A synthetic method of terpenes, genetically engineered bacteria for synthesizing terpenes and application thereof

Abstract

The application relates to a synthesis method of a compound of formula I, a genetically engineered bacterium for synthesizing terpenes and application of the genetically engineered bacterium, relates to the field of biosynthesis, and a synthesis method of terpenes, and comprises the following method: a compound of formula II is sequentially subjected to the action of cytochrome oxidase, carboxylic acid esterase and cyclase to generate the terpene compound shown in formula I. The application solves the problem of multiple synthesis steps of the compound shown in formula I. The application solves the problem of low enzyme rate of each step through gene optimization.

Description

Technical Field

[0001] This invention relates to the field of biosynthesis technology, specifically to a method for synthesizing terpenes, a genetically engineered bacterium for synthesizing terpenes, and their applications. Background Technology

[0002] A molecule with a chemical formula like I is an extremely important synthetic fragrance, playing a central role in high-end perfumes, cosmetics, and tobacco flavoring.

[0003]

[0004] In Formula I, one of CH2CH2CH2OH, CH2OH, OH, CH3, CH2CH3, and CH2CH2CH3.

[0005] Microbial fermentation has a short growth cycle, can be produced around the clock, and has a stable yield, which can meet the growing market demand. Yarrowia lipolytica, an oil-producing yeast, can utilize various inexpensive carbon sources such as glucose, fructose, and glycerol. It has an ample supply of acetyl-CoA and the ability to secrete exogenous proteins and is generally recognized as a safe microorganism (GRAS). However, there are currently no recombinant Yarrowia lipolytica strains capable of synthesizing this molecule. Therefore, there is an urgent need to develop genetically engineered Yarrowia lipolytica strains with the ability to synthesize this molecule. Summary of the Invention

[0006] Purpose of the invention In view of the problems or needs existing in the prior art, the present invention provides a method for synthesizing terpenes, a genetically engineered bacterium for synthesizing terpenes, and its applications.

[0007] This invention solves the problem of numerous synthetic steps in the compound shown in Formula I. This invention also addresses the issue of low enzyme rates at each step through gene optimization.

[0008] Solution To address the problems or needs existing in the prior art, in a first aspect, the present invention provides a method for synthesizing terpenes, characterized by comprising the following method: a compound of formula II is sequentially subjected to the action of cytochrome oxidase, carboxylesterase, and cyclase to generate a terpene compound represented by formula I: ; In Formula I, R is one of CH2CH2CH2OH, CH2OH, OH, CH3, CH2CH3, and CH2CH2CH3, and in Formula II, n = 1 to 4.

[0009] And / or, R is one of CH3, CH2CH3, CH2CH2CH3, and optionally R is CH3; And / or, n is 1, 2, 3, 4, optionally 2; And / or, when R is CH2CH2CH2OH, CH2OH, OH, the step of terminal hydroxylation is also included. By adjusting the number of compounds n in formula II, different products R can be obtained. For example, n=2 yields product R=CH3; n=3 yields product R=CH2CH3; n=4 yields product R=CH2CH2CH3. Hydroxylated products can be obtained by terminal hydroxylation as needed.

[0010] Cytochrome oxidase can insert an oxygen atom into the carbon-oxygen double bond position of the compound shown in Formula II, forming an ester bond. The corresponding product structure is an acetate intermediate.

[0011] Carboxylesterases can catalyze the cleavage of the ester bonds in the above-mentioned acetate intermediates to form the corresponding alcohol intermediates.

[0012] Cycloylases can catalyze the cyclization of the above-mentioned alcohol intermediates to generate the molecule with the structure shown in Formula I.

[0013] Furthermore, the reaction is carried out in yeast cells by independently or simultaneously integrating genes encoding the cytochrome oxidase, carboxylesterase, and cyclase. Optionally, the genes encoding the cytochrome oxidase, carboxylesterase, and cyclase are simultaneously integrated into the yeast cells.

[0014] Secondly, a yeast genetically engineered strain for producing terpenes is provided, with yeast as the starting strain, including genes encoding cytochrome oxidase, carboxylesterase, and cyclase.

[0015] Thirdly, a method for constructing a genetically engineered yeast strain for producing terpenes is provided, comprising the following steps: 1) Construct a recombinant plasmid containing the cytochrome oxidase gene and capable of expressing cytochrome oxidase in yeast; 2) Construct a recombinant plasmid containing a carboxylesterase gene that can express carboxylesterase in yeast; 3) Construct a recombinant plasmid containing a cyclase gene that can express cyclase in yeast; Optionally, the recombinant plasmids in 1), 2), and 3) can be introduced into yeast sequentially or separately.

[0016] Optionally, the following steps may be included: 1) Construct a recombinant plasmid with the pCAS promoter, Cas9 gene, upstream homologous arm of XPR2 integration site, cytochrome oxidase gene, downstream homologous arm of XPR2 integration site, and sgRNA of XPR2 site arranged in sequence. The plasmid backbone can be pCRISPRyl. 2) Construct a recombinant plasmid with the pCAS promoter, Cas9 gene, upstream homologous arm of SCP2 integration site, carboxylesterase gene, downstream homologous arm of SCP2 integration site, and sgRNA of SCP2 site arranged in sequence. The plasmid backbone can be pCRISPRyl. 3) Construct a recombinant plasmid with the pCAS promoter, Cas9 gene, upstream homologous arm of GSY integration site, cyclase gene, downstream homologous arm of GSY integration site, and sgRNA of GSY site arranged in sequence. The plasmid backbone can be pCRISPRyl. Optionally, the recombinant plasmids in 1), 2), and 3) can be introduced sequentially or separately into Yersinia lipophila.

[0017] In the first, second, or third aspect described above, the amino acid sequence of cytochrome oxidase is at least one of SEQ ID NO:1 to 10; optionally, the amino acid sequence of cytochrome oxidase is at least one of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:9, optionally as shown in SEQ ID NO:1 or SEQ ID NO:4; optionally, the nucleotide sequence encoding SEQ ID NO:1 is shown in SEQ ID NO:25 (other sequences can also be obtained through codon optimization); optionally, the cytochrome oxidase gene is integrated into the XPR2 site of yeast cells; In the first, second, or third aspect described above, the amino acid sequence of the carboxylesterase is at least one of SEQ ID NO:11-16; optionally, the amino acid sequence of the carboxylesterase is at least one of SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, and SEQ ID NO:15, optionally as shown in SEQ ID NO:11 or SEQ ID NO:12; optionally, the nucleotide sequence encoding SEQ ID NO:11 can be as shown in SEQ ID NO:26 (other sequences can also be obtained through codon optimization); optionally, the carboxylesterase gene is integrated into the SCP2 site of the yeast cell; In the first, second, or third aspect described above, the amino acid sequence of the cyclase is at least one of SEQ ID NO:17-24; optionally, the amino acid sequence of the cyclase is at least one of SEQ ID NO:17, SEQ ID NO:19-23, or optionally as shown in SEQ ID NO:17 or SEQ ID NO:22; optionally, the nucleotide sequence encoding SEQ ID NO:17 is shown in SEQ ID NO:27 (other sequences may also be obtained through codon optimization); optionally, the cyclase gene is integrated into the GSY site of the yeast cell.

[0018] Optionally, the yeast cell may contain, independently or simultaneously, combinations of the following amino acid sequences: cytochrome oxidase amino acid sequences as shown in SEQ ID NO:1 or SEQ ID NO:4, carboxylesterase amino acid sequences as shown in SEQ ID NO:11 or SEQ ID NO:12, and cyclase amino acid sequences as shown in SEQ ID NO:17 or SEQ ID NO:22. Optionally, the yeast cell may contain combinations of the following amino acid sequences, either independently or simultaneously: SEQ ID NO:1, SEQ ID NO:11, SEQ ID NO:17; Optionally, the yeast cell may contain combinations of the following amino acid sequences, either independently or simultaneously: SEQ ID NO:1, SEQ ID NO:12, SEQ ID NO:17; Optionally, the yeast cell may contain combinations of the following amino acid sequences, either independently or simultaneously: SEQ ID NO:4, SEQ ID NO:11, SEQ ID NO:17; Optionally, the yeast cell may contain combinations of the following amino acid sequences, either independently or simultaneously: SEQ ID NO:1, SEQ ID NO:11, and SEQ ID NO:22.

[0019] That is, in genetically engineered bacteria, the genes for cytochrome oxidase, carboxylesterase, and cyclase can be integrated into different yeasts to promote the synthesis reaction, or the genes for cytochrome oxidase, carboxylesterase, and cyclase can be integrated into one yeast cell to promote the synthesis reaction.

[0020] In the first, second, or third aspect above, using the compound of formula II as a substrate, the terpene compound represented by formula I is synthesized using the aforementioned yeast genetically engineered bacteria; .

[0021] Fourthly, the application of a yeast genetically engineered strain as described in the second aspect or constructed by the construction method described in the third aspect in the production of terpenoid compounds represented by Formula I is provided. In formula I, R is one of CH2CH2CH2OH, CH2OH, OH, CH3, CH2CH3, and CH2CH2CH3.

[0022] Furthermore, by using compound II as a reaction substrate, YPD medium can be optionally used as a nutrient source for the yeast genetically engineered bacteria. In Equation II, n = 1~4.

[0023] Fifthly, the application of a yeast genetically engineered strain as described in the second aspect or a genetically engineered strain constructed by the construction method described in the third aspect in the metabolism of compound II;

[0024] Where n = 1 to 4, and can be 1, 2, 3 or 4.

[0025] In the first to fifth aspects mentioned above, the yeast is at least one of the following recombinant engineered strains: Saccharomyces cerevisiae, Yarrowia lipolytica, Pichia pastoris, Pichia pastoris, Hansenula polymorpha, Escherichia coli, Bacillus subtilis, Corynebacterium glutamicum; optionally, the yeast is Yarrowia lipolytica, or optionally Yarrowia lipolytica Po1f.

[0026] Beneficial effects This invention solves the problem of numerous synthetic steps in the synthesis of the compound shown in Formula I. This invention addresses the issue of low enzyme rates at each step through gene optimization. This invention achieves gene integration within a microbial chassis to realize a one-step conversion of compound II to compound I. Attached Figure Description

[0027] One or more embodiments are illustrated by way of example with reference to the accompanying drawings, and these illustrative examples are not intended to limit the embodiments. The term "illustrative" as used herein means "serving as an example, embodiment, or illustration." Any embodiment illustrated herein as "illustrative" is not necessarily to be construed as superior to or better than other embodiments.

[0028] Figure 1 The results are from the electrophoresis detection in Example 1; from left to right, they are the 8k Marker, the successfully inserted PCR band, and the control band.

[0029] Figure 2The image shows a gas chromatogram of the supernatant after culturing the Y03 strain in Example 6, with the peak of the target product at 16.38 min.

[0030] Figure 3 The mass spectrum of the purified compound of formula I (R=CH3) in Example 6 is shown. Detailed Implementation

[0031] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0032] Furthermore, to better illustrate the present invention, numerous specific details are provided in the following detailed embodiments. Those skilled in the art should understand that the present invention can be practiced without certain specific details. In some embodiments, materials, elements, methods, and means well known to those skilled in the art are not described in detail in order to highlight the spirit of the invention.

[0033] Unless otherwise expressly stated, throughout the specification and claims, the term "comprising" or its variations such as "including" or "comprises" shall be understood to include the stated elements or components without excluding other elements or other components.

[0034] To facilitate a better understanding of this invention, certain technical terms are specifically defined below. Unless otherwise expressly defined elsewhere in this document, the technical terms used herein have the meanings commonly understood by one of ordinary skill in the art to which this invention pertains. For specific definitions and terms in this field, those skilled in the art may refer to Current Protocols in Molecular Biology (Ausubel). The abbreviations for amino acid residues are the standard 3-letter and / or 1-letter codes used in the art to refer to one of the 20 commonly used L-amino acids. The singular forms used herein (including the claims) include their corresponding plural forms unless otherwise expressly specified herein.

[0035] The term “about” when used in conjunction with a numeric value means to encompass a range of numeric values ​​having a lower limit of 5% less than the specified numeric value and an upper limit of 5% greater than the specified numeric value, including but not limited to ±5%, ±2%, ±1%, and ±0.1%, as these variations are suitable for carrying out the disclosed methods.

[0036] The term “and / or” should be understood to mean any one of the options or any combination of two or more of the options.

[0037] This invention constructs a recombinant strain by integrating multiple genes to achieve one-step biotransformation of the molecule shown in Formula I. The sequence of intracellular biotransformation is as follows: first, cytochrome oxidase catalyzes the formation of an ester from the molecule of Formula II; second, esterase catalyzes the formation of the corresponding alcohol molecule; and third, cyclization generates the molecule shown in Formula I.

[0038]

[0039] In the following examples, R = CH3 in Formula I and n = 2 in Formula II. Products with other substituents can be obtained by adjusting the number of n in Formula II, and hydroxylated products can be obtained by terminal hydroxylation as needed.

[0040] This invention optimizes the cytochrome oxidase involved in the catalytic process, thereby improving the yield.

[0041] This invention optimizes the esterases involved in the catalytic process, thereby improving the yield.

[0042] This invention optimizes the cyclase involved in the catalytic process, thereby improving the yield.

[0043] The culture medium used in this invention is as follows: Screening medium YNB-URA: 10 g / L glucose, 6.7 g / L Yeast Nitrogen Base (YNB), 0.5 g / L uracil (URA), and 20 g / L agar powder.

[0044] Screening medium YNB: 10 g / L glucose, 6.7 g / L Yeast Nitrogen Base (YNB) and 20 g / L agar powder.

[0045] LB medium: 5 g / L yeast extract, 10 g / L peptone, 10 g / L sodium chloride.

[0046] LB selection medium: 5 g / L yeast extract, 10 g / L peptone, 10 g / L sodium chloride, and antibiotics at the corresponding working concentration (ampicillin, kanamycin, spectinomycin, or chloramphenicol). YPD liquid medium: 20 g / L glucose, 20 g / L peptone and 10 g / L yeast extract.

[0047] YPD solid medium: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract and 20 g / L agar powder.

[0048] YPD fermentation medium: 60 g / L glucose, 40 g / L peptone and 20 g / L yeast extract.

[0049] Unless otherwise specified, plasmids were constructed using Golden Gate or Gibson assembly methods. Yeast transformation was performed using the Zymo Research Frozen EZ Transformation II kit.

[0050] According to the amino acid sequence described in this invention, those skilled in the art can obtain the nucleotide molecule encoding the amino acid sequence through chemical synthesis or genetic engineering methods based on codon optimization or host preference. The sequence can be commissioned to a biotechnology company for synthesis.

[0051] Some of the amino acid sequences involved in this invention are shown in Table 1: Table 1

[0052] Note: Other coding nucleotide sequences involved in this invention can be obtained by codon optimization based on the capabilities of those skilled in the art.

[0053] The upstream homologous arm of the integration site involved in this invention can be obtained from publicly available sources such as addgene.

[0054] Example 1: Construction of integration plasmids pCRISPRyl-XPR2:P450-1, pCRISPRyl-SCP2:EST1, and pCRISPRyl-GSY:Cyc1: Elements such as the Cas9 editing protein on the pCRISPRyl backbone (including bases 1-1036 of the pCAS promoter) were obtained by PCR. Streptococcus pyogenesThe recombinant plasmid pCRISPRyl-XPR2:P450-1 was obtained by ligating multiple fragments using Novizan's C117 one-step cloning enzyme. The fragments consisted of the Cas9 gene (1048-5151 bases), the upstream homologous arm of the XPR2 integration site (1500 bp, obtainable from addgene #70007), the pU12-P450-1 expression cassette (nucleotide sequence as shown in SEQ ID NO:25 + stop codon taa), the downstream homologous arm of the XPR2 integration site (1500 bp), and the XPR2 sgRNA sequence GATGTCGTTGAGAGCCC (SEQ ID NO:28). The sequence was obtained by ligation of pCRISPRyl-XPR2 using Novizan's C117 one-step cloning enzyme (sequence order: pCAS promoter + Cas9 + XPR2 upstream homologous arm + P450-1 + XPR2 downstream homologous arm + XPR2 sgRNA). The plasmid was then transformed into *E. coli* DH5α competent cells, screened using ampicillin-resistant plates, and verified by colony PCR and sequencing to obtain the recombinant plasmid pCRISPRyl-XPR2:P450-1.

[0055] The pCRISPRyl backbone (containing elements such as the Cas9 editing protein), the upstream homologous arm (1500 bp) of the SCP2 integration site, the pU13-EST1 expression cassette (nucleotide sequence as shown in SEQ ID NO:26 + stop codon taa), the downstream homologous arm (1500 bp) of the SCP2 integration site, and the sgRNA sequence CCAAGGGTGATGCTGACATC (SEQ ID NO:29) at the SCP2 site were obtained by PCR. Multiple fragments were then ligated using the C117 one-step cloning enzyme of Novizan to obtain the recombinant plasmid pCRISPRyl-SCP2:EST1. The recombinant plasmid was then transformed into *E. coli* DH5α competent cells, screened using ampicillin-resistant plates, and verified by colony PCR and sequencing.

[0056] The pCRISPRyl backbone (containing elements such as the Cas9 editing protein), the upstream homologous arm (1500 bp) of the GSY integration site, the pC48-Cyc1 expression cassette (nucleotide sequence as shown in SEQ ID NO:27 + stop codon taa), the downstream homologous arm (1500 bp) of the GSY integration site, and the sgRNA sequence ATGAGTGATGCAATGCTGCA (SEQ ID NO:30) of the GSY site were obtained by PCR. Multiple fragments were ligated using the C117 one-step cloning enzyme of Novizan to obtain the recombinant plasmid pCRISPRyl-GSY:Cyc1. This plasmid was then transformed into *E. coli* DH5α competent cells, screened using ampicillin-resistant plates, and verified by colony PCR and sequencing. Electrophoresis results are shown below. Figure 1 As shown, this indicates that a positive clone was obtained.

[0057] Example 2: Construction of recombinant lipophilic yeast Y01-03 (1) Yarrowia lipolytica Po1f was cultured in YPD liquid medium for 24 h and then used to prepare competent cells.

[0058] (2) Using the Zymogen Frozen EZYeastTransformation Kit II from Zymo Research Corporation, the recombinant plasmid pCRISPRyl-XPR2: P450-1 was transformed into competent Yarrowia lipolytica Po1f cells, and the cells were plated for screening. YNB-URA yeast selection medium was used for screening, and the inserted P450-1 gene sequence was verified by colony PCR and sequencing to obtain strain Y01. (3) Using the Zymogen Frozen EZYeastTransformation Kit II from Zymo Research Corporation, the recombinant plasmid pCRISPRyl-SCP2:EST1 was transformed into competent Yarrowia lipolytica Y01 cells, and the cells were plated for screening. YNB-URA yeast selection medium was used for screening, and the inserted EST1 gene sequence was verified by colony PCR and sequencing to obtain strain Y02; (4) Using the Zymogen Frozen EZYeastTransformation Kit II from Zymo Research Corporation, the recombinant plasmid pCRISPRyl-GSY:Cyc1 was transformed into competent Yarrowia lipolytica Y02 cells, and the cells were plated for screening. YNB-URA yeast selection medium was used for screening, and the inserted Cyc1 gene sequence was verified by colony PCR and sequencing to obtain strain Y03.

[0059] Example 3: Synthesis experiment of recombinant lipophilic yeasts Y01, Y02, and Y03 in shake flasks.

[0060] The recombinant bacteria were activated, streaked onto YPD solid medium, and cultured at 30°C for 36 h to obtain single colonies. Multiple single colonies were inoculated into 5 mL of YPD fermentation medium and cultured for 30 h to obtain a seed culture (OD600 = 6). This seed culture was then inoculated into 50 mL of YPD fermentation medium at an initial OD600 = 0.5. Fermentation was carried out at 30°C and 220 rpm for 12 h. Then, 10% (by volume) of n-dodecane was added to the fermentation broth, and the culture was continued for 3 days with shaking in the presence of 5 g / L of substrate (compound shown in Formula II, n = 2). Processing of fermentation products: After fermentation, the fermentation broth was transferred to 50 mL centrifuge tubes, centrifuged at 7500 rpm for 8 min, and the uppermost organic phase was collected for later use.

[0061] The fermentation products of each recombinant strain were diluted 10 times with n-dodecane, filtered through an oil-based nylon membrane (0.22 μm), and detected by gas chromatography-mass spectrometry (GC-MS).

[0062] GC detection conditions: Injector temperature 250℃, injection volume 1μL, splitless; Column: Shimadzu DP-5ms (30m×250μm×0.25μm); Chromatographic conditions: Initial temperature 60℃, increased to 160℃ at a rate of 10℃ / min, held for 1 min, then increased to 280℃ at a rate of 40℃ / min, held for 4 min. The entire gas chromatographic program lasted 18 min. Qualitative and quantitative analysis was performed using perillaldehyde standards.

[0063] GC analysis showed that the recombinant strain Y03 produced 130 mg / L of compound I (R=CH3), meaning 130 mg of product per liter of fermentation broth. This product was not detected in the fermentation broths of the other strains (Y01, Y02), nor was it detected in the original strain Yarrowia lipolytica Po1f.

[0064] Example 4: Optimized synthesis experiment of cytochrome oxidase.

[0065] Following the method in Example 1, the P450-1 gene at the XPR2 site of strain Y03 was replaced with the P450-2 to P450-10 genes to construct pCRISPRyl-XPR2: P450-2 to P450-10 plasmids. These plasmids were then transformed into competent cells of Yarrowia lipolytica Po1f according to step (2) of Example 2 to obtain strains Y01-1 to Y01-9. These strains were then constructed according to steps (3) and (4) of Example 2 and named Y01-1 to Y01-9 for ease of representation. The strains were cultured according to the method in Example 3, and the yield of compound I (R=CH3) in the supernatant was tested. The results are shown in Table 1.

[0066] Where + represents a yield range of 0-50 mg / L; ++ represents a yield range of 50-100 mg / L; and +++ represents a yield greater than 100 mg / L.

[0067] Example 5: Optimized synthesis experiment of esterase.

[0068] Following the method in Example 1, the EST1 gene at the SCP2 site of strain Y03 was replaced with EST2 to EST6 genes respectively, and pCRISPRyl-SCP2:EST2 to EST6 plasmids were constructed. These plasmids were then transformed into competent cells of Yarrowia lipolytica Po1f according to step (3) of Example 2. Other genes were transformed according to steps (2) and (4) of Example 2, respectively, to obtain strains Y02-1 to Y02-5. These strains were cultured according to the method in Example 3, and the yield of compound I in the supernatant was tested. The results are shown in Table 2.

[0069] Where + indicates a yield range of 0-50 mg / L; ++ indicates a yield range of 50-100 mg / L; and +++ indicates a yield greater than 100 mg / L. Example 6: Optimized synthesis experiment of cyclase.

[0070] Following the method in Example 1, the Cyc1 gene at the GSY site of strain Y03 was replaced with Cyc2~Cyc8 genes to construct pCRISPRyl-GSY:Cyc2 to Cyc8 plasmids. These plasmids were then transformed into competent cells of Yarrowialipolytica Po1f according to step (4) of Example 2. Other genes were transformed according to steps (2) and (3) of Example 2. Strains Y03-1 to Y03-7 were obtained, and the supernatant yield of compound I (R=CH3) was tested according to the method in Example 3. The results are shown in Table 2.

[0071] Where + represents a yield range of 0-50 mg / L; ++ represents a yield range of 50-100 mg / L; and +++ represents a yield greater than 100 mg / L.

[0072] The gas chromatogram of the culture supernatant of strain Y03 (P450-1+ EST1+ Cyc1) is shown below. Figure 1 As shown, the gas chromatography chromatogram of the purified compound I (R=CH3) is as follows. Figure 2 As shown, the mass spectrum is as follows Figure 3 As shown, all of these indicate that compound I was successfully prepared in this application.

[0073] The above results indicate that even enzymes responsible for catalyzing the same reaction step have significant differences in the final small molecule yield due to different amino acid sequences (even those with high homology). Through extensive screening, this invention unexpectedly discovered that enzymes with specific sequence characteristics can significantly increase metabolic flux.

[0074] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.

Claims

1. A method for synthesizing terpenes, characterized in that, The method includes the following: the compound of formula II is sequentially reacted with cytochrome oxidase, carboxylesterase, and cyclase to generate the terpene compound shown in formula I: ； In Formula I, R is one of CH2CH2CH2OH, CH2OH, OH, CH3, CH2CH3, and CH2CH2CH3, and in Formula II, n = 1 to 4.

2. The synthesis method according to claim 1, characterized in that, The reaction is carried out in yeast cells by integrating genes encoding the cytochrome oxidase, carboxylesterase, and cyclase separately or simultaneously. Optionally, the genes encoding the cytochrome oxidase, carboxylesterase, and cyclase are integrated into the yeast cells at the same time. And / or, R is one of CH3, CH2CH3, CH2CH2CH3, and optionally R is CH3; And / or, n is 1, 2, 3, 4, optionally 2; And / or, when R is CH2CH2CH2OH, CH2OH, OH, the step of terminal hydroxylation is also included.

3. A genetically engineered yeast strain for producing terpenes, characterized in that, Starting with yeast strains, including genes encoding cytochrome oxidase, carboxylesterase, and cyclase.

4. A method for constructing a genetically engineered yeast strain for producing terpenes, characterized in that, The steps include the following: 1) Construct a recombinant plasmid containing the cytochrome oxidase gene and capable of expressing cytochrome oxidase in yeast; 2) Construct a recombinant plasmid containing a carboxylesterase gene that can express carboxylesterase in yeast; 3) Construct a recombinant plasmid containing a cyclase gene that can express cyclase in yeast; Optionally, the recombinant plasmids in 1), 2), and 3) can be introduced into yeast sequentially or separately.

5. The construction method according to claim 4, characterized in that, The steps include the following: 1) Construct a recombinant plasmid with the pCAS promoter, Cas9 gene, upstream homologous arm of XPR2 integration site, cytochrome oxidase gene, downstream homologous arm of XPR2 integration site, and sgRNA of XPR2 site arranged in sequence. The plasmid backbone can be pCRISPRyl. 2) Construct a recombinant plasmid with the pCAS promoter, Cas9 gene, upstream homologous arm of SCP2 integration site, carboxylesterase gene, downstream homologous arm of SCP2 integration site, and sgRNA of SCP2 site arranged in sequence. The plasmid backbone can be pCRISPRyl. 3) Construct a recombinant plasmid with the pCAS promoter, Cas9 gene, upstream homologous arm of GSY integration site, cyclase gene, downstream homologous arm of GSY integration site, and sgRNA of GSY site arranged in sequence. The plasmid backbone can be pCRISPRyl. Optionally, the recombinant plasmids in 1), 2), and 3) can be introduced sequentially or separately into Yersinia lipophila.

6. The synthesis method according to claim 2, or the yeast genetically engineered strain according to claim 3, or the construction method according to claim 4 or 5, characterized in that, The amino acid sequence of cytochrome oxidase is at least one of SEQ ID NO:1 to 10; optionally, the amino acid sequence of cytochrome oxidase is at least one of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:9, optionally as shown in SEQ ID NO:1 or SEQ ID NO:4; optionally, the nucleotide sequence encoding SEQ ID NO:1 is shown in SEQ ID NO:25 (other sequences can also be obtained through codon optimization); optionally, the cytochrome oxidase gene is integrated into the XPR2 site of yeast cells; And / or, the amino acid sequence of the carboxylesterase is at least one of SEQ ID NO:11-16; optionally, the amino acid sequence of the carboxylesterase is at least one of SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:15, optionally as shown in SEQ ID NO:11 or SEQ ID NO:12; optionally, the nucleotide sequence encoding SEQ ID NO:11 can be as shown in SEQ ID NO:26 (other sequences can also be obtained through codon optimization); optionally, the carboxylesterase gene is integrated into the SCP2 site of the yeast cell; And / or, the amino acid sequence of the cyclase is at least one of SEQ ID NO:17-24; optionally, the amino acid sequence of the cyclase is at least one of SEQ ID NO:17, SEQ ID NO:19-23, or optionally as shown in SEQ ID NO:17 or SEQ ID NO:22; optionally, the nucleotide sequence encoding SEQ ID NO:17 is shown in SEQ ID NO:27 (other sequences can also be obtained through codon optimization); optionally, the cyclase gene is integrated into the GSY site of the yeast cell; Optionally, the yeast cell may contain, independently or simultaneously, combinations of the following amino acid sequences: cytochrome oxidase amino acid sequences as shown in SEQ ID NO:1 or SEQ ID NO:4, carboxylesterase amino acid sequences as shown in SEQ ID NO:11 or SEQ ID NO:12, and cyclase amino acid sequences as shown in SEQ ID NO:17 or SEQ ID NO:

22. Optionally, the yeast cell may contain combinations of the following amino acid sequences, either independently or simultaneously: SEQ ID NO:1, SEQ ID NO:11, SEQ ID NO:17; Optionally, the yeast cell may contain combinations of the following amino acid sequences, either independently or simultaneously: SEQ ID NO:1, SEQ ID NO:12, SEQ ID NO:17; Optionally, the yeast cell may contain combinations of the following amino acid sequences, either independently or simultaneously: SEQ ID NO:4, SEQ ID NO:11, SEQ ID NO:17; Optionally, the yeast cell may contain combinations of the following amino acid sequences, either independently or simultaneously: SEQ ID NO:1, SEQ ID NO:11, and SEQ ID NO:

22.

7. The synthesis method according to claim 2, or the yeast genetically engineered strain according to claim 3, or the construction method according to claim 4 or 5, characterized in that, Using the compound of formula II as a substrate, the compound shown in formula I was synthesized using the yeast genetically engineered strain; 。 8. The synthesis method according to claim 2, or the yeast genetically engineered strain according to claim 3, or the construction method according to claim 4 or 5, characterized in that, The yeast is at least one of the following recombinant engineered strains: Saccharomyces cerevisiae, Yarrowia lipolytica, Pichia pastoris, Pichia pastoris, Hansenula polymorpha, Escherichia coli, Bacillus subtilis, Corynebacterium glutamicum; optionally, the yeast is Yarrowia lipolytica, or optionally Yarrowia lipolytica Po1f.

9. The use of a yeast genetically engineered strain as described in any one of claims 3, 5 to 8, or a yeast genetically engineered strain constructed by any one of claims 4 to 8, in generating terpenoid compounds represented by Formula I; In formula I, R is one of CH2CH2CH2OH, CH2OH, OH, CH3, CH2CH3, and CH2CH2CH3; Optionally, the compound of formula II is used as the reaction substrate, and YPD medium is used as the nutrient source for the yeast genetically engineered bacteria. In Equation II, n = 1~4.

10. The application of a yeast genetically engineered strain as described in claim 3, 5 or 6, or a genetically engineered strain constructed by any of the construction methods described in claims 4 to 6, in the metabolism of compound II; ； In Equation II, n = 1 to 4, which can be 1, 2, 3 or 4.

Images