Specific marker, primer pair and application of exon region insertion variation of hydin gene of oplegnathus punctatus and detection method
By designing specific primers and using agarose gel electrophoresis, the problem of detecting DNA insertion variations in the exon region of the hydin gene of spotted rock sea bream was solved, enabling rapid identification of the genetic sex of spotted rock sea bream and improving seedling production efficiency.
Patent Information
- Application Number
- CN202610943113.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-06-29
- Publication Date
- 2026-07-24
AI Technical Summary
Existing technologies make it difficult to accurately detect DNA insertion variations in the exon region of the hydin gene of spotted sea bream, resulting in the inability to quickly identify its genetic sex, which limits the breeding of early spotted sea bream seedlings and the production of parthenogenetic seedlings.
A pair of specific primers were designed to identify the genetic sex of spotted rock snapper by utilizing the nucleotide sequence differences in the exon regions of the hydin gene on the X2 and Y chromosomes of male and female spotted rock snapper through PCR amplification and agarose gel electrophoresis.
This technology enables rapid and accurate identification of the genetic sex of spotted sea bream, significantly accelerating the genetic breeding process, improving the production efficiency of high-quality seedlings, and shortening the identification cycle.
Smart Images

Figure CN122445783A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular biology, and more specifically to a specific marker, primer pair, application, and detection method for insertion variations in the exon region of the hydin gene of the spotted sea bream. Background Technology
[0002] Spotted sea bream ( Oplegnathus punctatus The spotted sea bream exhibits significant male growth advantages, commanding a market price as high as 240 yuan per kilogram. However, it takes 3-4 years for it to reach natural sexual maturity, and its sex cannot be determined by appearance in the early stages, severely restricting the breeding of superior varieties and the production of parthenogenetic seedlings. The development of genetic sex markers for spotted sea bream will directly serve the urgent needs of the efficient aquaculture industry. It can be directly applied to the rapid and accurate genetic sex identification of spotted sea bream in the early seedling stage (distinguishing through agarose gel electrophoresis), providing technical support for the preparation of all-male seedlings and the cultivation of highly male seedlings.
[0003] The Hydin gene, short for HYDIN axonemal central pair apparatus protein, belongs to the ciliary axonemal structural protein family and is located on human chromosome 16, region 16q22.2. It encodes a large protein of 5,121 amino acids. This gene is highly conserved evolutionarily and is widely distributed in vertebrates. Its unique feature is the existence of a nearly identical pseudogene, HYDIN2 (located on chromosome 1), in the human genome, which presents a significant challenge for gene sequencing. The HYDIN protein is a key component of the central pair apparatus of cilia and flagellar axonemals, primarily located in the C2b protrusion structure. It is crucial for maintaining normal ciliary movement, respiratory mucus clearance, cerebrospinal fluid circulation, and sperm motility, and is highly expressed in tissues such as the testes, lungs, brain, and spinal cord. Since the first confirmation in 2012 that the biallelic HYDIN mutation causes primary ciliary dyskinesia type 5 (CILD5 / PCD5), this gene has shown a high pathogenicity in certain populations, explaining 22% of PCD cases in the Finnish population and 8% of patients with normal visceral positions in the French-Canadian population. Due to the presence of the HYDIN2 pseudogene, conventional short-read sequencing is difficult to detect accurately. Recent studies have achieved diagnostic breakthroughs using long-read nanopore sequencing combined with bioinformatics masking techniques; in the UK, 17 HYDIN-related families were detected out of 437 families. To date, there are few reports on the genetic identification of male and female spotted seabream based on exon DNA insertion variations. Summary of the Invention
[0004] This invention aims to overcome the limitations of existing technologies for detecting insertion variations in the exon DNA of the spotted sea bream gene, and to provide a specific marker, primer pair, application, and detection method for insertion variations in the exon region of the spotted sea bream hydin gene.
[0005] To achieve the above objectives, the technical solution of the present invention is as follows: A specific marker for insertion variation in the exon region of the hydin gene of *Syngonium spp.* The specific marker for insertion variation in the exon region of the hydin gene of *Syngonium spp.* is the nucleotide sequence of the non-insertion and insertion specific markers of the DNA fragment in the exon region of the hydin gene of *Syngonium spp.*, and the sequence is the bases shown in SEQ ID NO:1 and SEQ ID NO:2.
[0006] The nucleotide sequence SEQ ID NO:1 in the specific marker is a homologous fragment in the exon region of the hydin gene shared by the X2 chromosomes of both male and female spotted sea bream, where no DNA insertion variation has occurred. It is a DNA characteristic marker shared by individuals with non-inserted and inserted bases in the exon region of the hydin gene of spotted sea bream. The nucleotide sequence SEQ ID NO:2 is a DNA fragment inserted between positions 98 and 99 (insertion 228 bp) of the bases shown in the nucleotide sequence SEQ ID NO:1. This inserted fragment is a characteristic marker of individuals with base insertion in the exon region of the hydin gene of the spotted rock seabream.
[0007] The application of a specific marker for an exon region insertion variation in the hydin gene of the spotted sea bream, and the application of the specific marker in identifying the genetic sex of the spotted sea bream.
[0008] A method for identifying the genetic sex of spotted sea bream using the aforementioned specific marker. 1) PCR amplification: Take the spotted sea bream to be tested and extract genomic DNA; use the obtained genomic DNA as a template and use the specific primers for the exon region of the spotted sea bream hydin gene to perform PCR amplification, and compare the obtained PCR amplification product with the non-insertion and insertion specific markers of the DNA fragment of the exon region of the spotted sea bream hydin gene. 2) Result interpretation: The genetic sex of the spotted sea bream to be tested is determined by amplified fragments.
[0009] The specific primer is Ch_F:1: 5'-GAATTCACTGTTTCCACTGGTAC-3'; Ch_R:2: 5'- ACTCTCAGTCTTCAAATATTTGG-3'.
[0010] The amplification of only a single DNA fragment of 159 bp shown in SEQ ID NO:1 is a non-insertion-specific marker DNA fragment of the exon region of the hydin gene of the spotted sea bream to be detected. The spotted sea bream to be detected is female X1X1X2X2. The two DNA fragments, 159bp and 387bp, shown in SEQ ID NO:1 and SEQ ID NO:2, were amplified. These fragments are DNA fragments with specific markers inserted into the exon region of the hydin gene of the spotted sea bream to be detected. The spotted sea bream to be detected is a male X1X2Y.
[0011] Advantages of this invention: This invention, based on whole-genome sequence analysis of the spotted rock seabream, successfully screened and identified sex-specific large-fragment DNA insertion marker sequences in homologous regions of X and Y chromosome gene exons. These markers can efficiently and accurately detect DNA insertion variations in spotted rock seabream gene exon regions. By comparing the sequences of homologous genes on the male Y fusion chromosome and the female X chromosome, specific large-fragment DNA insertions were found in the corresponding gene exons of the Y chromosome. This marker provides a reliable tool for rapid genetic sex identification of spotted rock seabream germplasm resources, significantly accelerating the genetic breeding process and improving the efficiency of large-scale production of high-quality seedlings, thus possessing significant application value.
[0012] This invention provides a rapid and simple method for genetic sex determination in spotted sea bream: requiring only a pair of specific primers, two bands (387 bp and 159 bp) are amplified in individuals with DNA insertion (males), while only a single 159 bp band is amplified in individuals without insertion (females). This can be clearly distinguished by conventional agarose gel electrophoresis. The method is convenient, has high accuracy, significantly shortens the identification cycle, and improves throughput and efficiency. This method has broad application prospects in key stages such as sex determination of spotted sea bream, preparation of high-male seedlings, and family selection, and has significant economic and scientific value in promoting the high-quality development of the spotted sea bream aquaculture industry. Attached Figure Description
[0013] Figure 1 The diagram provided in this embodiment of the invention shows the alignment of the hydin gene exon region with the nucleotide sequence of chromosome X2. The modules shown in the diagram represent highly homologous regions of the hydin gene exon region and chromosome X2, and the framed area is the location of the target sequence ChrX1 of this invention.
[0014] Figure 2 ChrX provided for embodiments of the present invention 2hydin and Chry hydin Specific location information of homologous sequence alignment; 159bp represents ChrX. 2hydin The length of the fragment, 387bp represents Chrys. hydin Fragment length; Chry hydin The middle low region represents the inserted 228 bp nucleotide sequence, and this region is related to ChrX. 2hydin The fragment has no homologous matching sequence.
[0015] Figure 3 The X chromosome ChrX obtained as provided in the embodiments of the present invention 2hydin ChrY with Y chromosome hydin Nucleotide sequence alignment diagram, with primer positions at both ends indicated by double black underlines; *: represents ChrX. 2hydin and Chry hydin Sequence consistency: blank areas indicate sequences with inconsistent bases; ------: represents insertion or deletion sequences; black single underline represents the region where the insertion sequence is located.
[0016] Figure 4 The X chromosome ChrX provided in the embodiments of the present invention 2hydin ChrY with Y chromosome hydin A schematic diagram of differentially inserted DNA fragments with homologous nucleotide sequences; black areas represent homologous regions, and blank areas represent deleted regions and site information.
[0017] Figure 5 The image shows the 1.5% agarose gel electrophoresis results of PCR products from male and female spotted sea bream provided in this embodiment of the invention. M: DL 2000 DNA Maker; ♂: physiological male fish; ♀: physiological female fish. Individuals showing two bands (387bp and 159bp) are individuals with DNA insertion in the gene exon, which are also genetically male fish, and are physiologically male based on histological identification. Individuals showing a single band (159bp) are individuals without DNA insertion in the gene exon, which are also genetically female fish, and are physiologically female based on histological identification. Detailed Implementation
[0018] The following examples further illustrate specific embodiments of the present invention. It should be noted that the specific embodiments described herein are merely for illustration and explanation and are not intended to limit the scope of the present invention.
[0019] This invention utilizes the published genome information of the spotted sea bream (CNP0001488, Li et al., 2021) and, through genomic bioinformatics analysis, discovered that genes on the male Y chromosome exhibit large-segment DNA sequence insertion variations (e.g., [missing information]) compared to homologous genes on the female X2 chromosome. Figure 1 and Figure 2 (As shown). This invention selects the 28,549,183bp~28,549,341bp region on the female X2 chromosome containing this gene, and the 28,549,853bp~28,550,239bp region on the male Y chromosome that is homologous to it and contains DNA sequence insertions, as the research target regions. On the X2 chromosome, the DNA fragment is 159bp in length and is named ChrX. 2hydin(i.e., ChrX2), whose sequence is shown in SEQ ID NO:1; while on the Y chromosome, the DNA fragment is 387 bp in length and contains a sequence homologous to the gene on the X2 chromosome, and is named ChrY. hydin (i.e., ChrY), whose sequence is shown in SEQ ID NO:2. Comparison of the homologous sequences of ChrY and ChrX2 revealed an inserted DNA sequence between positions 98 and 99 (228 bp insertion) corresponding to ChrX2. The total size of the inserted fragment is 228 bp (e.g., ...). Figure 3 and Figure 4 (As shown). This inserted sequence serves as a DNA marker for detecting whether a base insertion variation has occurred in the exon of the spotted rockfish gene; at the same time, since this marker is located on the male Y chromosome and has a male-linked inheritance characteristic, this fragment is also a DNA marker unique to the Y chromosome of male spotted rockfish, while ChrX2 is a DNA feature marker shared by both male and female spotted rockfish.
[0020] This invention utilizes a specific long DNA insertion sequence found in the exon region (28,549,853bp~28,550,239bp) of the hydin gene on the Y chromosome of male spotted sea bream as a marker to detect whether DNA insertion variations have occurred in the exons of spotted sea bream genes. This discovery has led to a rapid method for detecting exon variations in spotted sea bream genes and further applied to the rapid identification of the genetic sex of spotted sea bream. Specifically, the detection method first confirms the presence of a Y chromosome-specific gene nucleotide fragment (387bp) in the spotted sea bream sample to be tested. This step achieves rapid identification by designing specific PCR primers. This invention, through comparative analysis of the gene sequence on the Y chromosome of spotted sea bream with homologous sequences on chromosomes X1 and X2, identifies the gene (ChrX2) on chromosome X2. hydin Its sequence is as shown in SEQ ID NO:1) and the sequence on the Y chromosome (ChrY) is homologous to the nucleotide sequence. hydin The sequence is shown in SEQ ID NO:2. Based on the characteristic of a large DNA insertion in this homologous exon region on the Y chromosome, we designed a pair of primers. Analysis of the PCR products by 1.5% agarose gel electrophoresis can quickly determine whether a DNA insertion mutation has occurred in the exon of the hydin gene in the spotted rockfish. Furthermore, since this DNA insertion marker is located on the male Y chromosome and exhibits sex-linked inheritance characteristics, it is also suitable for accurately identifying the genetic sex of the spotted rockfish. The upstream and downstream primer sequences are as follows: Ch_F:1 : 5'-GAATTCACTGTTTCCACTGGTAC-3' (X ID No:2) (SEQ ID NO:3) Ch_R:2: 5'- ACTCTCAGTCTTCAAATATTTGG-3' (X ID No: 3) (SEQ ID NO: 4).
[0021] The steps for identifying exon insertion variations in the spotted rockfish gene using the above primers mainly include: extracting high-quality whole-genome DNA from the spotted rockfish, amplifying the specific marker DNA fragment of the exon insertion on the Y chromosome gene, and detecting the PCR product DNA by agarose gel electrophoresis; among them, two DNA fragments of 387bp and 159bp were amplified in the Y chromosome and X2 chromosome of male spotted rockfish (X1X2Y), respectively, and the 387bp fragment was a marker fragment specific to the hydin gene of the variant exon; while in female spotted rockfish (X1X1X2X2) individuals, only a single DNA fragment of 159bp was amplified.
[0022] This invention, based on whole-genome sequencing, genome localization, and DNA sequence alignment analysis of male and female spotted sea bream, discovered a specific long-segment DNA insertion variant in the exon region of the hydin gene on the Y chromosome of male sea bream. This insertion variant can serve as a unique exon DNA marker for the hydin gene on the Y chromosome of spotted sea bream, and can also be used for rapid, accurate, and efficient identification of the genetic sex of spotted sea bream individuals. Using specific primers designed based on this variant for PCR amplification, two bands (387 bp and 159 bp) were amplified in individuals with the hydin gene exon insertion variant, where the 387 bp band is the Y chromosome-specific target band; while in individuals without this insertion variant (i.e., females or individuals without a Y chromosome), only a single 159 bp target band was amplified. The amplified products can be rapidly and accurately distinguished by agarose gel electrophoresis, enabling rapid determination of whether or not a hydin gene exon insertion variant has occurred in spotted sea bream. Meanwhile, since this specific target band (387 bp) is specifically located on the male Y chromosome and has male-linked Y chromosome inheritance characteristics, this fragment can also be used as a sex-specific DNA molecular marker of the male Y chromosome of spotted rockfish, and can be directly applied to the accurate and rapid identification of the genetic sex of spotted rockfish.
[0023] Example 1: Screening and Validation of DNA Markers Specific to Exon Base Insertion Variations in the Spotted Sea Bream Gene Discovery of homologous gene regions on the X and Y chromosomes of the spotted rockfish, containing a large inserted target DNA sequence: The DNA sequences of the male neo-Y chromosome and the X1 chromosome of the female were derived from published genome information of the spotted rockfish (CNP0001488, Li et al., 2021). Comparative genomic bioinformatics analysis of the male and female spotted rockfish genome sequences revealed that the genes on the Y chromosome of the male spotted rockfish are homologous to those on the X2 chromosome of the female spotted rockfish, and a large DNA insertion fragment is present. The target DNA fragment on the X2 chromosome is 159 bp in length and is named ChrX. 2hydin (i.e., ChrX2), whose sequence is SEQ ID NO:1: GAATTCACTGTTTCCACTGGTACTGTGTGTTTTACTTTACCAAAGATTAACTTCAGCTTCAGCTTAACTTTATTGTCCCAGAAGAGAACTTTTAACTTAATCATATCACCTCATTAGCAGAATCTTGATATTTTAACCAAATATTTGAAGACTGAGAGT.
[0024] The target DNA fragment of the homologous gene on the male fish's heterochromosome Y is 387 bp in length, and it contains a sequence homologous to X2, named ChrY. hydin (i.e., ChrY), whose sequence is SEQ ID NO:2: GAATTCACTGTTTCCACTGGTACTATGTGTTTTACTTTACCTAAGATTAACTTCAGCTTCAACTTAACTTTATTGTCCCAGAAGAGAACTTTTAACTTGTGTTTTTTGCATTCAGTCGTTGAGATGACCAAAGAGGGAAGCAGTGGGAGACTGGGGCAGCTAGAGACGACCCCCGTCTACAGAGCAATTGCCCG CCACATGTGTGTTGACCTGTCACCTGAGGGTCTGGCTGCACGCAACCGCAGAGGCATAGCTATTATTGTATATGGAGCCCCACTGACAGGTGAAGCAGTTAAACAGTAAATTCTGTATTGTAAATCAAGTAAAATCATATCACCTCATTAGCAGAATCTTGATATTTTAACCAAATATTTGAAGACTGAGAGT.
[0025] Whole-genome scanning and gene localization and DNA sequence alignment analysis of male and female individuals revealed an exon DNA sequence insertion on ChrY (Y chromosome), which is homologous to the ChrX2 gene segment located on chromosome X2. The insertion occurred between positions 98 and 99 of ChrX2 (228 bp insertion), with a length of 228 bp. Figure 3 , Figure 4 The target region (ChrY) of the gene on the Y chromosome contains a 228 bp DNA sequence inserted into the homologous region (ChrX2) on the X2 chromosome. This fragment is a DNA marker specific to exon insertion variation in the ChrY gene of the spotted rockfish, and its presence or absence can be used to identify whether an exon insertion variation has occurred in the ChrY gene of the spotted rockfish. Furthermore, because this marker is located on the male Y chromosome and exhibits male-linked inheritance characteristics, the ChrY fragment is also a DNA marker specific to the Y chromosome of male spotted rockfish, while ChrX2 is a shared DNA marker for the sex of both sexes in spotted rockfish. Figure 3 As shown.
[0026] Sequence verification of the DNA marker specific to the exon insertion variation of this gene: Based on the nucleotide sequence characteristics of the Y chromosome gene SEQ ID NO:2 and the homologous gene SEQ ID NO:1 on the X2 chromosome, two primers were designed. High-quality DNA was extracted from male and female spotted rock seabream of known physiological sex, and PCR amplification was performed using primers Ch_F:1 and Ch_R:2. The reaction conditions and procedures were as follows: The PCR reaction system was 20 µL, including 5.8 µL of 10×Buffer, 4.0 µL of dNTPs, 0.2 µL of rTaq enzyme (5 U / µL), 0.4 µL each of forward and reverse primers (Ch_F:1 and Ch_R:2), 2.0 µL of DNA template, and 7.2 µL of ddH2O. Touch-down PCR amplification program: 95℃ 3 mins, 55℃ (-1℃, 3 cycles) 1 min, 72℃ 1 min, 3 cycles; 95℃ 30 s, 52.5℃ 30 s, 72℃ 1 min, 30 cycles; 72℃ 10 min, 15℃ storage. PCR products were analyzed by 1.5% agarose gel electrophoresis, which distinguished between individuals with exon variants and those without the hydin gene variant. The differentially expressed fragments were recovered from the gel and transformed into competent cells using the PMD18-T vector. Positive clones were selected and sent to Qingdao Paisennuo Gene Biotechnology Co., Ltd. for sequencing. Sequencing results confirmed that the homologous genes on the X and Y chromosomes of the spotted sea bream contained large inserted target DNA sequence fragments, such as... Figure 1 and Figure 2 As shown.
[0027] Example 2: Establishment and Application of Exon Insertion Variation Identification Technology for Spotted Sea Bream Gene Genetic identification was conducted on spotted sea bream (12 of which were female and 12 were male) raised by Laizhou Mingbo Aquatic Products Co., Ltd. in Laizhou City, Yantai, Shandong Province.
[0028] High-quality DNA extraction: DNA was extracted from the fin rays of the spotted sea bream using the Tiangen Marine Animal DNA Extraction Kit. The integrity of the genomic DNA was identified by 1.0% agarose gel electrophoresis. The OD value of the DNA supernatant was measured using a UV spectrophotometer. The DNA concentration was adjusted to 70 ng / µL and stored at -20℃ for later use.
[0029] PCR reaction system and PCR amplification identification: Primers Ch_F:1 and Ch_R:2, which are specific to exon insertion mutations in the *Syngonium hydinum* gene, were used to detect exon mutations in the *Syngonium hydinum* gene using PCR. The PCR reaction system was 20 µL, including 5.8 µL of 10×Buffer, 4.0 µL of dNTPs, 0.2 µL of rTaq enzyme (5 U / µL), 0.4 µL each of forward and reverse primers (Ch_F:1 and Ch_R:2), 2.0 µL of DNA template, and 7.2 µL of ddH2O. The touch-down PCR amplification program was: 95℃ for 3 mins, 55℃ (-1℃, 3 cycles) for 1 min, 72℃ for 1 min, 3 cycles; 95℃ for 30 s, 52.5℃ for 30 s, 72℃ for 1 min 30 s, 28 cycles; 72℃ for 10 min, and stored at 4℃. Using 1.5% agarose gel electrophoresis at a constant voltage of 110V for 20 minutes, gel imaging can clearly distinguish between individuals with inserted and non-inserted DNA genes in the exon formation of the spotted rock seabream (see [link to gel electrophoresis]). Figure 5 ).
[0030] Depend on Figure 5 It is evident that two target bands (387bp and 159bp) are amplified in individuals of spotted rock seabream with DNA insertion in their gene exons. Among them, the 387bp band is the ChrY band, which is a specific target band for DNA insertion variation in gene exons. hydin In individuals where no DNA insertion variants have occurred in the gene exons, only a single band of ChrX1 (159 bp) can be amplified. This is because ChrY... hydin The marker is located on the male Y chromosome and exhibits male-linked inheritance characteristics; therefore, ChrY... hydin This fragment is also a DNA marker unique to the Y chromosome of male spotted rock snapper, and ChrX2 hydinThese are DNA characteristic markers shared by male and female spotted sea bream, which can be used to distinguish selected spotted sea bream. The method of this invention can not only quickly, accurately and efficiently identify whether the gene of the spotted sea bream to be tested has undergone gene exon insertion variation, but also has important significance and application value in the sex identification of spotted sea bream, the preparation of male seedlings and the selection of family lines.
[0031] In summary, this invention, using a pair of specific primers, amplifies two bands (387 bp and 159 bp) in individuals carrying DNA insertion variants, while only a single 159 bp band is amplified in individuals without insertion variants. These band differences can be clearly distinguished using agarose gel electrophoresis, thus enabling rapid and accurate identification of DNA insertion variants in the exon DNA of the spotted sea bream gene. This method significantly shortens the detection cycle and improves screening efficiency, making it valuable for applications such as sex determination, male seedling preparation, and family selection in spotted sea bream.
Claims
1. A specific marker for insertion variation in the exon region of the hydin gene of *Scoidea spp.*, characterized in that: The insertion-specific markers for the exon region of the hydin gene of the spotted sea bream are the non-insertion and insertion-specific nucleotide sequences of the DNA fragments in the exon region of the hydin gene of the spotted sea bream, and the sequences are shown in SEQ ID NO:1 and SEQ ID NO:
2.
2. The specific marker for exon region insertion variation of the hydin gene in the spotted sea bream according to claim 1, characterized in that: The nucleotide sequence SEQ ID NO:1 in the specific marker is a homologous fragment in the exon region of the hydin gene shared by the X2 chromosomes of both male and female spotted sea bream, where no DNA insertion variation has occurred. It is a DNA characteristic marker shared by individuals with non-inserted and inserted bases in the exon region of the hydin gene of spotted sea bream. The nucleotide sequence SEQ ID NO:2 is a DNA fragment inserted between positions 98 and 99 of the bases shown in the nucleotide sequence SEQ ID NO:
1. This inserted fragment is a characteristic marker of individuals with a base insertion in the exon region of the hydin gene of the spotted rock seabream.
3. The application of a specific marker for exon region insertion variation in the hydin gene of the spotted sea bream as described in claim 1, characterized in that: Application of the specific marker in identifying the genetic sex of spotted sea bream.
4. A method for identifying the sex of spotted sea bream using a specific marker of insertional variation in the exon region of the hydin gene of the spotted sea bream as described in claim 1, characterized in that, 1) PCR amplification: Take the spotted sea bream to be tested and extract genomic DNA; use the obtained genomic DNA as a template and use the specific primers for the exon region of the spotted sea bream hydin gene to perform PCR amplification, and compare the obtained PCR amplification product with the non-insertion and insertion specific markers of the DNA fragment of the exon region of the spotted sea bream hydin gene. 2) Result interpretation: The genetic sex of the spotted sea bream to be tested is determined by amplified fragments.
5. The method for identifying the genetic sex of spotted sea bream according to claim 4, characterized in that, The specific primer is Ch_F:1: 5'-GAATTCACTGTTTCCACTGGTAC-3'; Ch_R:2: 5'- ACTCTCAGTCTTCAAATATTTGG-3'.
6. The method for identifying the genetic sex of spotted sea bream according to claim 4, characterized in that, Only a single DNA fragment of 159 bp shown in SEQ ID NO:1 was amplified, that is, the DNA fragment of the exon region of the hydin gene of the spotted sea bream to be detected was not an insertion-specific marker, and the spotted sea bream to be detected was female X1X1X2X2; Two DNA fragments, 159bp and 387bp, as shown in SEQ ID NO:1 and SEQ ID NO:2, were amplified. These fragments were identified as DNA fragments with specific markers inserted into the exon region of the hydin gene of the spotted sea bream to be detected. The spotted sea bream to be detected was a male X1X2Y.