Probe sets, reagents, kits and methods for detecting genetic mutations

The method of using probe sets for specific hybridization, extension and amplification solves the problem of incomplete gene mutation detection in existing technologies, realizes highly specific and low-cost detection of target genes of various sizes, and simplifies the operation process.

CN122445773APending Publication Date: 2026-07-24BEIJING BOE TECH DEV CO LTD +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-01-24
Publication Date
2026-07-24

AI Technical Summary

Technical Problem

Existing gene mutation detection technologies, such as quantitative real-time PCR and high-throughput sequencing, suffer from incomplete detection. Multiplex PCR technology is biased, and targeted capture sequencing technology is cumbersome and costly, making it difficult to flexibly apply to target genes of various sizes.

Method used

The method employs probe sets for specific hybridization, extension, and amplification. It utilizes a first specific sequence and a second specific sequence for dual probe hybridization, combined with a first universal sequencing sequence and a second universal sequencing sequence for amplification and enrichment, thereby achieving highly specific detection of the target region.

Benefits of technology

It has implemented a simple and easy-to-use gene mutation detection process, applicable to target genes of various sizes, with high specificity and low cost, and can effectively guide disease medication.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122445773A_ABST
    Figure CN122445773A_ABST
Patent Text Reader

Abstract

The present disclosure provides a probe set, reagent, kit and method for detecting gene mutation. Specifically, the detection method comprises: fragmenting sample sequences and denaturing; hybridizing the denatured sample sequences with at least one probe set; wherein the probe set comprises a first probe and a second probe; performing an extension reaction of the first probe on the hybridization product; connecting the extension product with the second probe to obtain a sequencing sequence for at least one target region; wherein the number of target regions corresponds to the number of probe sets; amplifying and enriching the sequencing sequence, and sequencing the enrichment product. Such technical solution not only has a simple and easy-to-operate process, but also can flexibly design the probe set, is suitable for target genes of various sizes, has high specificity and low cost.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This disclosure relates to the field of gene detection technology, and in particular to a probe set, reagent, kit and method for detecting gene mutations. Background Technology

[0002] Colorectal cancer is a common malignant tumor that seriously threatens human health. Targeted drugs refer to drugs or their formulations endowed with targeting capabilities. Their purpose is to enable the drug or its carrier to target specific lesion sites and accumulate or release the active ingredient at the target site, thus being used to treat colorectal cancer. Currently, there are mainly some targeted drugs that target specific gene mutations, such as EGFR inhibitors, but the specific drug selection needs to be determined based on the patient's genetic testing results. Summary of the Invention

[0003] In view of this, the purpose of this disclosure is to provide a probe set, reagents, kits and methods for detecting gene mutations.

[0004] To achieve the above objectives, this disclosure provides a method for detecting gene mutations, the method comprising:

[0005] Fragment the sample sequence and denature it;

[0006] The denatured sample sequence is hybridized with at least one set of probes; wherein the probe set includes a first probe (e.g., an upstream probe) and a second probe (e.g., a downstream probe);

[0007] The product of the hybridization reaction is used for the extension reaction of the first probe;

[0008] The extension product and the second probe are connected to obtain a sequencing sequence targeting at least one target region; wherein the number of target regions corresponds to the number of probe sets; here, the correspondence can be the same.

[0009] The sequencing sequences were amplified and enriched, and the enriched products were sequenced.

[0010] In some embodiments, the first probe includes a first universal sequencing primer, and the second probe includes a second universal sequencing primer; the amplification and enrichment of the sequencing sequence includes:

[0011] Amplification and enrichment are performed using universal primers; wherein the universal primers are at least complementary to either the first universal sequencing sequence or the second universal sequencing sequence.

[0012] In some embodiments, the extension reaction further includes, prior to: purifying the product of the hybridization reaction; and / or

[0013] The amplification and enrichment process includes purifying the sequencing sequence.

[0014] In some embodiments, the gene to be tested includes a gene for colorectal cancer medication.

[0015] Based on the same inventive concept, this disclosure also provides a probe set for detecting gene mutations, used to perform any of the aforementioned detection methods; wherein, the first probe includes a first universal sequencing sequence and a first specific sequence targeting a target region of the gene to be tested; wherein, the first specific sequence is adjacent to the 3' end of the first probe; and

[0016] The second probe includes a second universal sequencing sequence and a second specific sequence targeting the target region; wherein the second specific sequence and the 5' end of the second probe are adjacent and target the same single-stranded gene sequence as the first specific sequence.

[0017] It should be noted that each gene to be tested can have at least one target region, as shown in Table 2 below; optionally, the sequence set of each target region includes at least 70% of the sequence of the gene to be tested, such as >70%, >80%, >90%, or >95%.

[0018] In some embodiments, the first probe further includes a first tag sequence; the first tag sequence is located between the first universal sequencing sequence and the first specific sequence; and / or

[0019] The second probe also includes a second tag sequence; the second tag sequence is located between the second universal sequencing sequence and the second specific sequence.

[0020] In some embodiments, the first tag sequence and the second tag sequence each independently comprise 2 to 12 random bases.

[0021] In some embodiments, the 5' end of the first probe is labeled with biotin; and / or

[0022] The last base at the 3' end of the second probe is modified with dideoxycytosine nucleoside; and / or

[0023] The 5' end of the second probe is modified with a phosphate group.

[0024] In some embodiments, at least one of the first specific sequence and the second specific sequence has a length of 20 to 35 nucleotides.

[0025] In some embodiments, at least one of the first universal sequencing sequence and the second universal sequencing sequence has a length of 25 to 40 nucleotides.

[0026] In some embodiments, the sequence length of the target region corresponding to the first specific sequence and the second specific sequence is 140 to 300 nucleotides.

[0027] In some embodiments, the first specific sequence includes a sequence having at least 70% identity with any of the sequences in SEQ ID No. 1 to SEQ ID No. 720 that are ordered in odd numbers; here, ordered in odd numbers means that the number after "NO." is odd, such as 1, 3, etc.; the second specific sequence includes a sequence having at least 70% identity with any of the sequences in SEQ ID No. 1 to SEQ ID No. 720 that are ordered in even numbers; here, ordered in even numbers means that the number after "NO." is even, such as 2, 4, 6, etc.

[0028] Based on the same inventive concept, embodiments of this disclosure also provide a reagent for detecting gene mutations, the reagent comprising any of the probe sets described above.

[0029] Based on the same inventive concept, embodiments of this disclosure also provide a kit for detecting gene mutations, the kit comprising any of the reagents described above.

[0030] As described above, the probe set, reagents, kit, and method for detecting gene mutations provided in this disclosure employ a process of specific hybridization, extension, ligation, and final amplification to detect gene mutations. The first and second specific sequences in the probe set can undergo dual-probe hybridization to obtain highly specific target region sequences. The first and second universal sequencing sequences are used to amplify and enrich the target region sequence, and the amplified and enriched products can be used for gene sequencing, thereby enabling the detection of target gene mutations. This technical solution is not only simple and easy to operate, but also allows for flexible probe set design, is applicable to target genes of various sizes, and offers high specificity and low cost. Attached Figure Description

[0031] To more clearly illustrate the technical solutions in this disclosure or related technologies, the accompanying drawings used in the description of the embodiments or related technologies will be briefly introduced below. Obviously, the accompanying drawings described below are only embodiments of this disclosure. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0032] Figure 1 This diagram illustrates the structure of a probe array according to an embodiment of the present disclosure.

[0033] Figure 2 This diagram illustrates the structure of yet another probe assembly provided in an embodiment of the present disclosure.

[0034] Figure 3 This diagram illustrates a process for detecting gene mutations according to an embodiment of the present disclosure.

[0035] Figure 4 A schematic diagram of another probe assembly provided in this disclosure is shown. Detailed Implementation

[0036] To make the objectives, technical solutions, and advantages of this disclosure clearer, the following detailed description is provided in conjunction with specific embodiments and the accompanying drawings.

[0037] It should be noted that, unless otherwise defined, the technical or scientific terms used in the embodiments of this disclosure should have the ordinary meaning understood by one of ordinary skill in the art to which this disclosure pertains. The terms "first," "second," and similar terms used in the embodiments of this disclosure do not indicate any order, quantity, or importance, but are merely used to distinguish different components. The terms "comprising / including" and "having" are inclusive or open-ended and do not exclude additional, unlisted elements or method steps. It is contemplated that any implementation discussed in this specification can be implemented with reference to any method or combination of the contents of this disclosure, and vice versa. Furthermore, combinations of the contents of this disclosure can be used to implement the methods of this disclosure.

[0038] To facilitate understanding of the technical solutions disclosed herein, some technical terms involved in this disclosure will be introduced below.

[0039] The term "genome" refers to the sum of all genetic material in an organism. When used for eukaryotic cells, the genome encompasses not only chromosomal DNA located in the cell nucleus but also organelle DNA found in subcellular components of the cell, such as mitochondria and plastids. The terms "polynucleotide," "nucleic acid sequence," "nucleotide sequence," or "nucleic acid fragment" are used interchangeably and are single-stranded or double-stranded RNA or DNA polymers, optionally containing synthetic, non-natural, or modified nucleotide bases (nt). Nucleotides are designated by their single-letter names as follows: "A" for adenosine or deoxyadenosine (corresponding to RNA or DNA, respectively), "C" for cytidine or deoxycytidine, "G" for guanosine or deoxyguanosine, "U" for uridine, "T" for deoxythymidine, "R" for purine (A or G), "Y" for pyrimidine (C or T), "K" for G or T, "H" for A, C, or T, "I" for inosine, and "N" for any nucleotide.

[0040] The term "amplification" refers to carrying out an amplification reaction. "Reaction solution" refers to a solution containing all the reactants required to carry out the reaction, which may include, but is not limited to, buffers, salts, cofactors, scavengers, etc., to maintain the pH at a selected level during the reaction.

[0041] The term "fragment" refers to a portion of a larger polynucleotide molecule. For example, polynucleotides can be broken down or fragmented into multiple fragments by natural processes, such as cDNA fragments that are naturally present in biological samples, or by in vitro manipulation. Various methods for breaking nucleic acids are well known in the art. These methods can be, for example, chemical, physical, or enzymatic. Enzymatic cleavage can include partial degradation with deoxyribonucleases; partial depurination with acids; the use of restriction enzymes: intron-encoded endonucleases; DNA-based cleavage methods, such as triplet and hybridization methods, which rely on specific hybridization of nucleic acid fragments to position the cleavage reagent at a specific location within the nucleic acid molecule; or other enzymes or compounds that cleave polynucleotides at known or unknown locations. Physical cleavage methods can include subjecting polynucleotides to high shear rates. High shear rates can be generated, for example, by moving DNA through chambers or channels with pits or spikes, or by forcing DNA samples through flow channels of limited size, such as pores with cross-sectional dimensions in the micrometer or submicrometer range. Other physical methods include sonication and nebulization. Combinations of physical and chemical fragmentation methods can also be used, such as fragmentation by heating and ion-mediated hydrolysis. See, for example, Sambrook et al., “Molecular Cloning: A Laboratory Manual,” 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (2001) (“Sambrook et al.”), which is incorporated herein by reference for all purposes. These methods can be optimized to digest nucleic acids into fragments of a selected size range.

[0042] The term "PCR" refers to Polymerase Chain Reaction (PCR), a reaction that amplifies a specific DNA sequence in vitro by simultaneously extending the complementary strand of DNA with primers. In other words, PCR is a reaction used to produce multiple copies or replicates of a target nucleic acid flanked by primer binding sites. This reaction involves repeating the following steps one or more times: (i) denaturing the target nucleic acid, (ii) annealing the primers to their binding sites, and (iii) extending the primers with a nucleic acid polymerase in the presence of nucleoside triphosphates. Typically, in a thermal cycler, the reaction is cycled at different temperatures optimized for each step. The specific temperature, the duration of each step, and the rate of change between steps depend on many factors well known to those skilled in the art. For example, in conventional PCR using Taq DNA polymerase, the double-stranded target nucleic acid can be denatured at temperatures >90°C, the primers annealed at temperatures ranging from 50°C to 75°C, and the primers extended at temperatures ranging from 72°C to 78°C. The term "PCR" includes derivative forms of the reaction, including but not limited to RT-PCR, real-time PCR, nested PCR, quantitative PCR, multiplex PCR, etc. Those skilled in the art can identify the specific form of PCR used from the context of the application. Reaction volumes can range from hundreds of nanoliters, such as 200 nL, to hundreds of μL, such as 200 pT.

[0043] The term "amplification primer" refers to a primer used for amplification. A "primer" is a natural or synthetic oligonucleotide that, when forming a double helix with a polynucleotide template, can act as an initiation site for nucleic acid synthesis and extend from its 3' end along the template to form an extended double helix. Primer extension is typically performed using a nucleic acid polymerase, such as a DNA or RNA polymerase. The sequence of nucleotides added during extension is determined by the sequence of the template polynucleotide. Typically, primers are extended by DNA polymerase. Primer lengths are typically in the range of 14 to 40 nucleotides, or 18 to 36 nucleotides. Primers are used in a variety of nucleic acid amplification reactions, such as linear amplification reactions using a single primer, or polymerase chain reactions using two or more primers. Guidelines for selecting primer length and sequence for a specific application are well known to those skilled in the art.

[0044] For the detection of drug-measuring genes in colorectal cancer, the common techniques are quantitative real-time PCR and high-throughput sequencing. Quantitative real-time PCR can only detect single or a few sites, resulting in incomplete detection. High-throughput sequencing commonly uses multiplex PCR and targeted capture sequencing. Multiplex PCR inevitably suffers from amplification bias; when detecting multiple targets, this bias leads to incomplete coverage of some target sites. Furthermore, single nucleotide polymorphisms (SNPs) can affect primer binding efficiency, resulting in missed detections of target gene sites. Targeted capture sequencing requires whole-genome library preparation followed by hybridization, a cumbersome and complex process. It also has a high rate of non-specific hybridization in complex regions, leading to higher costs. It is more suitable for large-scale target gene detection, and its cost is very high even for target genes smaller than 200 kb.

[0045] In view of this, embodiments of this disclosure provide a probe set, reagents, kits, and methods for detecting gene mutations. The first and second specific sequences in the probe set can perform dual-probe hybridization to obtain highly specific target region sequences. The first and second universal sequencing sequences are used to amplify and enrich the target region sequences, and the amplified and enriched products can be used for gene sequencing, thereby enabling the detection of target gene mutations. This technical solution is not only simple and easy to operate, but also allows for flexible probe set design, is applicable to target genes of various sizes, and offers high specificity and low cost.

[0046] In a first aspect, embodiments of this disclosure provide a probe set. Figure 1 This diagram illustrates the structure of a probe array according to an embodiment of the present disclosure. Figure 2 This diagram illustrates the structure of yet another probe assembly provided in an embodiment of the present disclosure. Figure 1 and Figure 2As shown, the probe set includes: an upstream probe comprising a first universal sequencing sequence 101 and a first specific sequence 102 targeting a target region of the gene to be tested; wherein the first specific sequence 102 is adjacent to the 3' end of the upstream probe; and a downstream probe comprising a second universal sequencing sequence 201 and a second specific sequence 202 targeting the target region; wherein the second specific sequence 202 is adjacent to the 5' end of the downstream probe. It should be noted that the first specific sequence 102 and the second specific sequence 202 can target the same single-stranded DNA. Considering that DNA polymerase extends the DNA strand from the 3' end, the first specific sequence 102 at the 3' end can continue to extend after complementary pairing with the single-stranded DNA, while the second specific sequence 202 at the 5' end cannot continue to extend after complementary pairing with the single-stranded DNA. Thus, the upstream probe achieves linear amplification, ensuring unbiased amplification. If the second specific sequence 202 and the target region are perfectly complementary, the extended product of the upstream probe can be successfully linked to the second specific sequence 202. If the second specific sequence 202 and the target region are not perfectly complementary, the extended product of the upstream probe cannot be linked to the second specific sequence 202, thereby further ensuring the specificity of the dual probe hybridization.

[0047] In some embodiments, such as Figure 2 As shown, the upstream probe further includes a first tag sequence 103; the first tag sequence 103 is located between the first universal sequencing sequence 101 and the first specific sequence 102. The downstream probe further includes a second tag sequence 203; the second tag sequence 203 is located between the second universal sequencing sequence 201 and the second specific sequence 202. Here, the first tag sequence 103 and the second tag sequence 203 can coexist, for example, the upstream probe may contain the first tag sequence 103 while the downstream probe may include the second tag sequence 203; they can also coexist separately, for example, the upstream probe may contain the first tag sequence 103 while the downstream probe may not contain the second tag sequence 203; or, for example, the upstream probe may not contain the first tag sequence 103 while the downstream probe may include the second tag sequence 203.

[0048] It should be understood that the sequences of the first tag sequence 103 and the second tag sequence 203 are not fixed sequences, but random sequences. For example, the base arrangement of the first tag sequence 103 can be completely different for two upstream probe molecules; similarly, the base arrangement of the second tag sequence 203 can be completely different for two downstream probe molecules. Therefore, the first tag sequence 103 and the second tag sequence 203 can serve as molecular tags to identify each original DNA strand, thereby effectively eliminating false positives caused by PCR amplification errors, especially in the detection of ultra-low frequency mutations (e.g., ≤0.1%).

[0049] In some embodiments, the first tag sequence 103 and the second tag sequence 203 each independently include 2 to 12 random bases. It should be noted that the random bases can be selected from any of A, T, C, and G, and this disclosure does not limit this selection.

[0050] For example, the first tag sequence 103 and the second tag sequence 203 may have different numbers of bases. For instance, the first tag sequence 103 may have 3 bases and the second tag sequence 203 may have 6 bases; or the first tag sequence 103 may have 4 bases and the second tag sequence 203 may have 4 bases. For example, the types of bases in the first tag sequence 103 and the second tag sequence 203 may be the same or different. For instance, the bases in the first tag sequence 103 and the second tag sequence 203 may each be independently selected from A, T, C, and G; or the bases in the first tag sequence 103 may be selected from A, T, and G, and the bases in the second tag sequence 203 may be selected from A, T, C, and G.

[0051] In some embodiments, the 5' end of the upstream probe is labeled with biotin. Streptavidin magnetic beads can bind to biotin to capture the hybridization product, thereby achieving purification of the hybridization product.

[0052] In some embodiments, the last base at the 3' end of the downstream probe is modified with dideoxycytidine (ddC). ddC modification not only prevents probe self-ligation but also helps avoid subsequent extension reactions, thereby reducing the number of invalid sequences in subsequent sequencing.

[0053] In some embodiments, the 5' end of the downstream probe is modified with a phosphate group (P). The phosphate group can react with the elongation product of the upstream probe to form a phosphate diester, thereby achieving the connection between the elongation product and the downstream probe.

[0054] In some embodiments, at least one of the first specific sequence 102 and the second specific sequence 202 has a length of 20 to 35 nucleotides, such as 20 nucleotides, 22 nucleotides, 25 nucleotides, 27 nucleotides, 33 nucleotides, 35 nucleotides, etc.

[0055] In some embodiments, at least one of the first universal sequencing sequence 101 and the second universal sequencing sequence 201 has a length of 25 to 40 nucleotides, such as 25 nucleotides, 30 nucleotides, 32 nucleotides, 35 nucleotides, 37 nucleotides, 40 nucleotides, etc.

[0056] In some embodiments, the target region corresponding to the first specific sequence and the second specific sequence 202 has a sequence length of 140–300 nucleotides, such as 141 nucleotides, 190 nucleotides, 210 nucleotides, 249 nucleotides, 299 nucleotides, etc. The sequence length of the target region is greater than the total length of the first specific sequence 102 and the second specific sequence 202; for example, the difference between the sequence length of the target region and the total length of the first specific sequence 102 and the second specific sequence 202 is not less than 50 nucleotides. This design is suitable for the detection of multiple unknown base mutations, increasing detection accuracy. Furthermore, a target region sequence length of 140–300 nucleotides is beneficial because the total sequence length of the extension product and the amplification product is greater than 200 base pairs, which facilitates separation and purification, such as magnetic bead purification.

[0057] It should be understood that different probe sets can be designed for different genes to be tested. For the same gene to be tested, multiple probe sets can be designed for different target regions. For example, the same gene to be tested can be divided into multiple different target regions, and probe sets can be designed for each region.

[0058] Secondly, embodiments of this disclosure also provide a reagent for detecting gene mutations. In some embodiments, the reagent includes at least one set of probes as described above.

[0059] Thirdly, embodiments of this disclosure also provide a kit for detecting gene mutations. In some embodiments, the kit includes the aforementioned reagents. Optionally, the kit may further include TE buffer (prepared from Tris and EDTA), single-chain binding proteins, enzyme-free water, glycerol, PEG4000, etc., and this disclosure does not limit the scope of the kit.

[0060] Fourthly, this disclosure also provides a method for detecting gene mutations. Figure 3 This diagram illustrates a flowchart of a gene mutation detection process provided by an embodiment of this disclosure. Figure 3 As shown, the method includes:

[0061] First, the sample sequence is fragmented and denatured; here, the sample can be patient blood, tissue biopsy, pleural fluid, peritoneal fluid, etc. This disclosure does not limit this. It should be noted that fragmentation refers to breaking down or breaking the sample's DNA into multiple fragments. The methods for achieving this breakdown or fragmentation are as described above, such as chemical, physical, or enzymatic methods, and this disclosure does not limit this. Denaturation refers to the breaking of hydrogen bonds in the DNA double helix structure under certain conditions, thereby converting the double strand into a single strand.

[0062] Next, the denatured sample sequence is hybridized with at least one of the aforementioned probe sets; here, the first specific sequence 102 of the upstream probe of each probe set can pair with the complementary base of the target region, and the second specific sequence 202 of the downstream probe can pair with the complementary base of the target region.

[0063] It should be noted that a set of probes can correspond to a target region, and the same gene to be detected can include multiple target regions. By hybridizing the deformed sample sequence with multiple sets of probes, multiple genes to be detected can be detected simultaneously.

[0064] Then, the product of the hybridization reaction is used for an extension reaction; here, the 3' end of the first specific sequence 102 undergoes an extension reaction;

[0065] Next, the extension product and the second specific sequence 202 are joined to form a sequencing sequence including the target region; here, the 3' end of the extension product and the 5' end of the second specific sequence 202 are joined to obtain a sequencing sequence including the complete target region.

[0066] The technique of using upstream primer extension and downstream primer ligation not only achieves linear amplification to obtain the target region sequence and ensures unbiased amplification, but also effectively guarantees the specificity of dual-probe hybridization.

[0067] Finally, the enriched sequencing sequences are amplified and sequenced. By enriching and sequencing these sequences, mutations in the target genes can be effectively detected, thus providing more effective guidance for disease treatment.

[0068] Therefore, the gene mutation detection method of this disclosure is simple and easy to operate, shortening the experimental operation time to about 6 hours; in addition, the probe design is flexible and applicable to target gene regions of various sizes, with low cost and high specificity.

[0069] In some embodiments, the amplified enriched sequencing sequence includes:

[0070] Amplification and enrichment are performed using universal primers; wherein the universal primers are at least complementary to either the first universal sequencing sequence 101 or the second universal sequencing sequence 201. Here, different universal primers can be designed for different first universal sequencing sequences 101 and second universal sequencing sequences 201, and this disclosure does not limit this.

[0071] In some embodiments, prior to the extension reaction, the product of the hybridization reaction is purified, for example, by using streptavidin magnetic beads and biotin conjugate. In some embodiments, prior to amplification and enrichment, the sequencing sequence is purified, for example, by using novizan purification magnetic beads.

[0072] In some embodiments, the gene to be tested includes colorectal cancer drug genes, such as AKT1, BRAF, CTNNB1, EGFR, ERBB2, FBXW7, GNAS, KRAS, MAP2K1, NRAS, PIK3CA, SMAD4, TP53, APC, etc., which are not limited in this disclosure.

[0073] To make the technical solution of this disclosure clearer and easier to understand, a method for detecting gene mutations provided by the embodiments of this disclosure will be described in detail below with reference to the accompanying drawings and specific embodiments. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions.

[0074] Example 1

[0075] 1. Preparation of Standards: 800g of pan-tumor DNA (catalog number: GW-OGTM800), experimentally designated as Standard 1; the mutations and their corresponding frequencies contained in the pan-tumor 800g DNA standard are as follows: EGFR L858R mutation frequency 1%, KRAS A146T mutation frequency 1%, EGFR T790M mutation frequency 2%, BRAF V600E mutation frequency 7%, and NRAS Q61K mutation frequency 1%. 10ng of the pan-tumor 800g DNA standard was mixed with 90ng of wild-type gDNA to form Standard 2.

[0076] 2. Target genes: including AKT1, BRAF, CTNNB1, EGFR, ERBB2, FBXW7, GNAS, KRAS, MAP2K1, NRAS, PIK3CA, SMAD4, TP53, and APC. Gene information is shown in Table 1.

[0077] Table 1

[0078]

[0079]

[0080] 3. Probe set design: Primer design targeting gene exon regions (e.g., using Primer3 primer design software). For example, Figure 1As shown, the upstream probe includes a first universal sequencing sequence 101 and a target region complementary sequence (corresponding to a first specific sequence 102), and the downstream probe includes a second universal sequencing sequence 201 and a target region complementary sequence (a second specific sequence 202), thereby forming a target region probe set. Exemplarily, the first specific sequence 102 and the second specific sequence 202 are shown in Table 2:

[0081] Table 2

[0082]

[0083]

[0084]

[0085]

[0086]

[0087]

[0088]

[0089]

[0090]

[0091]

[0092]

[0093]

[0094]

[0095]

[0096]

[0097]

[0098]

[0099]

[0100]

[0101]

[0102]

[0103]

[0104]

[0105]

[0106] like Figure 1 As shown, the first universal sequencing sequence 101 (5'-3') can be ACACTCTTTCCCTACACGACGCTCTTCCGATCT—SEQ ID NO:721; the second universal sequencing sequence 201 (5'-3') can be AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC—SEQ ID NO:722.

[0107] Continue to refer to Figure 1 The upstream probes are all modified with biotin at the 5' end for subsequent streptavidin magnetic bead capture of hybridization products. The downstream probes are phosphorylated at the 5' end to form phosphodiester bonds with the extension reaction products, and the last base at the 3' end is modified with dideoxycytosine nucleoside to prevent probe self-ligation and subsequent extension reactions.

[0108] All synthesized probes were diluted to 1 μM and then mixed in a 1:1 ratio to form a probe panel.

[0109] 4.Reference Figure 3 The flowchart is as follows: Genome fragmentation: Add 100 ng of standard 1 and 100 ng of standard 2 to 0.6 mL PCR tubes respectively, add TE buffer to 50 μL, mix thoroughly and centrifuge, fragment the sample using a Bioruptor sonicator, 20 cycles, with the sonicator turned on for 30 s and off for 30 s in each cycle.

[0110] 5. Hybridization reaction: Prepare the hybridization solution according to the following system, labeled Hyb-1, and mix thoroughly after preparation.

[0111]

[0112] Place the fragmented standards from step 4 into 1.5 mL centrifuge tubes, mix thoroughly, and centrifuge. Label them H1 and H2, respectively. Then, thaw the probe pair panel and blocker solution, mix them by inversion, and prepare the following reagent systems in sterile PCR tubes:

[0113]

[0114] Mix thoroughly and centrifuge briefly. Place this sterile PCR tube in a vacuum concentrator and concentrate to a dry powder. Then, prepare the following reagent system in this centrifuge tube:

[0115]

[0116] Gently pipette the mixture to mix thoroughly and briefly centrifuge. Then, place the mixture in a PCR instrument for the following reaction:

[0117]

[0118] 6. Streptavidin bead washing: 40 minutes before the previous reaction is complete, remove the streptavidin beads from 4°C and allow them to equilibrate at room temperature for 30 minutes. Then, perform the following steps:

[0119] 1) Pipette 100 μL of magnetic beads into a 1.5 mL low-adsorption centrifuge tube and clean the magnetic beads with Beads Binding buffer;

[0120] 2) Add 200 μL of Bead Binding Buffer to the centrifuge tube, gently pipette to mix 10 times, centrifuge briefly, place on a magnetic rack for several minutes until the liquid is completely clear, discard the supernatant using a pipette; remove the centrifuge tube from the magnetic rack;

[0121] 3) Repeat step 2) twice;

[0122] 4) Add 200 μL of magnetic bead suspension to the centrifuge tube, gently mix by blowing and aspirating, and transfer all the magnetic bead suspension to a new 1.5 mL low-adsorption PCR tube.

[0123] 7. Elution of hybridization products:

[0124] 1) Mix 200 μL of magnetic bead suspension with the hybridization product thoroughly, incubate at room temperature for 30 min, place on a magnetic rack after incubation, wait for the solution to become clear, and discard the supernatant using a pipette;

[0125] 2) Then remove the centrifuge tube from the magnetic rack, add 200 μL of preheated (e.g., 65°C) Fast Wash Buffer 1, mix thoroughly, and incubate at 65°C for 5 minutes. After incubation, place it on the magnetic rack for 1 minute until the solution is clear, and remove the supernatant. Add another 200 μL of preheated (e.g., 65°C) Fast Wash Buffer 1, incubate at 65°C for 5 minutes, and after incubation, place it on the magnetic rack until it is clear, and remove the supernatant.

[0126] 3) Add the product from the previous step to 200 μL of Wash Buffer 2 at 48°C, mix thoroughly, and incubate at 48°C for 5 minutes. After incubation, place the solution on a magnetic rack for 1 minute until it becomes clear, and then remove the supernatant. Repeat this step 3 times.

[0127] After the final wash, remove all supernatant residue with a 10 μL pipette, but do not let the beads become too dry. Remove the centrifuge tube from the magnetometer, add 40 μL of water, and mix well with a pipette. Then incubate the solution on ice, take 20 μL for the next experiment, and retain 20 μL.

[0128] 8. Extension reaction: Prepare the reaction system under the following conditions:

[0129]

[0130] Gently pipette the mixture to mix thoroughly and briefly centrifuge. Then, place the mixture in a PCR instrument for the following reaction:

[0131]

[0132] 9. Extend product linkage by preparing the linkage reaction system under the following conditions:

[0133]

[0134] Gently pipette to mix and briefly centrifuge. Place in a PCR instrument and incubate at 20°C for 15 minutes.

[0135] 10. Purification of ligation products:

[0136] Add 100 μL of Novizan purification magnetic beads to the ligation product, mix thoroughly, and let stand at room temperature for 5 min. Place the mixture on a magnetic rack for about 5 min to allow the magnetic beads to be completely adsorbed and the solution to become clear. Carefully remove the supernatant. Add 200 μL of freshly prepared 80% ethanol for rinsing, incubate at room temperature for 30-60 s, and carefully remove the supernatant. Repeat once. After the magnetic beads have dried, add 22 μL of ultrapure water for elution, let stand at room temperature for 3 min, place the mixture on a magnetic rack, and after the solution becomes clear, take 20 μL of the supernatant for later use.

[0137] 11. Universal primer amplification and enrichment:

[0138] The reaction system was prepared using VAHTS HiFi Universal Amplification Mix for Illumina (catalog number N618) and VAHTS Maxi Unique Dual Index DNA Adapter for Illumina (catalog number 34201) as follows:

[0139]

[0140] Among them, the Index primers can be complementary to the first universal sequencing sequence 101 and the second universal sequencing sequence 201.

[0141] Gently pipette the mixture to mix thoroughly and briefly centrifuge. Then, place the mixture in a PCR instrument for the following reaction:

[0142]

[0143] 12. Purification of amplification products: Add 75 μL of Novizan purification magnetic beads to the amplification products, mix thoroughly, and let stand at room temperature for 5 min. Place on a magnetic rack for about 5 min to allow the magnetic beads to be completely adsorbed and the solution to become clear. Carefully remove the supernatant. Add 200 μL of freshly prepared 80% ethanol for rinsing, incubate at room temperature for 30-60 s, and carefully remove the supernatant. Repeat once. After the magnetic beads are dry, add 22 μL of ultrapure water for elution, let stand at room temperature for 3 min, and then place on a magnetic rack. After the solution becomes clear, take 20 μL of the supernatant for later use.

[0144] 13. Sequencing was performed using the Illumina Novaseq 6000 platform. The data volume of standards 1 and 2 was 5G each.

[0145] It should be noted that the Blocker Solution, streptavidin magnetic beads (catalog number: 100983), and elution buffers (Binding buffer, Washing Buffer 1, Washing Buffer 2) in this embodiment were purchased from Twist Bioscience (catalog number 100971). It should be understood that those skilled in the art may choose to use products from other reagent companies, and this disclosure does not limit this choice.

[0146] Example 2

[0147] The difference between this embodiment and Embodiment 1 lies in the probe set. For example... Figure 2 As shown, the upstream probe adds a first tag sequence 103 between the first universal sequencing sequence 101 and the first specific sequence 102; the downstream probe adds a second tag sequence 203 between the second universal sequencing sequence 201 and the second specific sequence 202.

[0148] For example, the first tag sequence 103 is 4 random bases, such as the first universal sequencing sequence 101 and the first tag sequence 103 (5'-3') could be ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNN—SEQ ID NO:723.

[0149] For example, the second tag sequence 203 is 4 random bases, such as the second tag sequence 203 and the second universal sequencing sequence 201 (5'-3') being NNNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC—SEQ ID NO:724.

[0150] Comparative Example 1

[0151] For comparative testing of hybridization capture, the hybridization capture reagent used was the NanOnCT Panel v1.0 kit (1001902) from Nanotronics, and the experimental procedure was performed according to the kit instructions. Samples included standards 1 and 2; 100 ng of each was used for hybridization capture library construction and sequencing, with a total data volume of 5 GB per sample.

[0152] Comparative Example 2

[0153] The difference between Comparative Example 2 and Example 1 lies in the first and second specific sequences in the target gene and probe set. Specifically, using EGFR and KRAS genes as targets and hotspot mutation sites (S) as the center, 40-60 bases are extended upstream and downstream respectively to form two sequences. The upstream sequence ends at the hotspot mutation base site. For different mutation bases, the upstream sequence contains multiple sequences. The TM value of all sequences is calculated using Bio.SeqUtils, MeltingTemp module, and Tm_NNmethods to ensure that the TM value is approximately 60. Each hotspot mutation upstream and downstream sequence is defined as an upstream and downstream probe pair.

[0154] For example, such as Figure 4 As shown, upstream probes 401 and 402 include a first universal sequencing sequence and extended bases; wherein upstream probe 401 is a wild-type upstream probe with wild-type bases at the end, and upstream probe 402 is a mutant upstream probe with mutant bases at the end. The downstream probe includes a second universal sequencing sequence and extended bases. Here, the positions of the extended bases in the upstream and downstream probes are the same as the positions of the first and second specific sequences in Example 1.

[0155] Finally, 50 upstream and downstream probe pairs were formed. The extended base sequence information of the probes is shown in Table 3, where the mutation site refers to the protein mutation site. Comparative tests were performed with the KRAS and EGFR probe sets (probe sets 18-39, 262-308) from Example 1.

[0156] Table 3

[0157]

[0158]

[0159]

[0160]

[0161]

[0162] The data results are shown below:

[0163]

[0164] It should be noted that the above results only show the detection results of partial mutations in some genes, to illustrate the comparison of detection results between the examples and comparative examples. Detection results for other genes are omitted and not shown.

[0165] Comparing Examples 1 and 2, it can be seen that both Examples 1 and 2 show good detection results at mutation frequencies above 1%. Example 2 adds four random bases to each of the upstream and downstream probe sequences, which can serve as molecular tags. Each original DNA strand carries a unique tag sequence, which can eliminate false positives caused by PCR amplification errors, especially in the detection of ultra-low frequency mutations. For example, in the detection of mutation frequencies such as EGFR (L858R - mutation frequency 0.1%), EGFR (T790M - mutation frequency 0.2%), KRAS (A146T - mutation frequency 0.1%), BRAF (V600E - mutation frequency 0.7%), and NRAS (Q61K - mutation frequency 0.1%), the detection results of Example 2 are more accurate, indicating that adding random bases to the upstream and downstream probe sets can effectively improve the accuracy of ultra-low frequency gene mutation detection.

[0166] Comparing Example 2 and Comparative Example 1, Comparative Example 1 used a traditional hybridization capture probe sequencing method, which could effectively detect low-frequency gene mutations ranging from 0.1% to 7%. Compared to Comparative Example 1, Example 2 used an upstream and downstream probe scheme, combined with extension and ligation reactions, which further improved the specificity of hybridization capture, achieving a capture efficiency of over 85%. In addition, the uniformity of the target region was also improved.

[0167] Comparing Example 2 and Comparative Example 2, the inspection results of Example 2 are significantly better than those of Comparative Example 2. In Comparative Example 2, the probe design lacks spacing between upstream and downstream probes, limiting detection to known single-base mutation sites and failing to detect multi-base mutations. Furthermore, while mutations exceeding 1% can be effectively detected, accuracy is insufficient for ultra-low frequency mutation detection, and both capture efficiency and uniformity are low. This may be due to the shorter overall fragment size and greater loss of sequences after the probe captures the target region sequence.

[0168] Furthermore, the gene mutation detection method provided in this disclosure can improve the uniformity of the target region (coverage of 0.2 times the average depth) from 94% (highest comparison ratio) to 97%; and improve the hybridization capture efficiency of the target region from 82% (highest comparison ratio) to a minimum of 86%.

[0169] In summary, the probe set and detection method provided in this disclosure not only improve the detection effect, but are also simple to operate and help save detection time.

[0170] Those skilled in the art should understand that the discussion of any of the above embodiments is merely exemplary and is not intended to imply that the scope of this disclosure (including the claims) is limited to these examples; within the framework of this disclosure, the technical features of the above embodiments or different embodiments can also be combined, the steps can be implemented in any order, and there are many other variations of different aspects of the embodiments of this disclosure as described above, which are not provided in detail for the sake of brevity.

[0171] This disclosure is intended to cover all such substitutions, modifications, and variations that fall within the broad scope of the appended claims. Therefore, any omissions, modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this disclosure should be included within the scope of protection of this disclosure.

Claims

1. A method for detecting gene mutations, characterized in that, The detection method includes: Fragment the sample sequence and denature it; The denatured sample sequence is hybridized with at least one set of probes; wherein the probe set includes a first probe and a second probe. The product of the hybridization reaction is used for the extension reaction of the first probe; By connecting the extension product and the second probe, a sequencing sequence targeting at least one target region is obtained; wherein the number of target regions corresponds to the number of probe sets; The sequencing sequences were amplified and enriched, and the enriched products were sequenced.

2. The detection method according to claim 1, characterized in that, The first probe includes a first universal sequencing primer, and the second probe includes a second universal sequencing primer; The amplification and enrichment of the sequencing sequences includes: Amplification and enrichment are performed using universal primers; wherein the universal primers are at least complementary to either the first universal sequencing sequence or the second universal sequencing sequence.

3. The detection method according to claim 1, characterized in that, The extension reaction is preceded by: purifying the products of the hybridization reaction; and / or The amplification and enrichment process includes purifying the sequencing sequence.

4. A probe set for detecting gene mutations, used to perform the detection method according to any one of claims 1 to 3; wherein, The first probe includes a first universal sequencing sequence and a first specific sequence targeting a specific region of the gene to be tested; wherein the first specific sequence is adjacent to the 3' end of the first probe; and The second probe includes a second universal sequencing sequence and a second specific sequence targeting the target region; wherein the second specific sequence and the 5' end of the second probe are adjacent and target the same single-stranded gene sequence as the first specific sequence.

5. The probe assembly according to claim 4, characterized in that, The first probe further includes a first tag sequence; the first tag sequence is located between the first universal sequencing sequence and the first specific sequence; and / or The second probe also includes a second tag sequence; the second tag sequence is located between the second universal sequencing sequence and the second specific sequence.

6. The probe assembly according to claim 5, characterized in that, The first tag sequence and the second tag sequence each independently comprise 2 to 12 random bases.

7. The probe assembly according to claim 4, characterized in that, The 5' end of the first probe is biotin-tagged; and / or The last base at the 3' end of the second probe is modified with dideoxycytosine nucleoside; and / or The 5' end of the second probe is modified with a phosphate group.

8. The probe assembly according to claim 4, characterized in that, The length of at least one of the first specific sequence and the second specific sequence is 20 to 35 nucleotides.

9. The probe assembly according to claim 4, characterized in that, The length of at least one of the first universal sequencing sequence and the second universal sequencing sequence is 25 to 40 nucleotides.

10. The probe assembly according to claim 4, characterized in that, The target regions corresponding to the first and second specific sequences have a sequence length of 140 to 300 nucleotides.

11. The probe assembly according to claim 4, characterized in that, The first specific sequence includes a sequence that has at least 70% identity with any of the sequences in SEQ ID No. 1 to SEQ ID No. 720 that are ordered as odd numbers; and / or The second specific sequence includes sequences that have at least 70% identity with any even-numbered sequence in SEQ ID No. 1 to SEQ ID No.

720.

12. A reagent for detecting gene mutations, said reagent comprising at least one set of probes as described in any one of claims 4 to 11.

13. A kit for detecting gene mutations, the kit comprising the reagent of claim 12.