if the pathogen content is high). The matching rate between field samples and standard detection technology results is as high as 94.24%, making it suitable for field operation and of great practical significance for ensuring the healthy development of the citrus industry. Attached Figure Description

[0021] Figure 1 This is a schematic diagram of the probe binding site.

[0022] Figure 2 This indicates a positive result from the probe test.

[0023] Figure 3 The results of the detection were optimized for enzyme concentration; where A represents the optimization results of the CPA system with different amounts of Bst DNA polymerase (2U, 6U, 10U), the horizontal axis represents the copy number of the omp recombinant plasmid, and the vertical axis represents the detection positive rate; B represents the fluorescence amplification curve of the CPA reaction collected by the instrument when the amount of Bst DNA polymerase is 6U.

[0024] Figure 4 This is a graph showing the specificity detection results of the CPA primer and probe set.

[0025] Figure 5 The graph shows the results of qPCR and CPA detection of positive control DNA after 10-fold serial dilution. A represents the qPCR fluorescence amplification curve, with 3 technical replicates per group, and ND indicates no detection (cycle threshold Ct > 40). B represents the CPA detection results, with 5 technical replicates per group. The copy number concentration was calculated based on the standard curve plotted using homologous fragment recombinant plasmids. DNA con. represents the final concentration of positive control DNA in the reaction system.

[0026] Figure 6 The images show the results of conventional PCR and LAMP assays, respectively; where A represents the results of conventional PCR assays and B represents the results of LAMP assays.

[0027] Figure 7 The images show the detection results of Huanglongbing (HLB) in citrus from different leaf parts. The detection results at the bottom, from top to bottom, are the detection results of the left leaf mesophyll, main vein, and right leaf mesophyll of the infected leaf.

[0028] Figure 8 Images showing the results of Huanglongbing (HLB) testing in different parts of the phloem tissue of citrus.

[0029] Figure 9 Image showing the results of Huanglongbing (HLB) testing on the stem end of citrus fruit.

[0030] Figure 10 This image shows the results of citrus Huanglongbing (HLB) testing on the pith and fibrous tissue of the fruit peel.

[0031] Figure 11 The results show the field performance evaluation. Figure A shows the test results of 10 negative control samples collected from the nursery in Ganxian District, and Figure B shows the test results of 10 positive control samples collected from Guangdong.

[0032] Figure 12 This image shows the test results for some field samples from Jiangxi province.

[0033] Figure 13 This image shows the test results for some field samples from Jiangxi province. Detailed Implementation

[0034] This invention provides a CPA primer and probe set for detecting Huanglongbing fungus in citrus, including a primer set and a probe HLB-P; the primer set includes HLB-FB, HLB-AP, HLB-OP, HLB-IP, HLB-CPR and HLB-RB; The nucleotide sequences of HLB-FB, HLB-AP, HLB-OP, HLB-IP, HLB-CPR and HLB-RB are shown in SEQ ID NO:1 to SEQ ID NO:6, respectively; the nucleotide sequence of the probe HLB-P is shown in SEQ ID NO:7.

[0035] In this invention, the CPA primer-probe set is designed based on the conserved region sequence of the outer membrane protein of *Citrus citrus Huanglongbing* (HCFB), exhibiting high specificity. It can specifically recognize *Citrus citrus Huanglongbing*, but does not recognize common citrus pathogens such as *Bacillus anthracis*, *Colletotrichum gloeosporioides*, *Xanthomonas citrus*, *Bacillus proliferatingis*, and four viruses (Citrus citrus degeneration virus, Citrus yellowing vein virus, Citrus leaf mottle virus, and Citrus peel cracking virus). The CPA primer-probe set has high sensitivity, with a limit of detection of 8.3 copies / μL and a minimum detection concentration of 500 fg / μL, making its detection sensitivity ten times higher than qPCR.

[0036] In this invention, the 5' end of the probe HLB-P is preferably labeled with a fluorescent group, and the 3' end of the probe HLB-P is preferably labeled with a quenching group. The fluorescent group preferably includes FAM, and the quenching group preferably includes BHQ1. This invention does not impose any special limitations on the source of the CPA primer-probe set; in this embodiment, the CPA primer-probe set was synthesized by Sangon Biotech.

[0037] This invention provides a kit for detecting Huanglongbing (HLB) of citrus, including the CPA primer and probe set and CPA reaction buffer.

[0038] In this invention, the kit preferably further includes Bst DNA polymerase, dNTPs, betaine, and magnesium ions. The magnesium ions preferably include magnesium sulfate. The kit preferably also includes crude DNA extraction buffer. In an embodiment of this invention, the crude DNA extraction buffer is AMP1 nucleic acid lysis buffer, purchased from Agdia (catalog number 00117 / 0020).

[0039] In some embodiments of the present invention, the reaction system of the kit preferably contains the following concentrations of components, calculated in 500 μL: HLB-FB 0.2 μM, HLB-AP 2 μM, HLB-OP 2 μM, HLB-IP 1 μM, HLB-CPR 2 μM, HLB-RB 0.2 μM, probe HLB-P 0.3 μM, 1×CPA reaction buffer, Bst DNA polymerase 6 U, dNTPs 0.3 mM, magnesium ions 6 mM, and betaine 1 M.

[0040] The present invention provides an apparatus for detecting Huanglongbing (HLB) of citrus, including the aforementioned reagent kit and a fluorescence detection device.

[0041] In this invention, the apparatus preferably further includes a grinding device. The grinding device includes a grinding bag.

[0042] This invention provides a method for detecting Huanglongbing (HLB) of citrus based on a fluorescent base, comprising the following steps: Using the nucleic acid of the sample to be tested as a template, a CPA reaction is performed using the CPA primer and probe set, the kit, or the device to obtain the CPA reaction product; The fluorescence intensity of the CPA reaction product is measured, and the presence or absence of fluorescence intensity is used to determine whether the sample contains citrus Huanglongbing (HLB): when a fluorescence intensity signal is detected, it indicates that the sample is infected with HLB, otherwise it is not infected.

[0043] In this invention, nucleic acid from the sample to be tested is used as a template. The sample to be tested is preferably taken from different citrus plant tissues, including leaf mesophyll, leaf veins, phloem, fruit stalk, and peel. The nucleic acid preferably includes purified genomic DNA or crude leaf DNA. In some embodiments, the nucleic acid extraction method preferably includes the CTAB method or extraction with commercial crude DNA extract.

[0044] After extracting nucleic acid from the sample to be tested, a CPA reaction is performed using the CPA primer-probe set or the kit to obtain the CPA reaction product. In this invention, the preferred reaction system for the CPA reaction is 500 μL, containing the following components at the following concentrations: HLB-FB 0.2 μM, HLB-AP 2 μM, HLB-OP 2 μM, HLB-IP 1 μM, HLB-CPR 2 μM, HLB-RB 0.2 μM, probe HLB-P 0.3 μM, 1×CPA reaction buffer, Bst DNA polymerase 6 U, dNTPs 0.3 mM, magnesium ions 6 mM, and betaine 1 M. The CPA reaction procedure is: 63℃ for 15–30 min, for example, 63℃ for 20–30 min.

[0045] This invention optimizes the concentration of Bst DNA polymerase used in the reaction system by setting different dosages (2U, 6U, 10U) for parallel comparison. Finally, 6U was determined to be the optimal enzyme addition for this detection system, ensuring amplification efficiency and detection stability.

[0046] The fluorescence intensity of the CPA reaction product is measured, and the presence or absence of fluorescence intensity is used to determine whether the sample contains citrus Huanglongbing (HLB): when a fluorescence intensity signal is detected, it indicates that the sample is infected with HLB, otherwise it is not infected.

[0047] In this embodiment of the invention, genomic DNA is extracted using a commercial DNA crude extract method. The commercial DNA crude extract method includes adding a crude extract to the tissue sample to be tested and grinding it to obtain a nucleic acid extract. The nucleic acid extract is then added to a CPA reaction buffer containing betaine, MgSO4, and dNTPs for lysis to obtain genomic DNA. The preferred temperature for the lysis reaction is 92-99°C, more preferably 95-98°C. The preferred reaction time is 2-15 min, more preferably 3-12 min, and most preferably 5-10 min. The apparatus for the lysis reaction preferably includes a fluorescent base. The fluorescent base is purchased from Hangzhou Youstar Company. The nucleic acid crude extract is AMP1 crude extract, purchased from Agdia Company. The grinding apparatus preferably includes a grinding bag. The grinding bag is purchased from Wangnuo Company (model 30 filaments; size 4×7cm). In this embodiment of the invention, the crude extraction method involves taking four leaf midribs (each approximately 1 cm long), placing them in a grinding bag, adding approximately 250 μL of crude extract, and thoroughly grinding them with a grinding pestle. Then, approximately 5 μL of the crude extract is pipetted out as a template for subsequent reactions. After obtaining genomic DNA using the crude extraction method, the primer and probe set is added to a CPA reaction buffer containing the genomic DNA and placed on a fluorescent base for CPA reaction. After reacting at 63°C for 15-30 minutes, if the fluorescence intensity signal of the CPA reaction product is higher than the threshold (1000 fluorescence units), the fluorescent base shows a positive result, indicating that the sample is infected with *Citrus citrus Huanglongbing* (CPC). If the fluorescence intensity signal of the CPA reaction product is lower than the threshold, the fluorescent base shows a negative result, indicating that the sample is not infected with *Citrus citrus Huanglongbing*. If the fluorescent base shows an invalid result (no fluorescence) at the end of the reaction, it indicates a problem with the sample processing or the reagent, and the reaction needs to be repeated.

[0048] This invention constructs a novel rapid nucleic acid detection method (CPA) that integrates the advantages of cross-priming amplification technology and molecular beacon systems. By combining the high-efficiency amplification capability of CPA with the real-time detection characteristics of molecular beacons, a one-step rapid detection of target nucleic acid sequences is achieved. First, CPA-specific primers are designed for the omp outer membrane protein specific gene sequence, and a corresponding nucleic acid amplification detection system is constructed. After system construction, specificity experiments are conducted, using cross-amplification of nucleic acids from various closely related pathogens and common citrus pathogens to verify the target specificity of the primers and the entire system, eliminating interference from non-specific amplification. The sensitivity of the detection system is evaluated using serially diluted plasmid standards and known positive DNA samples to determine its limit of detection. A LAMP method validation experiment is conducted on the same omp target gene, using conventional PCR results as the evaluation criterion. The experiment confirms that LAMP has a significant false-positive problem, and the stability of existing isothermal detection protocols is insufficient. To verify the applicability of the method, genomic DNA extracted by the CTAB method and nucleic acids from rapidly crudely extracted grapefruit, tangerine, and navel orange are used as templates for methodological validation, examining its detection efficiency and stability. After the method was validated, the detection system was tested directly in the field to assess its field application value.

[0049] The method described in this invention is simple and rapid, with good specificity, high field matching rate, and versatility for various detection materials. The method consists of two steps: genomic DNA extraction and CPA reaction, with a total reaction time of 30 minutes (20 minutes for high pathogen content). In this embodiment, systematic field validation trials were conducted in major citrus-producing areas such as Jiangxi, Guangdong, Hunan, Fujian, and Yunnan. The results showed that the method achieved a 100% accuracy rate in detecting strongly positive samples with Ct values ​​below 30, with an overall matching rate of 94.24%. Control trials showed that the LAMP method had a high false positive rate and insufficient detection stability. Therefore, the method of this invention provides a reliable technical means for the diagnosis of different tissues of citrus Huanglongbing (HLB), and lays an important technical foundation for real-time monitoring and control strategies in the field, which is of significant practical importance for ensuring the healthy development of the citrus industry.

[0050] To further illustrate the present invention, the solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0051] Example 1 CPA primer and probe set design and reaction system establishment Through comprehensive retrieval and systematic analysis of citrus Huanglongbing pathogen (… CandidatusBased on relevant genomics literature on *Liberibacter asiaticus*, the outer membrane protein gene *omp* was screened as a specific detection target. A primer set for the CPA reaction was designed based on the conserved region sequence of this target gene.

[0052] 1. Probe sequence screening Using DNA from citrus Huanglongbing (HLB)-positive leaves verified by qPCR as a template, the sequences of three molecular beacon probes, Q1, Q2, and Q3, were optimized and screened. Figure 1 As shown, the three probes target the middle, lateral, and terminal regions of the omp gene, respectively. The design controlled the Tm value to be between 65 and 70°C, with no long homopolymers and no four consecutive identical bases. The probe sequences are as follows: Q1: FAM-cgcgcTGCCAGCAAATGATGTATCCGATgcgcg-BHQ1 (SEQ ID NO:7); Q2: FAM-cgcgcGCCATGATACGACGCTTAGCACGgcgcg-BHQ1 (SEQ ID NO:11) Q3: FAM-cgcgcACCAGCGCTCAGTTGTTTTACGCgcgcg-BHQ1 (SEQ ID NO:12) The positive test result indicates that ( Figure 2 The detection performance of molecular beacon probe Q1 (HLB-P) was completely in line with expectations, with a positive concordance rate of 100% (3 / 3), and it can be used for subsequent optimization experiments with different enzyme concentrations.

[0053] 2. Enzyme concentration optimization To establish a CPA detection system, the dosage of Bst DNA polymerase was optimized, with three concentration gradients of 2U, 6U, and 10U. Amplification and detection were performed using the constructed OMP recombinant plasmid as a template. Each group was run in 5-10 replicates. Results showed that when the template concentration was 2 copies / μL, the detection rate in both the 2U and 10U enzyme dosage groups was only 60%, while the detection rate in the 6U group reached 70%. At the optimal enzyme dosage of 6U, the detection rates of 4 copies / μL and 10 copies / μL template reached 90% and 100%, respectively. Figure 3 According to the internal fluorescence curve recording from the detector, the amplification curve of the 6U enzyme group at a concentration of 2 copies / μL consistently reached the plateau phase. Figure 3 (B). Based on the above results, 6U was ultimately selected as the optimal amount of Bst DNA polymerase to be added to the subsequent system.

[0054] After optimization of reaction conditions and verification of specificity, the optimal primer combination and its sequence information are detailed in Table 1. After system optimization and condition screening, the final components and corresponding concentration parameters of the CPA reaction system are detailed in Table 2.

[0055] Table 1 CPA-specific primer sequences

[0056] Table 2 Optimized CPA reaction system

[0057] Example 2 CPA primer and probe set specificity evaluation method Amplification-specific detection was performed on pathogens and leaf microorganisms that are prone to occur in citrus, including Bacillus anthracis (Bacillus). Bacillus anthracis Four viruses—Citrus citrus degeneration virus (CTV), Citrus yellowing and vein clearing virus (CYVCV), Citrus leaf spot virus (CLBV), and Citrus peel cracking virus (CEVd)—as well as Colletotrichum anthracnose (… Colletotrichum gloeosporioides ), Xanthomonas citrus ( Xanthomonas citri ) and proliferating phloem bacteria ( Liberibacter crescens ).

[0058] 1. Total DNA was extracted from citrus Huanglongbing fungus using the CTAB method. The specific steps are as follows: 1) Take one fresh, clean leaf from the top, middle, and bottom of the branch, chop the main vein, place it in a grinding tube, add 6 appropriately sized steel balls, immerse the grinding tube in liquid nitrogen for about 5 minutes, and then fix the grinding tube on a tissue grinding machine for rapid grinding. 2) Use a toothpick to pick up an appropriate amount of tissue powder into a 2.0 mL centrifuge tube containing 1 mL of CTAB solution (containing proteinase K), place it on a vortex mixer and shake vigorously, then insert it into the float plate and incubate in a 65°C water bath for 2 hours, shaking 2-3 times during the process. 3) Remove the centrifuge tubes and centrifuge at 12900 rpm for 1 min at room temperature; 4) Take 600 μL of the supernatant into a 1.5 mL centrifuge tube, add 600 μL of phenol:chloroform:isoamyl alcohol (25:24:1), place it in a vortex mixer and shake vigorously until it becomes emulsified, let it stand at room temperature for 3 min, centrifuge at 12900 r / min at room temperature for 5 min; 5) After centrifugation, take 300 μL of the supernatant into a 1.5 mL centrifuge tube, add an equal volume of isopropanol solution and 1 / 10 volume of sodium acetate, gently invert to mix, and let stand at -20℃ for 1 h. 6) Centrifuge at 4000 r / min at room temperature for 7 min; discard the supernatant, rinse twice with 75% alcohol, centrifuge at 4000 r / min and 7000 r / min for 2 min and 1 min respectively; 7) After the final washing, centrifuge at 7000 r / min for 30 s at room temperature, remove excess alcohol, dry in a 65℃ metal bath until transparent, add 50 μL of ddH2O to dissolve, centrifuge at low speed, and obtain the nucleic acid sample to be tested for subsequent experiments.

[0059] The extraction methods for Bacillus anthracis, Colletotrichum anthracis, Xanthomonas citrinum, Bacillus proliferativeis, and four viruses were the CTAB method.

[0060] 2. Specificity of the CPA primer-probe set The test tube A contains 500 μL of CPA reaction buffer containing betaine, MgSO4 and dNTPs. The final concentration of betaine is 1 M, the final concentration of MgSO4 is 6 mM and the final concentration of dNTPs is 0.3 mM.

[0061] The detection tube B contains a filter paper disc with vitrified powder, which consists of CPA primer-probe set and BST Enzyme. After mixing with tube A, the final concentrations of each component are as follows: HLB-FB 0.2μM, HLB-AP 2μM, HLB-OP 2μM, HLB-IP 1μM, HLB-CPR 2μM, HLB-RB 0.2μM, HLB-P 0.3μM, dNTP 0.3mM, and BST Enzyme 6U.

[0062] The components in tubes A and B were processed and packaged inside the tubes by Ustar Company.

[0063] Using a fluorescent base (purchased from Hangzhou Youstar Company, model PN0102) as the detection device, CPA primer and probe sets were used to perform CPA amplification on different pathogens to verify the specificity of the CPA primer and probe set. The CPA amplification method is as follows: A. Remove test tube A and test tube B and place them on a stable surface; B. Open the cap of test tube A and add 5 μL of the nucleic acid sample to be tested using a pipette; C. Insert the detection tube A into the pyrolysis hole (the tube wall of tube A has two vertical lines aligned with the hole), press and hold the power button for 5 seconds, and the pyrolysis indicator light will change from green to blue and flash, indicating that pyrolysis has started (pyrolysis temperature is 98℃, pyrolysis time is 10min). D. After pyrolysis, the blue light turns green and an alarm sound is emitted. Remove the detection tube A and allow it to cool to room temperature for 2 minutes. E. After cooling, transfer the liquid in test tube A to test tube B, and mix the liquid in tube A with the reagent in tube B. F. Insert the soft plastic part of detection tube B into the thermostatic port of the fluorescent base for isothermal amplification. Press and hold the power button for 5 seconds. The reaction indicator light will change from green to flashing blue, indicating that the reaction has started (the isothermal amplification temperature is 63℃). G. Wait 15-30 minutes (depending on the content of Huanglongbing bacteria in citrus; wait 15 minutes if the sample contains Huanglongbing bacteria, and 30 minutes for other pathogens), then a prompt sound will be heard and the indicator light will display the result.

[0064] The test results showed that when the sample was infected with *Citrus citrus Huanglongbing*, the test result was positive. *Bacillus anthracis* (… Bacillus anthracis Four viruses—Citrus citrus degeneration virus (CTV), Citrus yellowing and vein clearing virus (CYVCV), Citrus leaf spot virus (CLBV), and Citrus peel cracking virus (CEVd)—as well as Colletotrichum anthracnose (… Colletotrichum gloeosporioides ), Xanthomonas citrus ( Xanthomonas citri ) and proliferating phloem bacteria ( Liberibacter crescens The test result was negative. Figure 4 As can be seen, the CPA primer and probe set has the characteristic of high specificity for the detection of Huanglongbing pathogen in citrus.

[0065] Example 3 CPA primer and probe set sensitivity detection method A recombinant plasmid was constructed using the coding gene of the target outer membrane protein fragment, and this plasmid was used as a standard for detection sensitivity analysis.

[0066] 1. The recombinant plasmid was constructed using the pMD™19-T Vector Cloning Kit (Code No. 6013, Takara). The ligation system of the recombinant plasmid is shown in Table 3.

[0067] Table 3. Ligation system of recombinant plasmids

[0068]

[0069] 2. Sensitivity determination method for CPA primer-probe set detection of plasmid samples Recombinant plasmid samples containing the omp fragment were added to tube A as positive test samples for reaction, resulting in final concentrations of 20 copies / μL, 10 copies / μL, 4 copies / μL, and 2 copies / μL. CPA amplification was performed using a fluorescent base as the detection device, following the method described in Example 2.

[0070] Table 4 Results of plasmid amplification using CPA primer and probe sets

[0071] The plasmid CPA amplification results (Table 4) show that the detection rate was 100% when the plasmid concentration was 10 copies / μL.

[0072] Based on the laboratory-established method for quantitative detection of Huanglongbing pathogen-specific copy number (Xie L, Zeng X, Amir MB, et al. Clathrin heavy chain is involved in infection of Candidatus Liberibacter asiaticus in the host vector Diaphorina citri[J]. InsectScience, 2024, 31(4): 1326-1332.), the detection sensitivity of this system was systematically evaluated using real-time quantitative PCR technology. First, the DNA of positive samples was accurately quantified. Then, the positive DNA was serially diluted with water to determine the limit of detection of this method. Finally, the detection performance of qPCR and CPA methods was compared.

[0073] To compare the detection performance of qPCR and CPA methods, qPCR and CPA amplified the same target site for comparison. Therefore, the primers selected for qPCR were the stripping primers HLB-FB (SEQ ID NO:1) and HLB-RB (SEQ ID NO:6) from CPA, which were used as the upstream and downstream primers for this experiment. qPCR was performed using Hieff qPCR SYBR Green premix (Yisheng, 11201ES08). The reaction volume was 20 μL, containing 10 μL of premix, 250 nM primers, 1 μL of DNA template, and ddH2O. The following program was followed: 95℃ pre-denaturation for 5 min; then 40 cycles, each cycle consisting of 95℃ denaturation for 10 s, 60℃ annealing for 20 s, and 72℃ extension for 40 s, with fluorescence signal acquisition at 72℃.

[0074] The results showed that the qPCR method could still achieve 100% detection even when the concentration was reduced to 5 pg / μL. Figure 5 (A) In comparison, the CPA method achieves 100% detection at a concentration of 0.5 pg / μL, while the detection rate of qPCR at the same concentration is only 66.67%. Furthermore, CPA remains stable at concentrations as low as 50 fg / μL, with a success rate of 80%. Figure 5 (See section B). Based on the copy number of positive DNA, the limit of detection for the CPA method of this invention is 8.3 copies / μL, and its sensitivity is 10 times higher than that of qPCR. All the above results demonstrate that this technique has high sensitivity for the detection of Huanglongbing (HLB) of citrus.

[0075] Example 4 Total bacterial DNA was extracted from the samples using the CTAB method described in Example 2. Samples 1-24 were tested using conventional PCR and LAMP methods, with sample 23 serving as a positive control and sample 24 serving as a water control.

[0076] 1. Conventional PCR method Samples 1-24 were tested using the PCR detection method for citrus Huanglongbing fungus recommended by the national standard GB / T 28062-2011 "Real-time Fluorescent PCR Detection Method for Citrus Huanglongbing".

[0077] Standard PCR detection primers: HLB-OI1: GGCCGTATGCAATACGAGCGGCA (SEQ ID NO:9); HLB-OI2: GCGTCGCGACTTCGCAACCCAT (SEQ ID NO: 10); The standard PCR reaction system is shown in Table 5, and the reaction procedure is shown in Table 6.

[0078] Table 5. Conventional PCR Reaction System

[0079] Table 6. Standard PCR Detection Procedure

[0080] After the conventional PCR reaction is completed, the amplification products are detected by electrophoresis.

[0081] 2. LAMP method The primers and system are based on the LAMP amplification-specific primer set for detecting citrus Huanglongbing disclosed in patent CN102605092A, and are as follows: omp-FIP 5'-GCCATGATACGACCGCTTAGCATTGAGTGAGGGAGATCCAAT-3' (SEQ ID NO: 13); omp-BIP 5'-CTGAAGTCAATATTTCGCAATTGCCTTTACGCTCACCCTCAGA-3' (SEQ ID NO: 14); omp-F3 5'-ATTCGGCGTGAACTTGAA-3' (SEQ ID NO: 15); omp-B3 5'-GCTATACCTACAGAACCAGC-3' (SEQ ID NO: 16).

[0082] The above two methods were used to test 24 samples, and the results are as follows: Figure 6 As shown.

[0083] It can be seen that the positive rate of the classic PCR method is 50% (12 / 24=50%), while Lamp detected a total of 20 positive samples, with a positive rate of 83.3% (20 / 24=83.3%). In addition, the blank control showed a positive signal, indicating an excessively high false positive rate.

[0084] Based on the aforementioned experimental results, it is evident that the CPA primer and probe set of this invention only shows a positive reaction against *Huanglongbing* (citrus citrus greening pathogen), and no amplification signal against common citrus pathogens and viruses, demonstrating excellent detection specificity. Furthermore, the method of this invention has a lower detection limit and significantly better sensitivity than conventional qPCR technology. In contrast, the commonly used LAMP detection method suffers from significant false positive problems, making it difficult to guarantee detection reliability. Overall, this invention is significantly superior to existing LAMP detection technologies in terms of specificity, sensitivity, and result stability.

[0085] Example 5 A method for rapid crude nucleic acid extraction from the field using CPA primer and probe sets. 1. Perform routine PCR detection of citrus Huanglongbing (HLB) on citrus leaf samples No. 1-5. The specific method is as follows.

[0086] Total pathogen DNA was extracted from the samples using the CTAB method described in Example 2. Then, samples 1-5 were subjected to conventional PCR detection using the PCR method recommended by the national standard GB / T 28062-2011, "Real-time Fluorescent PCR Detection Method for Citrus Huanglongbing Fever." The detection primers, reaction system, and detection procedure were the same as in Example 4. After the conventional PCR reaction, the amplification products were detected by electrophoresis.

[0087] 2. CPA primer and probe set for rapid detection of crude leaf nucleic acid extract. Leaf samples from citrus trees No. 1-5 were rapidly extracted in the field. Four to six leaves were randomly selected from each sample, and the leaves were divided into left mesophyll, main vein, and right mesophyll for testing. DNA was extracted from the leaves of samples No. 1-5 using AMP1 crude extract (the crude extraction method was to add 250 μL of crude extract per milligram of sample, grind in a grinding bag to obtain nucleic acid extract). Then, CPA amplification and detection were performed using a fluorescent base as the detection device, following the method in Example 2.

[0088] Standard PCR test results ( Figure 7 The results showed that samples 1, 3, and 5 were positive, while samples 2 and 4 were negative. The CPA primer-probe combination results were consistent with those of conventional PCR. The CPA primer-probe combination results for samples 1, 3, and 5 are shown below. Figure 7 Furthermore, all tested samples showed positive reactions in both leaf mesophyll and leaf vein tissue, confirming that the citrus Huanglongbing pathogen exhibits a systematic distribution pattern in leaf tissue.

[0089] 3. Rapid detection of specific areas of citrus phloem Using the No. 1 positive citrus tree as experimental material, phloem tissues from different parts of the tree were collected for citrus Huanglongbing (HLB) testing. Figure 8 Rapid detection was performed using the CPA primer-probe set, following the same method as described above for detecting leaves.

[0090] The experimental results showed that the results of conventional PCR detection and rapid detection using CPA primer and probe sets were consistent. The detection results of phloem 1 were negative, while the detection results of phloem 2, 3 and 4 were positive, indicating that the distribution of citrus Huanglongbing fungus in the host tree exhibited significant spatial heterogeneity.

[0091] Citrus peel and stem tissue were collected for citrus Huanglongbing (HLB) detection. Rapid detection was performed using conventional PCR and CPA primer / probe sets. Figure 9 and Figure 10 The consistency indicates that the method of the present invention can detect different sample objects.

[0092] Example 6 1. Accuracy verification of the rapid on-site detection system for Huanglongbing in orchard samples During the field validation phase, CPA primer and probe sets and qPCR were used to test 10 confirmed navel orange seedlings that were free of Huanglongbing collected from the nursery in Ganxian District. At the same time, a batch of suspected positive samples (E1-E10) collected from Guangdong were also tested.

[0093] (1) The qPCR method was used to detect Huanglongbing pathogen in citrus. The specific method is as follows.

[0094] Total DNA of pathogens was extracted from the sample using the CTAB method described in Example 2, and then qPCR detection was performed using the method recommended by the national standard GB / T 28062-2011 "Real-time Fluorescent PCR Detection Method for Citrus Huanglongbing".

[0095] Details of qPCR detection primers and reaction systems are cited from national standards.

[0096] (2) Rapid detection of crude leaf nucleic acid using CPA primer and probe set. The method for rapid detection of crude leaf nucleic acid using the CPA primer and probe set is the same as in Example 5.

[0097] The results showed that all 10 navel orange seedling samples confirmed to be free of Huanglongbing were negative when tested using the CPA primer and probe set and qPCR method. Figure 11 (A). Meanwhile, after testing suspected positive samples collected from Guangdong, this CPA primer-probe set accurately determined all 10 samples to be positive. Figure 11 (B)

[0098] 2. Detection methods for Huanglongbing (HLB) in citrus from different major citrus producing areas To ensure the reliability and practical value of the detection technology, systematic field validation trials were conducted in major citrus-producing areas such as Jiangxi, Guangdong, Fujian, Yunnan, and Hunan, and double-blind comparisons were performed with the standard real-time quantitative PCR method. The rapid detection of crude leaf nucleic acids using qPCR and the CPA primer-probe set was performed in the same manner as described above.

[0099] A total of 191 samples were collected in this study. The results of rapid detection using qPCR and CPA primer and probe sets are shown in Table 7. Figure 12 , Figure 13 The results showed an overall concordance rate of 94.24% (180 / 191). Targeted analysis of samples from core citrus-producing areas in Jiangxi Province revealed a 95.80% concordance rate between the CPA primer-probe set and qPCR detection results (137 / 143). These empirical data fully demonstrate that the CPA primer-probe set rapid detection method not only possesses absolute detection capability for high-concentration infected samples but also accurately identifies samples with different levels of infection, exhibiting excellent sensitivity and reliability.

[0100] Table 7 Results of rapid detection using qPCR and CPA primer / probe sets

[0101] Note: The Ct values ​​for qPCR in the table are the average of three technical replicates. The test criteria are: a Ct value > 35 is considered negative; if one of the three technical replicates of sample E17 is < 35, the sample is considered positive.

[0102] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. Other embodiments can be obtained based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A CPA primer and probe set for detecting Huanglongbing fungus in citrus, characterized in that, Includes primer set and probe HLB-P; The primer set includes HLB-FB, HLB-AP, HLB-OP, HLB-IP, HLB-CPR, and HLB-RB; The nucleotide sequences of HLB-FB, HLB-AP, HLB-OP, HLB-IP, HLB-CPR and HLB-RB are shown in SEQ ID NO:1 to SEQ ID NO:6, respectively. The nucleotide sequence of the probe HLB-P is shown in SEQ ID NO:

7.

2. The CPA primer-probe set according to claim 1, characterized in that, The probe HLB-P has a fluorescent group labeled at its 5' end and a quenching group labeled at its 3' end.

3. The CPA primer-probe set according to claim 2, characterized in that, The fluorescent group includes FAM, and the quenching group includes BHQ1.

4. A kit for detecting Huanglongbing (HLB) of citrus, characterized in that, It includes the CPA primer and probe set, CPA reaction buffer, Bst DNA polymerase, dNTPs, betaine, and magnesium ions as described in any one of claims 1 to 3.

5. The reagent kit according to claim 4, characterized in that, The reaction system of the kit contains the following components at concentrations per 500 μL: HLB-FB 0.2 μM, HLB-AP 2 μM, HLB-OP 2 μM, HLB-IP 1 μM, HLB-CPR 2 μM, HLB-RB 0.2 μM, probe HLB-P 0.3 μM, 1×CPA reaction buffer, Bst DNA polymerase 6 U, dNTPs 0.3 mM, magnesium ions 6 mM, and betaine 1 M.

6. The reagent kit according to claim 4, characterized in that, It also includes crude DNA extract.

7. A device for detecting Huanglongbing (HLB) of citrus, characterized in that, The kit and fluorescence detection device are included according to any one of claims 4 to 6.

8. The apparatus according to claim 7, characterized in that, The device also includes a grinding device.

9. A method for detecting Huanglongbing (HLB) of citrus based on a fluorescence detection device, characterized in that, Includes the following steps: Using the nucleic acid of the sample to be tested as a template, a CPA reaction is performed using the CPA primer and probe set according to any one of claims 1 to 3, the kit according to any one of claims 4 to 6, or the device according to claim 7 or 8 to obtain the CPA reaction product; The fluorescence intensity of the CPA reaction product is measured, and the presence or absence of fluorescence intensity is used to determine whether the sample contains citrus Huanglongbing (HLB): when a fluorescence intensity signal is detected, it indicates that the sample is infected with HLB, otherwise it is not infected.

10. The method according to claim 9, characterized in that, The reaction procedure for the CPA reaction is as follows: maintain at 63°C for 15-30 minutes.

Images