Stzfp72 gene for improving cold tolerance of potato and application thereof in breeding of cold-tolerant potato
By screening and cloning the StZFP72 gene, overexpressing or silencing the gene, and expressing the gene in potato using Agrobacterium-mediated transformation technology, the problem of insufficient cold tolerance of potato to low-temperature stress was solved, its cold tolerance was significantly improved, and gene resources for new cold-resistant varieties were provided.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- CROP RES INST GUANGDONG ACAD OF AGRI SCI
- Filing Date
- 2026-05-21
- Publication Date
- 2026-07-17
Smart Images

Figure CN122404516A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering, and in particular to a StZFP72 gene that enhances the cold resistance of potatoes and its application in cold-resistant potato breeding. Background Technology
[0002] Through long-term natural selection and domestication, potatoes have developed a certain degree of adaptability to complex climatic conditions. However, as a cool-season tuber crop that is intolerant of severe frost, potato growth is highly susceptible to low-temperature stress, especially for cultivars originating from lowland areas, which have relatively limited cold tolerance. Low temperatures directly restrict the planting area, growing season length, and final yield of potatoes. Therefore, studying their cold tolerance mechanisms is of great significance for ensuring food security and sustainable agricultural development.
[0003] When potatoes are subjected to low-temperature stress, they experience multi-level damage from the cellular level to the entire plant. At the cellular level, low temperatures first disrupt cell membrane fluidity, leading to loss of semi-permeability and electrolyte leakage; simultaneously, reactive oxygen species accumulate within the cells, triggering oxidative stress and damaging proteins, lipids, and DNA. At the physiological level, the activity of photosynthetic enzymes is inhibited, chloroplast structure is damaged, resulting in impaired energy synthesis; the root system's ability to absorb water and nutrients also decreases significantly. Phenotypically, these damages manifest as wilting, wrinkling, purple discoloration, or necrosis of leaves, growth stagnation, and ultimately, a significant reduction in tuber yield and quality. The potato's response to low temperatures is a complex quantitative trait, regulated collaboratively by multiple genes and influenced by the planting environment, developmental stage, and the duration and intensity of low temperatures.
[0004] Research on improving the cold resistance of potatoes mainly focuses on germplasm resource exploration, physiological and biochemical mechanism analysis, and genetic improvement. Studies have revealed that cold resistance involves a series of protective mechanisms, such as inducing the synthesis of osmotic regulators (e.g., proline and betaine), enhancing antioxidant system activity, and expressing specific low-temperature response proteins. Currently, breeding new cold-resistant varieties through marker-assisted selection and genetic engineering has become an important direction. For example, transferring cryoregulatory protein genes or transcription factor genes into cultivated varieties has yielded lines with significantly enhanced growth capacity at low temperatures. This work provides practical and feasible technical pathways for expanding potato planting boundaries and coping with climate fluctuations. Summary of the Invention
[0005] In order to overcome the shortcomings and deficiencies of the existing technology, the purpose of this invention is to provide a StZFP72 gene that enhances the cold resistance of potatoes.
[0006] Another objective of this invention is to provide the application of the StZFP72 gene, which enhances the cold resistance of potatoes, in the breeding of cold-resistant potatoes.
[0007] The objective of this invention is achieved through the following technical solution:
[0008] A StZFP72 protein that enhances the cold resistance of potatoes is at least one of the following:
[0009] (a) A protein consisting of the amino acid sequence shown in SEQ ID NO.1;
[0010] (b) Analogs of the amino acid sequence shown in SEQ ID NO: 1 that still have the effect of improving the cold resistance of potatoes by substitution, insertion or deletion of one or more amino acids.
[0011] The StZFP72 protein mentioned above, which enhances the cold resistance of potatoes, can improve the cold resistance of potatoes.
[0012] The StZFP72 protein mentioned above, which enhances the cold resistance of potatoes, has a nucleotide sequence encoded by a gene obtained according to codon coding rules; preferably, the nucleotide sequence is shown in SEQ ID NO.2.
[0013] A StZFP72 gene for enhancing cold resistance in potatoes, having at least one of the following nucleotide sequences:
[0014] (a) The nucleotide sequence shown in SEQ ID NO.2;
[0015] (b) Analogs of the nucleotide sequences in (a) above, obtained by base insertion, deletion, or substitution, that still enhance the cold resistance of potatoes.
[0016] An expression vector carrying the StZFP72 gene that enhances cold resistance in potatoes, comprising the nucleotide sequence shown in SEQ ID NO.2.
[0017] The vector backbone of the expression vector carrying the StZFP72 gene that enhances potato cold resistance is pCAMBIA1300.
[0018] An Agrobacterium species that expresses the StZFP72 gene, which enhances the cold resistance of potatoes, in plants, including the aforementioned expression vector carrying the StZFP72 gene that enhances the cold resistance of potatoes.
[0019] The above-mentioned StZFP72 protein for enhancing potato cold resistance, the StZFP72 gene for enhancing potato cold resistance, the expression vector carrying the StZFP72 gene for enhancing potato cold resistance, and the application of Agrobacterium for expressing the StZFP72 gene for enhancing potato cold resistance in plants in enhancing potato cold resistance.
[0020] The above-mentioned StZFP72 protein for enhancing potato cold resistance, the StZFP72 gene for enhancing potato cold resistance, the expression vector carrying the StZFP72 gene for enhancing potato cold resistance, and the application of Agrobacterium for expressing the StZFP72 gene for enhancing potato cold resistance in plants in cold-resistant potato breeding.
[0021] The above-mentioned StZFP72 protein for enhancing potato cold resistance, the StZFP72 gene for enhancing potato cold resistance, the expression vector carrying the StZFP72 gene for enhancing potato cold resistance, and the application of Agrobacterium for expressing the StZFP72 gene for enhancing potato cold resistance in plants in the preparation of biological agents to enhance potato cold resistance.
[0022] A method for enhancing the cold resistance of potatoes includes the following steps:
[0023] Agrobacterium, which expresses the StZFP72 gene that enhances cold resistance in plants, was applied to potatoes to improve their cold resistance.
[0024] The application mentioned refers to the application to potato seedlings.
[0025] The potato in question is Yue Shu No. 1.
[0026] A biological agent for enhancing the cold resistance of potatoes, comprising Agrobacterium, which expresses the StZFP72 gene in plants that enhances the cold resistance of potatoes.
[0027] The Agrobacterium mentioned is Agrobacterium GV3101.
[0028] The present invention has the following advantages and effects compared with the prior art:
[0029] Based on transcriptome sequencing and expression analysis of low-temperature stress, this invention screened and cloned the StZFP72 gene. Overexpression of StZFP72 significantly improved potato's tolerance to low-temperature stress, while silencing the StZFP72 gene reduced it, indicating that the StZFP72 gene is involved in the regulation of potato's low-temperature stress tolerance. This research contributes to elucidating the molecular mechanism of potato's response to low-temperature stress and provides gene resources for the breeding of cold-resistant potato varieties.
[0030] Experiments have shown that under low-temperature stress, the degree of plant damage, from least to most severe, is as follows: StZFP72 overexpressing plants, control plants, and StZFP72 silenced plants, indicating that StZFP72 helps improve the low-temperature stress tolerance of potatoes. This invention is the first to verify the function of StZFP72 in regulating low-temperature stress tolerance, which plays an important role in the breeding of cold-resistant potato varieties.
[0031] Based on the results of low-temperature stress transcriptome sequencing analysis, this invention obtained a low-temperature-induced C2H2 ZincFinger transcription factor, StZFP72. The nucleotide sequence of this gene, as shown in SEQ ID NO.1, is 731 bp in length and encodes 164 amino acids, as shown in SEQ ID NO.2. Based on the StZFP72 gene sequence, this invention, through transgenic experiments, ultimately confirmed that this gene can improve the cold resistance of potatoes and can be used for the breeding of new cold-resistant potato varieties. Attached Figure Description
[0032] Figure 1 This study analyzed the expression of the StZFP72 gene in response to low temperature stress, hormone treatment, and tissue-specific conditions; (a) showed the expression analysis under low temperature stress; (b) showed the expression analysis under hormone treatment; and (c) showed the gene expression analysis in different tissues.
[0033] Figure 2 This represents the expression level of the StZFP72 gene in transgenic potato plants;
[0034] Figure 3 The cold resistance of plants overexpressing the StZFP72 gene, plants with gene silence, and control plants are shown from top to bottom: before low-temperature treatment, after low-temperature treatment, and after recovery to room temperature.
[0035] Figure 4 This shows the changes in electrical conductivity under low-temperature stress in plants overexpressing the StZFP72 gene, gene-silenced plants, and control plants.
[0036] Figure 5 This is a graph showing the analysis of reactive oxygen species (ROS) and malondialdehyde (MDA) in StZFP72 gene overexpressing plants, gene-silenced plants, and control plants. (a) DAB staining results for reactive oxygen species in leaves; (b) hydrogen peroxide content in leaves; (c) peroxidase (POD) activity in leaves; (d) superoxide dismutase (SOD) activity in leaves; and (e) malondialdehyde (MDA) content in leaves. Detailed Implementation
[0037] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.
[0038] Example 1: Cloning of the potato StZFP72 gene
[0039] 1.1 Pretreatment of potato leaves
[0040] Using Yueshu No. 1 potato as the experimental material, potato microtubers were planted in a light culture room. Four-week-old large potato plants were taken and subjected to low temperature stress (-1 ℃, 24 h). Mature leaves were then taken at different time points, quick-frozen in liquid nitrogen, and stored in a -80 ℃ freezer for later use.
[0041] 1.2 Extraction of cDNA
[0042] RNA extraction was performed using the TRIZOL method. Potato leaf samples were freeze-ground into powder, then rapidly added to 1 ml of Trizol and vigorously mixed for 5 seconds. The mixture was incubated at room temperature for 20 min, then chloroform (200 μL) (1 / 5 volume of Trizol) was added and vigorously mixed for 1 min to form an emulsion. The emulsion was incubated on ice for separation, and then centrifuged at 12000 g at 4°C for 15 min. The supernatant was transferred to a 1.5 ml centrifuge tube, and an equal volume of isopropanol (pre-cooled to -20°C) was added. The mixture was inverted and incubated at -20°C for at least 1 h, then centrifuged at 12000 g at 4°C for 25 min. The isopropanol was removed, and the precipitate was retained. Add 1 ml of 75% ethanol (pre-cooled at -20 ℃), vortex to mix, then centrifuge at 12000 g, 4 ℃ for 5 min, remove the supernatant, dry in a clean bench for 5-15 min, add an appropriate amount of DEPC-treated ultrapure water to dissolve the RNA, and detect by OD value 260 / 280=1.9-2.1 or electrophoresis.
[0043] Using 1 μg of potato leaf RNA as a template, cDNA was synthesized using the Xinkailai All-in-one First-Strand Synthesis MasterMix (with dsDNase) reverse transcription kit. The cDNA synthesis was performed according to the kit instructions, and the reaction system and PCR conditions were as specified in the kit's manual.
[0044] 1.3 Sequence Amplification
[0045] Using the potato cDNA obtained in section 1.2 as a template, the full-length cDNA sequence of StZFP72 was amplified. First, the cDNA sequence of this gene was downloaded from the Potato Genome website (http: / / spuddb.uga.edu / index.shtml), and primers were designed using Primer 5.0 with reference to the transcriptome sequencing sequence.
[0046] StZFP72-F: 5'-TTCTCTCATTCTTCCAAAGTTTCA-3'
[0047] StZFP72-R: 5'-TGGGTGATATATAGCTAAGATTCAA-3'
[0048] The full-length StZFP72 gene was obtained by PCR amplification using Takara PrimerSTAR Max DNA Polymerase.
[0049] The PCR reaction system consisted of: 25 μL PrimeSTAR Max Premix (2X), 1 μL each of forward and reverse primers, 1 μL cDNA template, and 22 μL sterile water. The PCR amplification program was: 94℃ for 5 min, 98℃ for 10 sec, 55℃ for 15 sec, 72℃ for 1 min, for a total of 35 cycles, followed by 72℃ for 5 min and 4℃ for 15 min, to obtain the potato StZFP72 gene. The nucleotide and protein sequences of the potato StZFP72 gene are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively.
[0050] Example 2: Application of the potato StZFP72 gene in regulating potato low-temperature stress tolerance
[0051] 2.1 Analysis of the expression pattern of the potato StZFP72 gene
[0052] Three-week-old YueShu No. 1 seedlings were subjected to low-temperature stress and hormone treatment. RNA was then extracted from leaves, reverse transcribed into cDNA, and diluted 5-fold as a template for expression analysis. Simultaneously, roots, tubers, stolons, stems, and leaves of three-week-old YueShu No. 1 seedlings were collected, and RNA was extracted into cDNA, diluted 5-fold, and used as a template for expression analysis. Primers were designed based on the StZFP72 gene nucleotide sequence using the NCBI-Primer blast website. The amplification primer sequence was StZFP72-F / R as described in the examples. qRT-PCR reactions were performed according to the instructions of the 2×SYBR Green qPCR Premix (Universal) kit. The potato EF1α gene was used as an internal control. Data analysis was performed using 2... -ΔΔ Ct method. The student's-test method was used for data significance analysis.
[0053] qRT-PCR primers for amplifying StEF1α:
[0054] StEF1α-qRT-F: 5'-GCCCATGGTTGTTGAGACCT-3';
[0055] StEF1α-qRT-R: 5'-TCTTGACAACACCGACAGCA-3'.
[0056] The results are as follows Figure 1 As shown, StZFP72 can be induced to express by low temperature stress ( Figure 1 a) Hormone response results showed that ABA and SA could induce StZFP72 expression, suggesting that StZFP72 may mediate the regulation of low-temperature stress by ABA or SA hormone signaling. Figure 1b). Further tissue-specific expression analysis showed that StZFP72 was expressed in all tissues, but the highest expression was observed in roots and stolons. Figure 1 c). The above results indicate that StZFP72 is an important factor in regulating the low-temperature stress tolerance of potatoes.
[0057] 2.2 Analysis of the cis-acting elements of the StZFP72 gene promoter
[0058] Based on the potato genome reference website, the promoter of the StZFP72 gene was cloned. Using the online analysis software PlantCARE, cis-acting element analysis was performed on the 2kb promoter sequence upstream of the start codon of the StZFP72 gene, mainly including hormone response elements, stress response elements, and light response elements. The results are shown in Table 1. The experimental results show that the activation of this gene is associated with multiple stresses and hormone responses, proving that this gene has the potential function of regulating plant stress.
[0059] Table 1. Analysis of cis-regulatory elements in the StZFP72 gene promoter.
[0060] Classification biological function Cis-acting element Hormone response abscisic acid ABRE Auxin ARR salicylic acid SARE Jasmonic acid TGACG-motif, CGTCA-motif Coercion-related Low temperature stress LTR / CRT / CBF2 drought stress DRE, MBS Photoresponse Photoresponse Box4, G-box, GT1-motif Transcription factor sites MYB MYB MYC MYC HB HD-zip
[0061] Example 3: Verification of the effect of regulating the potato StZFP72 gene on potatoes.
[0062] 3.1 Construction of overexpression vectors
[0063] Using the cloned StZFP72 cDNA as a template, the coding region was amplified using primers StZFP72-OE-F / R. The fragment and the pCAMBIA1300 overexpression vector were double-digested with BamHI and XbaI restriction endonucleases. Enzyme ligation was performed using DNA recombinase. The ligation product was added to DH5α competent cells, incubated on ice for 20 min, heat-shocked at 42℃ for 60 s, incubated on ice for 5 min, and then 700 μL of antibiotic-free LB liquid medium was added. The cells were incubated at 37℃ for 45 min using a shaker. 200 μL of the bacterial culture was evenly spread onto LB solid medium (LB + kana 50 mg / L) and incubated at 37℃ for 12 h. Single colonies were picked for PCR detection. Positive single-clone bacterial cultures were sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing identification. The correct pCAMBIA1300-StZFP72 overexpression vector and bacterial culture were obtained through comparison and preserved.
[0064] StZFP72-OE-F:
[0065] 5'- TGTACAAGGGTACCCGGGGATCCATGACAACCAAGAAAAGAAG -3';
[0066] StZFP72-OE-R:
[0067] 5'-CATGCCTGCAGGTCGATCTAGATTAAATAAATATTCGCAAGA-3'.
[0068] 3.2 Construction of gene silencing vector
[0069] Using the StZFP72 cDNA cloned in step (3) of Example 1 as a template, the following primers were used to clone the silent fragment.
[0070] Justice chain primer:
[0071] StZFP72-RNAi-SC-F (forward primer):
[0072] 5'-TTACAATTACCATGGGGCGCGCCTGGAAGAGGCTCCATCGC-3';
[0073] StZFP72-RNAi-SC-R (reverse primer):
[0074] 5'-CATGTTCATCTGGGGATTTAAATTGGGTGATATATAGCTAAGATT-3';
[0075] Antisense primer:
[0076] StZFP72-RNAi-AS-F (forward primer):
[0077] 5'-CGATCTCTTTGATGGGGATCCTGGGTGATATATAGCTAAGATT-3';
[0078] StZFP72-RNAi-AS-F (reverse primer):
[0079] 5'-AGCAGGACTCTAGGGACTAGTTGGAAGAGGCTCCATCGC-3'.
[0080] The positive strand clone product was double-digested with AscI and SwaiI, and then the RNAi vector PFGC1008 was double-digested with AscI and SwaiI to construct the positive strand into the PFGC1008 vector. Following the method in 3.1, homologous recombination ligation reaction and bacterial single-clone identification were performed to obtain the PFGC1008-StZFP72 (positive strand) vector.
[0081] The antisense strand cloning product was double-digested with BamHI and SpeI. Then, the PFGC1008-StZFP72 (positive strand) vector was double-digested with BamHI and SpeI. Following the method in 3.1, the antisense strand was constructed into the PFGC1008-StZFP72 (positive strand) vector through enzyme-linked reaction and single-clone identification in bacterial culture. This formed the PFGC1008-StZFP72 (positive strand-antisense strand) vector, which is the PFGC1008-StZFP72 gene silencing vector.
[0082] 3.3 Preparation of Agrobacterium
[0083] The pCAMBIA1300-StZFP72 overexpression vector constructed in 3.1 and the PFGC1008-StZFP72 gene silencing vector constructed in 3.2 were transformed into Agrobacterium GV3101, respectively. The specific steps are as follows:
[0084] 100 μL of Agrobacterium competent cells were thawed on ice, and 1 μL of pCAMBIA1300-StZFP72 plasmid was added and mixed. The mixture was then incubated on ice for 20 min, frozen in liquid nitrogen for 5 min, incubated in a 30°C water bath for 5 min, and then placed on ice for 5 min. 1 mL of antibiotic-free LB liquid medium was added and the mixture was incubated at 28°C and 175 rpm for 6 h. 200 μL of the bacterial culture was plated and placed in a biochemical incubator and incubated at 28°C for 2-3 days. Positive bacteria were screened by PCR, and after successful sequencing verification, Agrobacterium GV3101 containing the pCAMBIA1300-StZFP72 overexpression vector was obtained.
[0085] Following the steps described above, Agrobacterium GV3101 containing the PFGC1008-StZFP72 gene silencing vector was prepared.
[0086] 3.4 Transformation by Agrobacterium
[0087] Agrobacterium GV3101 containing the target gene plasmid was inoculated into LB medium (50 mg / L Kan) and activated twice. Single colonies were picked and cultured in LB liquid medium (20 ml, Rif 50 mg / L, Kan 50 mg / L) for 6 h at 28℃ and 240 rpm / min until OD600 = 0.5. After centrifugation at 5000 rpm for 6 min, the cultured cells were resuspended in 10 ml MS liquid medium (3% analytical sucrose) (OD600 = 1.5-2.0). Stem segments of robust tissue culture seedlings (Yueshu No. 1) grown for 3 weeks were taken and immersed in Agrobacterium inoculum for 15 min. The stem segments were removed and excess Agrobacterium was removed with sterilized filter paper. The infected stem segments were then spread out and transferred to co-culture medium and cultured in the dark at 26℃ for 2 days. Subsequently, they were transferred to bud differentiation medium containing 50 mg / ml hygromycin and 400 mg / L CEF until resistant buds grew to 0.5-1 cm. The buds were then cut off and transferred to MS medium + 50 mg / L Rooting medium containing hygromycin and 400 mg / L cephalosporin. When the transgenic seedlings reached a suitable size, they were potted, with 5 replicates per group.
[0088] Young leaves of transgenic potato plants were collected, and DNA was extracted as a template to amplify the overexpression vector GFP gene fragment and the gene silencing vector hygromycin (Hyg) gene fragment. Transgenic positive plants were obtained through screening. The amplification primers were:
[0089] GFP-F: 5'- GACCACATGAAGCAGCACGA-3';
[0090] GFP-R: 5'-CGCTTCTCGTTGGGGTCTTT-3';
[0091] Hyg-F: 5'-CGGTGTCGTCCATCACAGTT-3';
[0092] Hyg-R: 5'-TGACCTATTGCATCTCCCGC-3'.
[0093] After sequencing, three positive lines with the highest StZFP72 expression, namely OE-2, OE-25 and OE-40, were selected from the five positive lines. Three positive lines with the highest StZFP72 silencing efficiency, namely RNAi-27, RNAi-25 and RNAi-16, were selected from the seven positive lines for subsequent experiments.
[0094] 3.5 Determination of gene expression levels
[0095] Using cDNA from transgenic potato leaves as a template, qRT-PCR identification was performed according to the 2×SYBR Green qPCR Premix (Universal) (XKL0412, Kailai Enzyme, Guangzhou) kit. EF1α was used as an internal control gene (using primers StEF1α-qRT-F / R from section 2.1). Each sample was tested in triplicate. The reaction system and conditions followed the kit instructions. The primers used are as follows:
[0096] Primers for qRT-PCR amplification of StZFP72:
[0097] StZFP72-qRT-F: 5'-AAGCCCTTGGTGGACATCG-3';
[0098] StZFP72-qRT-R: 5'-GTCCGCCTAATGCTTGACCC-3';
[0099] qRT-PCR results are as follows Figure 2 As shown in the figure, compared with the control, the expression levels of transgenic lines OE-2, OE-25, and OE-40 were significantly upregulated, while the expression levels of RNAi-27, RNAi-25, and RNAi-16 were significantly downregulated, indicating that the overexpression and gene silencing system was successfully constructed.
[0100] 3.6 Low-temperature stress experiment on StZFP72 gene-edited plants
[0101] Low temperature stress treatment was applied to potato StZFP72 overexpressing plants (OE), silent plants (RNAi), and wild-type plants (WT). The specific steps are as follows:
[0102] Three-week-old transgenic and wild-type tissue culture seedlings were transplanted into a light-controlled culture room at 23°C under 16 hours of light / 8 hours of darkness for four weeks. Ten seedlings of uniform growth from each group were selected and subjected to low-temperature stress treatment (-2°C for 12 hours), followed by recovery at room temperature (23°C) for 12 hours. Phenotypic observation and photographic recording were conducted. The results are as follows: Figure 3 As shown.
[0103] The experimental results showed that, compared with the control, the overexpressing plants showed almost no frost damage and minimal leaf freezing after low-temperature stress. The control group showed less frost damage, with slight wilting of leaves, and although the leaves wilted after 12 hours of recovery, not all plants died. The silenced plants showed greater leaf freezing damage after 12 hours of low-temperature treatment, and after 12 hours of recovery, almost all aboveground parts died. This result indicates that the StZFP72 gene participates in the regulation of potato's low-temperature stress response and has a function in regulating potato's low-temperature stress tolerance.
[0104] 3.7 Determination of leaf electrical conductivity in StZFP72 gene-edited plants and wild-type plants
[0105] Low-temperature stress in plants can impair cell membrane integrity, leading to ion outflow from the cell. Therefore, we compared the changes in electrical conductivity of leaves from genetically modified plants treated with low-temperature stress (section 3.6) with those from wild-type plants under low-temperature stress conditions.
[0106] The results are as follows Figure 4 As shown in the figure, the relative electrical conductivity of leaves in silenced plants after low-temperature stress treatment was 89-91%, that in overexpressed plants was 22-35%, and that in the control plants was 68.2%. These results indicate that overexpressed plants suffered the least low-temperature damage, while silenced plants suffered the most. This means that overexpression of StZFP72 can improve the low-temperature stress tolerance of potatoes, while silencing StZFP72 reduces their low-temperature tolerance.
[0107] 3.8 Determination of changes in reactive oxygen species in leaves of StZFP72 gene-edited plants and wild-type potato plants
[0108] Low-temperature stress significantly promotes the generation of reactive oxygen species (ROS) in plant cells, leading to cell membrane damage and ultimately cell death. Furthermore, low-temperature stress promotes lipid peroxidation in cell membranes, resulting in the large-scale production of malondialdehyde (MDA), an important indicator of plant response to abiotic stress. Therefore, we analyzed the ROS content and ROS scavenging enzyme activity in the leaves of transgenic plants and wild-type potato plants treated with low-temperature stress in section 3.6.
[0109] Leaves from transgenic plants subjected to low-temperature stress and wild-type plants were flash-frozen in liquid nitrogen and ground into powder for later use. Hydrogen peroxide detection kit (Beijing Solarbio Science & Technology Co., Ltd., catalog number BC3590), POD and SOD enzyme activity detection kits (Beijing Solarbio Science & Technology Co., Ltd., catalog numbers BC0090 and BC0200), and MDA content detection kit (Beijing Solarbio Science & Technology Co., Ltd., catalog number BC0025) were used to determine the content. Results are as follows: Figure 5 As shown in the figure, compared with the wild-type control, the overexpressing plants had the lowest hydrogen peroxide and MDA content in their leaves, the lowest activity of reactive oxygen species scavenging enzymes POD and SOD, and the lightest reactive oxygen species staining. The gene-silenced plants had the highest hydrogen peroxide and MDA content in their leaves, the highest activity of reactive oxygen species scavenging enzymes, and the darkest reactive oxygen species staining. These results indicate that StZFP72 can improve the cold resistance of potatoes and can be used for the breeding of new cold-resistant potato varieties.
[0110] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.
Claims
1. A StZFP72 protein for enhancing the cold resistance of potatoes, characterized in that... It is at least one of the following: (a) A protein consisting of the amino acid sequence shown in SEQ ID NO.1; (b) Analogs of the amino acid sequence shown in SEQ ID NO: 1 that still have the effect of improving the cold resistance of potatoes by substitution, insertion or deletion of one or more amino acids.
2. The StZFP72 protein for enhancing potato cold resistance according to claim 1, characterized in that: The StZFP72 protein mentioned above, which enhances the cold resistance of potatoes, can improve the cold resistance of potatoes.
3. A StZFP72 gene for enhancing cold resistance in potatoes, characterized in that... The nucleotide sequence is at least one of the following: (a) The nucleotide sequence shown in SEQ ID NO.2; (b) Analogs of the nucleotide sequences in (a) above, obtained by base insertion, deletion, or substitution, that still enhance the cold resistance of potatoes.
4. An expression vector carrying the StZFP72 gene that enhances cold resistance in potatoes, characterized in that: Includes the nucleotide sequence shown in SEQ ID NO.
2.
5. An Agrobacterium species expressing the StZFP72 gene, which enhances cold resistance in potatoes, in plants, characterized by: Including the expression vector carrying the StZFP72 gene that enhances cold resistance of potatoes as described in claim 4.
6. The StZFP72 protein for enhancing potato cold resistance as described in claim 1 or 2, the StZFP72 gene for enhancing potato cold resistance as described in claim 3, the expression vector carrying the StZFP72 gene for enhancing potato cold resistance as described in claim 4, and the application of Agrobacterium for expressing the StZFP72 gene for enhancing potato cold resistance in plants as described in claim 5 in enhancing potato cold resistance.
7. The StZFP72 protein for enhancing potato cold resistance as described in claim 1 or 2, the StZFP72 gene for enhancing potato cold resistance as described in claim 3, the expression vector carrying the StZFP72 gene for enhancing potato cold resistance as described in claim 4, and the application of Agrobacterium for expressing the StZFP72 gene for enhancing potato cold resistance in plants as described in claim 5 in the breeding of cold-resistant potatoes.
8. The StZFP72 protein for enhancing potato cold resistance as described in claim 1 or 2, the StZFP72 gene for enhancing potato cold resistance as described in claim 3, the expression vector carrying the StZFP72 gene for enhancing potato cold resistance as described in claim 4, and the Agrobacterium for expressing the StZFP72 gene for enhancing potato cold resistance as described in claim 5, in the preparation of biological agents for enhancing potato cold resistance.
9. A method for enhancing the cold resistance of potatoes, characterized in that... Includes the following steps: Agrobacterium, which expresses the StZFP72 gene that enhances cold resistance in plants, was applied to potatoes to improve their cold resistance. The application refers to the application to potato seedlings; The potato in question is Yue Shu No.
1.
10. A biological agent for enhancing the cold resistance of potatoes, characterized in that: This includes Agrobacterium, which expresses the StZFP72 gene in plants to enhance potato cold resistance; The Agrobacterium mentioned is Agrobacterium GV3101.