Circulating serum microRNA biomarkers and methods for determining the progression rate of Parkinson's disease
Patent Information
- Authority / Receiving Office
- DE · DE
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2018-06-07
- Publication Date
- 2026-03-11
AI Technical Summary
Current diagnostic methods lack objective biomarkers for early diagnosis and progression assessment of Parkinson's disease, complicating effective therapeutic management.
Identification of specific serum microRNAs (miRNAs) that differentiate between rapid and slow progression of Parkinson's disease, enabling their use in determining disease progression and guiding treatment protocols.
Provides accurate differentiation between rapid and slow Parkinson's disease progression, facilitating tailored therapeutic interventions.
Description
BACKGROUND OF THE INVENTION1. Field of the Invention
[0001] The present invention generally relates to serum-based microRNAs and methods for differentiating patients suffering from Parkinson's disease based on the rate of disease progression, as well as assisting clinicians to determine treatment protocols for such patients.2. Brief Description of the Background Art
[0002] Parkinson's Disease (PD) is a highly specific degeneration of dopamine-containing cells of the substantia nigra of the midbrain, causing a dopamine deficiency in the striatum. PD currently affects about 10 million people worldwide. Effective management of a patient with PD is possible in the first 5-7 years of treatment, after which time a series of often debilitating complications, together referred to as Late Motor Fluctuations (LMF) occur. It is believed that treatment with levodopa ((-)-L-α-amino-beta-(3,4-dihydroxybenzene) propanoic acid), or L-dopa, the most effective anti-Parkinson drug, may facilitate or even promote the appearance of LMF. Dopamine agonists are employed as a treatment alternative, but they do not offer the same degree of symptomatic relief to patients as L-dopa does.
[0003] Symptomatic therapies improve signs and symptoms without affecting the underlying disease state. Levodopa increases dopamine concentration in the striatum, especially when its peripheral metabolism is inhibited by a peripheral decarboxylase inhibitor (PDI). Levodopa / PDI therapy is widely used for symptomatic therapy for Parkinson's disease, such as combinations with levodopa, with carbidopa ((-)-L-α-hydrazino-α-methyl-beta-(3,4-dihydroxybenzene) propanoic acid monohydrate), levodopa and controlled release carbidopa, levodopa and benserazide, levodopa plus controlled release benserazide (2-Amino-3-hydroxy-propionic acid N'-(2,3,4-trihydroxy-benzyl)-hydrazide).
[0004] Catechol-O-methyltransferase (COMT) inhibitors enhance levodopa treatment as they inhibit levodopa's metabolism, enhancing its bioavailability and thereby making more of the drug available in the synaptic cleft for a longer period of time. Examples of COMT inhibitors include tolcapone (3,4-dihydroxy-4'-methyl-5-nitrobenzophenone) and entacapone ((E)-2-cyano-3-(3,4-dihydroxy-5-nitrophenyl)-N,N-diethyl-2-propenamide).
[0005] Dopamine agonists provide symptomatic benefit by directly stimulating post-synaptic striatal dopamine receptors. Examples include bromocriptine ((5α)-2-Bromo-12'-hydroxy-2'-(1-methylethyl)-5'-(2-methylpropyl)erg- otaman-3',6',18-trione), pergolide (8B-[(Methylthio)methyl]-6-propylergoline), ropinirole (4-[2-(Dipropylamino)ethyl]-1,3-dihydro-2H-indol-2-one), pramipexole ((S)-4,5,6,7-Tetrahydro-N 6< -propyl-2,6-benzothiazolediamine), lisuride (N'-[(8α)-9,10-didehydro-6-methylergolin-8-yl]-N,N-diethyl- urea), cabergoline ((8β)-N-[3-(Dimethylamino)propyl]-N-[(ethylamino)carbonyl]-6-(2-propenyl)ergoline-8-carboxamide), apomorphine ((6aR)-5,6,6a,7-Tetrahydro-6-methyl-4 H-dibenzo[de,g]quinoline-10,11-diol), sumanirole (5-(methylamino)-5,6-dihydro-4H-imidazo {4,5,1-ij}quinolin-2(1H)-one), rotigotine ((-)(S)-5,6,7,8-tetrahydro-6-[propyl[2-(2-thienyl)ethyl]amino]-1-naphthol- ), talipexole (5,6,7,8-Tetrahydro-6-(2-propenyl)-4H-thiazolo[4,5-d]azepin-2-amine), and dihydroergocriptine (ergotaman-3',6',18-trione,9,10-dihydro-12'-hydroxy-2'-methyl-5'-(phenylmethyl) (5' cc)). Dopamine agonists are effective as monotherapy early in the course of Parkinson's disease and as an adjunct to levodopa in more advanced stages. Unlike levodopa, dopamine agonists directly stimulate post-synaptic dopamine receptors. They do not undergo oxidative metabolism and are not thought to accelerate the disease process.
[0006] Amantidine (1-Aminotricyclo (3,3,1,1 3,7< ) decane) is an antiviral agent that was discovered by chance to have anti-Parkinsonian activity. Its mechanism of action in PD has not been established, but is believed to work by increasing dopamine release. Patients who receive amantidine either as monotherapy or in combination with levodopa show improvement in akinesia, rigidity and tremor.
[0007] Other medications used in the treatment of Parkinson's disease include MAO-B inhibitors. Inhibition of L-dopa metabolism through inactivation of the monoamino oxidase type B (MAO-B) is an effective means of enhancing the efficacy of both endogenous residual dopamine and that exogenously derived from its precursor, L-dopa. Selegiline (methyl-(1-methyl-2-phenyl-ethyl)-prop-2-ynyl-amine) is a MAO-B inhibitor. There is evidence that treatment with selegiline may slow down disease progression in PD by blocking formation of free radicals derived from the oxidative metabolism of dopamine. Other examples of MAO B inhibitors include lazabemide (N-(2-Aminoethyl)-5-chloro-2-pyridinecarboxamide), rasagiline (N-propargyl-1-(R)aminoindan and caroxazone (2-oxo-2H-1,3-benzoxazine-3(4H)-acetamide).
[0008] It is imperative to diagnose individuals with PD at an early stage and it is also important to determine the prognosis of the disease to increase the efficacy of therapeutic agents. However, there are neither any objective tests nor established biomarkers for diagnosing PD. Moreover, the heterogeneity, subtypes and progression of the disease make it difficult to develop specific therapeutic candidates.
[0009] MicroRNAs ("miRNAs) are a class of non-coding RNAs that play key roles in the regulation of gene expression. miRNAs act at the post-transcriptional level and fine-tune the expression of as much as 30% of all mammalian protein-encoding genes. Mature miRNAs are short, single-stranded RNA molecules approximately 22 nucleotides in length. miRNAs may be encoded by multiple loci, and may be organized in tandemly co-transcribed clusters. miRNA genes are transcribed by RNA polymerase II as large primary transcripts (pri-microRNA) that are processed by a protein complex containing the RNase III enzyme Drosha, DGCR8 and other cofactors, to form an approximately 70 nucleotide precursor microRNA (pre-miRNA). (Cathew RW, Cell, 2009; Kim VN, Nat Rev Mol Cel Biol, 2009; Siomi H, Mol Cel, 2010; Bartel DP, Cell, 2004; Lee Y, Nature 2003; Han J, Genes Dev, 2004.) Pre-miRNA is transported to the cytoplasm by Exportin-5 where it is processed by DICER, a second RNase III enzyme, together with TRBP, PACT and Ago2 in the RNA Induced Silencing Complex resulting in miRNA duplexes (Kim VN, Nat Rev Mol Cel Biol, 2009; Gregory RI, Nature 2004; MAcRae IJ, PNAS, 2008). The guide strands of miRNA duplexes separate and associate with Ago 2 for incorporation into a ribonuclear particle to form the RNA-induced silencing complex RISC that mediates gene silencing. The mechanisms of miRNA range from direct degradation or silencing of mRNA and repression of translation to post-transcriptional upregulations. (MacRae IJ, PNAS, 2008.)
[0010] The presence of miRNAs has been reported in body fluids including blood, cerebrospinal fluid (CSF), plasma, serum and saliva at detectable levels. The tissue-specificity of miRNAs suggests their vital and integral role in various physiological processes. The tissue-enrichment promises a new but less explored role as diagnostic biomarker and potential therapeutic target. Circulating miRNAs are understood to originate from passive leakage from damaged tissue as a result of cell lysis or apoptosis, active transport from cells via microvesicles, such as exosomes, or bound within RISC protein complexes (Etheridge et al, 2011). Exosome and osmotic pump-mediated delivery of small RNA molecules to the brain and CNS, respectively, provides a solution to overcoming the limitations of miRNA-based therapies (Alvarez-Erviti et al., 2011; Koval et al, 2013, Hum. Mol. Gen). miRNA has been demonstrated to be exceptionally stable and thus present as powerful candidates to be potential biomarkers (Chen et al, 2008; Grasso, 2014). Sok Kean Khoo (01-06-2014) assesses miRNA stability and evaluates the potential of previously identified PD-predictive circulating miRNAs as progression biomarkers for PD using MIFF DATATOP biospecimens. Sok Kean Khoo (01-01-2014) identified miRNAs that can discriminate between Parkinson"s disease (PD) patients that progress slowly and rapidly.
[0011] US 2015 / 197809 A1 provides an assay comprising measuring, in a sample obtained from a subject the level of at least one miRNA and determining that the subject is at increased risk of Parkinson's Disease developing or progressing. US 2017 / 145511 A1 describes an assay comprising measuring, in a sample obtained from a subject the level of at least one miRNA and determining that the subject is at increased risk of Parkinson's Disease developing or progressing. US 2013 / 102485 A1 relates to methods of determining mRNA and miRNA associated with a PD state, determining whether a subject has a PD state, and monitoring the subject's disease state progression.SUMMARY OF THE INVENTION
[0012] Disclosed therein but not part of the invention is a method identify miRNAs relevant to patients suffering from Parkinson's disease.
[0013] It is an object of the present invention to provide methods for determining the rate of disease progression for patients suffering from Parkinson's disease.
[0014] Also disclosed therein but not part of the invention are methods for determining treatment option based on the rate of progression of the disease for patients suffering from Parkinson's disease.
[0015] These objects and others are achieved by the present invention, which provides miRNA biomarkers that may be used singly, in pairs or in combination to determine patients suffering from Parkinson's disease.BRIEF DESCRIPTION OF THE DRAWINGS
[0016] Figure 1 shows the mean fold change of five PrognomiRNAs between rapid and slow progressing PD patients. The median values for relative expression of let7b-3p, miR-3613-3p, miR-6865-3p, pre-mir-532 and miR663a are plotted as lines with each box displaying inner quartiles as a measure of distribution with whiskers. Results shown are derived qRT-PCR verification performed in initial 8 rapid and 8 slow progressing PD patients. Separate colored bars are drawn for let7b-3p (blue), miR-3613-3p (orange), miR-6865-3p (green), pre-mir-532 (purple) and miR663a (turquoise). Means for each group are denoted as triangles on the plot. Significance is denoted as *, p < 0.05, **, p < 0.01; ***, p < 0.001.DETAILED DESCRIPTION OF THE INVENTIONMETHODS Serum samples handling and classification
[0017] All patients and controls participated in the Norwegian ParkWest project, which is an ongoing prospective population-based longitudinal cohort study investigating the incidence, neurobiology and prognosis of PD. The Norwegian ParkWest study is a prospective longitudinal multicenter cohort study of patients with incident Parkinson's disease (PD) from Western and Southern Norway. Between November 1st 2004 and 31st of August 2006 it was endeavored to recruit all new cases of Parkinson's Disease within the study area. Since the start of the study 212 of 265 (80 %) of these patients and their age- / sex-matched control group have been followed. Further information about the study can be found at http: / / www.parkvest.no http: / / www.parkvest.no.
[0018] All possible efforts were undertaken to establish an unselected and population-representative cohort of patients with PD. Patients were included if they had provided serum at study entry and fulfilled diagnostic criteria for PD of the National Institute of Neurological Disorders and Stroke (http: / / www.ninds.nih.gov / disorders / parkinsons_disease / parkinsons_disease.ht m) and UK Brain Bank (http: / / www.ncbi.nlm.nih.gov / projects / gap / cgi-bin / GetPdf.cgi?id=phd000042) at latest follow-up. Patients with secondary parkinsonism at study entry were excluded from this study. Control subjects were recruited from multiple sources, including friends, spouses, and public organizations for elderly and were included in this study if they had provided serum. All patients and controls were Caucasian. The participants of the study have been followed for over eight years to establish the rate of disease progression.
[0019] In this study of possible biomarkers for PD we applied a two-stage procedure. For the first discovery phase serum from 8 patients with rapid and 8 patients with slow progression of PD were selected at random. The remaining 164 patients with PD that were eligible for this study were selected for verification purposes.
[0020] Serum samples were collected at the same day as the clinical examinations and then stored frozen at -70 degrees Celsius until transported to the facilities in New York on dry ice.Example 1: Analyses of differentially expressed human miRNA by qPCR RNA Isolation from serum samples and QC
[0021] After thawing on ice, twenty-four (sixteen PD samples) serum samples were spun down for 5 mins at 3000xg to remove debris. The supernatant was used to perform small RNA isolation using miRCURY RNA Isolation Kit - Biofluids (Exiqon, MA). Before RNA Isolation, the lysis buffer was spiked with 0.267fmol / ul of spike-in control cel-miR-39-3p (Qiagen, CA). The remaining part of the RNA isolation was performed following manufacturer's protocol and the isolated RNA was quantified on a Nanodrop 2000 (Thermo Scientific, MA). The RNA was used for running Affymetrix v4 microRNA microarray chips and for subsequent cDNA synthesis and qPCR. RNA from 180 serum samples (from PD patients from ParkWest project) was isolated as described above, they were not quantified by Nanodrop, but the qPCR data resulting from these samples were normalized by a reference small RNA scaRNA17.miRNA microarray and data analysis
[0022] The isolated RNA from twenty-four patient serum samples were quantified and subjected to Affymetrix GeneChip ®< miRNA 4.0 Array by the Yale Center for Genome Analysis (http: / / medicine.yale.edu / keck / ycga / index.aspx). The normalized .CEL files obtained from Affymetrix Expression Console software were imported into Partek Genomics Suite version 6.6 Copyright ©< 2012 (Partek, MO) for analysis. The 'microRNA Expression Workflow' was employed to detect differentially expressed miRNAs employing ANOVA resulting in lists of miRNAs significantly (p<0.05) expressed between rapid and slow PD cohorts. The miRNAs detected were used for further qPCR verification.Quantitative Polymerase Chain Reaction
[0023] cDNA for miRNA specific qPCR was synthesized using qScript ™< microRNA cDNA Synthesis kit (Quanta Biosciences, MD) following manufacturer's protocol and subsequent qPCRs were performed using miRNA specific forward primers (Table#) and PerfeCTa ®< Universal PCR primer (Quanta Biosciences, MD). scaRNA17 and U6 were used reference small RNAs for normalizing qPCR Cq values whereas cel-miR-39-3p was used as spike-in control. PerfeCTa ®< SYBR ®< GREEN SuperMix for IQ ™< (Quanta Biosciences, MD) was used for all qPCRs in a MyiQ ™< Single color Real-Time PCR Detection System (Bio-Rad, CA). Standard curve for cel-miR-39-3p was analyzed in MS Excel with R 2< = 0.97882 and PCR efficiency 92.96%. No Template Control (NTC) was implied wherever needed.
[0024] Differentially expressed human miRNAs in Parkinson's disease patients' serum samples from The Norwegian ParkWest study were determined employing miRNA microarray. Provided below are the miRNAs with >1.2 fold differential expression.52 differentially expressed human pre- and mature miRNAs with >1.2 fold change
[0025] hsa-miR-6865-3p, hsa-miR-663a, hsa-miR-92b-3p, hsa-miR-455-3p, hsa-miR-937-5p, hsa-let-7b-3p, hsa-miR-6730-3p, hsa-miR-5010-3p, hsa-miR-1825, hsa-mir-4487, hsa-miR-4783-5p, hsa-miR-2117, hsa-mir-5090, hsa-mir-4484, hsa-miR-5094, hsa-mir-611, hsa-miR-4738-3p, hsa-miR-6894-5p, hsa-mir-8072, hsa-mir-762, hsa-let-7e, hsa-miR-6768-5p, hsa-mir-3917, hsa-mir-3673, hsa-mir-4431, hsa-miR-216a-3p, hsa-miR-635, hsa-miR-490-3p, hsa-mir-601, hsa-miR-636, hsa-miR-466, hsa-miR-1271-5p, hsa-miR-548u, hsa-miR-3606-5p, hsa-miR-510-5p, hsa-miR-4306, hsa-mir-4753, hsa-mir-6128, hsa-mir-4251, hsa-miR-1306-5p, hsa-miR-8052, hsa-mir-4310, hsa-mir-3128, hsa-miR-628-5p, hsa-miR-3660, hsa-miR-3156-3p, hsa-miR-548aj-3p, hsa-miR-4791, hsa-mir-532, hsa-miR-202-5p, hsa-miR-3613-3p, hsa-miR-8075
[0026] 36 differentially expressed mature miRNAs with >1.2 fold change hsa-miR-6865-3p, hsa-miR-663a, hsa-miR-92b-3p, hsa-miR-455-3p, hsa-miR-937-5p, hsa-let-7b-3p, hsa-miR-6730-3p, hsa-miR-5010-3p, hsa-miR-1825, hsa-miR-4783-5p, hsa-miR-2117, hsa-miR-5094, hsa-miR-4738-3p, hsa-miR-6894-5p, hsa-let-7e, hsa-miR-6768-5p, hsa-miR-216a-3p, hsa-miR-635, hsa-miR-490-3p, hsa-miR-636, hsa-miR-466, hsa-miR-1271-5p, hsa-miR-548u, hsa-miR-3606-5p, hsa-miR-510-5p, hsa-miR-4306, hsa-miR-1306-5p, hsa-miR-8052, hsa-miR-628-5p, hsa-miR-3660, hsa-miR-3156-3p, hsa-miR-548aj-3p, hsa-miR-4791, hsa-miR-202-5p, hsa-miR-3613-3p, hsa-miR-8075
[0027] 16 differentially expressed premature miRNAs with >1.2 fold change hsa-mir-4487, hsa-mir-5090, hsa-mir-4484, hsa-mir-611, hsa-mir-8072, hsa-mir-762, hsa-mir-3917, hsa-mir-3673, hsa-mir-4431, hsa-mir-601, hsa-mir-4753, hsa-mir-6128, hsa-mir-4251, hsa-mir-4310, hsa-mir-3128, hsa-mir-532, These differentially expressed miRNA sequences are illustrated below in Table 1, along with the reference / house-keeping small RNAs cel-miR-39-3p, U6 and ScaRNA17 used as controls. Cel-miR-39-3p is a spike-in control that demonstrates the stability of the RNA samples. U6 and ScaRNA17 are used as internal controls to normalize the readings of the rest of the miRNAs or candidate miRNAs.Example 1
[0028] Table 1 microRNA / small microRNA SequenceRNA name hsa-let-7b-3p CUAUACAACCUACUGCCUUCCC (SEQ ID NO:1)hsa-let-7e hsa-miR-1271-5p CUUGGCACCUAGCAAGCACUCA (SEQ ID NO:3)hsa-miR-1306-5p CCACCUCCCCUGCAAACGUCCA (SEQ ID NO:4)hsa-miR-1825 UCCAGUGCCCUCCUCUCC (SEQ ID NO:5)hsa-miR-202-5p UUCCUAUGCAUAUACUUCUUUG (SEQ ID NO:6)hsa-miR-2117 UGUUCUCUUUGCCAAGGACAG (SEQ ID NO:7)hsa-miR-216a-3p UCACAGUGGUCUCUGGGAUUAU (SEQ ID NO:8)hsa-mir-3128 hsa-miR-3156-3p CUCCCACUUCCAGAUCUUUCU (SEQ ID NO:10)hsa-miR-3606-5p UUAGUGAAGGCUAUUUUAAUU (SEQ ID NO:11)hsa-miR-3613-3p ACAAAAAAAAAAGCCCAACCCUUC (SEQ ID NO:12)hsa-miR-3660 ACUGACAGGAGAGCAUUUUGA (SEQ ID NO:13)hsa-mir-3673 hsa-mir-3917 hsa-mir-4251 hsa-miR-4306 UGGAGAGAAAGGCAGUA (SEQ ID NO:17)hsa-mir-4310 hsa-mir-4431 hsa-mir-4484 hsa-mir-4487 hsa-miR-455-3p GCAGUCCAUGGGCAUAUACAC (SEQ ID NO:22)hsa-miR-466 AUACACAUACACGCAACACACAU (SEQ ID NO:23)hsa-miR-4738-3p UGAAACUGGAGCGCCUGGAGGA (SEQ ID NO:24)hsa-mir-4753 hsa-miR-4783-5p GGCGCGCCCAGCUCCCGGGCU (SEQ ID NO:26)hsa-miR-4791 UGGAUAUGAUGACUGAAA (SEQ ID NO:27)hsa-miR-490-3p CAACCUGGAGGACUCCAUGCUG (SEQ ID NO:28)hsa-miR-5010-3p UUUUGUGUCUCCCAUUCCCCAG (SEQ ID NO:29)hsa-mir-5090 hsa-miR-5094 AAUCAGUGAAUGCCUUGAACCU (SEQ ID NO:31)hsa-miR-510-5p UACUCAGGAGAGUGGCAAUCAC (SEQ ID NO:32)hsa-mir-532 hsa-miR-548aj-3p UAAAAACUGCAAUUACUUUUA (SEQ ID NO:34)hsa-miR-548u CAAAGACUGCAAUUACUUUUGCG (SEQ ID NO:35)hsa-mir-601 hsa-mir-611 hsa-mir-6128 hsa-miR-628-5p AUGCUGACAUAUUUACUAGAGG (SEQ ID NO:39)hsa-miR-635 ACUUGGGCACUGAAACAAUGUCC (SEQ ID NO:40)hsa-miR-636 UGUGCUUGCUCGUCCCGCCCGCA (SEQ ID NO:41)hsa-miR-663a AGGCGGGGCGCCGCGGGACCGC (SEQ ID NO:42)hsa-miR-6730-3p CCUGACACCCCAUCUGCCCUCA (SEQ ID NO:43)hsa-miR-6768-5p CACACAGGAAAAGCGGGGCCCUG (SEQ ID NO:44)hsa-miR-6865-3p ACACCCUCUUUCCCUACCGCC (SEQ ID NO:45)hsa-miR-6894-5p AGGAGGAUGGAGAGCUGGGCCAGA (SEQ ID NO:46)hsa-mir-762 hsa-miR-8052 CGGGACUGUAGAGGGCAUGAGC (SEQ ID NO:48)hsa-mir-8072 hsa-miR-8075 UGCUGAUGGCAGAUGUCGGGUCUG (SEQ ID NO:50)hsa-miR-92b-3p UAUUGCACUCGUCCCGGCCUCC (SEQ ID NO:51)hsa-miR-937-5p GUGAGUCAGGGUGGGGCUGG (SEQ ID NO:52)cel-miR-39-3p UCACCGGGUGUAAAUCAGCUUG (SEQ ID NO:53)scaRNA17 U6 Example 2: Verification of human mature miRNAs by qPCR in sample cohort of 8 rapid and 8 slow progressing patients
[0029] The mean fold change for hsa-let7b-3p, hsa-miR-3613-3p and hsa-miR-6865-3p, hsa-pre-miR-532, and hsa-miR-663a, PrognomiRs between rapid and slow progressing PD patients are shown below in Table 2 and illustrated in Figure 1. Table 2 PrognomiR Fold change Significance hsa-let7b-3p 0.170.02hsa-miR-3613-3p 0.530.01hsa-miR-6865-3p 0.440.002hsa-pre-miR-532 0.430.0005hsa-miR-663a 0.460.01 Example 3
[0030] Measurement of levels of a combination of two or more miRNAs in serum from patients can assist in distinctly differentiating between a potential rapid as opposed to slow progressing PD patient. A serum sample is obtained from blood withdrawn from patients suspected of PD. The serum is used for total microRNA isolation and enrichment. This RNA would then be tested using qPCR to measure the levels of any two or more of the 52 miRNAs mentioned in Example 1, or any one of five miRNAs mentioned in Example 2. Detectable levels of one or more of the aforementioned 52 miRNAs with >1.2 fold change, or any one or more of these five miRNAs confirms the rate of progression for patients with PD. If desired, other sample fluids may be utilized, including plasma, venous or arterial blood, or CSF samples withdrawn by lumbar puncture. Such plasma, blood or CSF samples are processed as discussed above regarding serum, e.g., so as to provide a sample for processing and evaluation outside the human or animal body. It will be understood that measurement of more than two miRNAs in combination or a set of combinations used in a test matrix may desirably increase the accuracy of predicting PD progression. Following diagnosis, the result is then communicated to the patient.
[0031] As discussed and illustrated above, detecting the aforementioned miRNAs with >1.2 fold change may be used to differentiate potential rapid progressing PD from potential slow progressing PD in afflicted patients. However, as readily understood by those of ordinary skill herein, other thresholds may be suitably employed as desired with possible concomitant variation in accuracy, including >1.0, 1.1, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, and 2.0 fold changes. Moreover, it will be similarly understood that these varying fold change thresholds may be more suitably used with particular miRNAs without affecting accuracy.Example 4
[0032] Since a combination of miRNA can be used for predicting prognosis it may be advisable to test all the candidates to eliminate any cohort-based variation. It is understood that any detectable amounts of relevant miRNA will indicate PD pathology. However, those of ordinary skill in the art recognize it may be clinically helpful to use values of slow (8) v rapid (8) samples to set an artificial threshold for determination of rate of disease progression. Differential miRNA levels can be used to develop prognostic biomarker kits that can be used by clinicians for estimating prognosis of the disease as well as enriching patient cohorts in clinical trials. In this study the presence and quantification of miRNA from serum was determined by qRT-PCR which amplifies and quantifies the RNA is question. Other suitable techniques known to those of ordinary skill herein may be alternatively utilized, including use of labeled antisense sequences and labeled antibodies. Suitable antibodies are preferentially selective, referring to a binding reaction between two molecules that is typically more than 10 to 100 times background molecular associations under measurement conditions. Thus, under designated immunoassay conditions, the specified antibodies bind to a particular miRNA sequence, thereby identifying its presence. Specific binding to an antibody under such conditions requires an antibody that is selected for its specificity for a particular miRNA. For example, antibodies raised against a particular miRNA can be selected by subtracting out antibodies that cross-react with other molecules. A variety of immunoassay formats may be used to select antibodies specifically immunoreactive with a particular miRNA including solid-phase ELISA immunoassays (see, e.g., Harlow & Lane, Antibodies, A Laboratory Manual (1988) for a description of immunoassay formats and conditions that can be used to determine specific immunoreactivity). Methods for determining whether two molecules specifically interact are disclosed therein, and methods of determining binding affinity and specificity are well known in the art (see, for example, Harlow and Lane, Antibodies: A laboratory manual (Cold Spring Harbor Laboratory Press, 1988); Friefelder, "Physical Biochemistry: Applications to biochemistry and molecular biology" (W.H. Freeman and Co. 1976)). The term "antibody" as used herein encompasses naturally occurring antibodies as well as non-naturally occurring antibodies, including, for example, single chain antibodies, chimeric, bifunctional and humanized antibodies, as well as antigen-binding fragments thereof, (e.g., Fab', F(ab')2, Fab, Fv and rIgG). See also, Pierce Catalog and Handbook, 1994-1995 (Pierce Chemical Co., Rockford, IL). See also, e.g., Kuby, J., Immunology, 3rd Ed., W.H. Freeman & Co., New York (1998). Such non-naturally occurring antibodies can be constructed using solid phase peptide synthesis, can be produced recombinantly or can be obtained, for example, by screening combinatorial libraries consisting of variable heavy chains and variable light chains as described by Huse et al., Science, Vol. 246 (1989) 1275-81. These and other methods of making, for example, chimeric, humanized, CDR-grafted, single chain, and bifunctional antibodies are well known to those skilled in the art (Winter and Harris, Immunol. Today, Vol. 14 (1993) 243-46; Ward et al., Nature, Vol. 341 (1989) 544-46; Harlow and Lane, supra, 1988; Hilyard et al., Protein Engineering: A practical approach (IRL Press 1992); Borrabeck, Antibody Engineering, 2d ed. (Oxford University Press 1995). Methods for producing both monoclonal and polyclonal antibodies from identified RNA sequences are well known in the art.Example 5
[0033] Many neurodegenerative diseases are closely related to each other when it comes to symptoms as well as pathological markers. The circulating prognostic markers for one neurodegenerative disease can be useful for diagnosis / prognosis of other disease. A method to diagnose / prognoses other neurodegenerative diseases like Dementia with Lewy body (DLB), Amyotrophic lateral sclerosis (ALS), Alzheimer's disease (AD), Multiple system atrophy (MSA), CorticoBasal Degeneration (CBD), Progressive Supranuclear Palsy (PSP) can also be developed using similar miRNA measurements of candidates mentioned above. Disease specific kits can be developed similar to one mentioned in
[0024] with various combinations of miRNAs listed in
[0018] .Example 6
[0034] The miRNAs detected in one or more combinations can regulate several proteins in the cells. Novel protein targets for PD can be discovered using these microRNAs and their combinations. The involvement of these proteins in PD etiology can be further established to target them for therapy.Example 7
[0035] Small nucleic acid molecules derived from miRNAs mentioned in
[0018] will be designed to therapeutically intervene by specifically targeting genes in PD brains to achieve complete or partial remedy.
Claims
1. A method for determining the rate of progression of Parkinson's disease in a human patient, comprising the steps of: in a sample that has been obtained from said human patient, determining the level of expression of a miRNA according to SEQ ID NO: 12 within said sample, wherein said sample is serum, plasma, whole blood or CSF; and correlating the level of expression of the determined miRNA to determine the rate of progression of Parkinson's disease in the patient.
2. The method according to claim 1, wherein the level of expression of said miRNA is determined using qRT-PCR.
3. The method according to claim 1, wherein the level of expression of said miRNA is determined using labeled antisense nucleotide sequences.
4. The method according to claim 1, wherein the level of expression of said miRNA is determined using labeled antibodies.
5. The method according to claim 1, wherein the labeled antibodies are monoclonal.
6. The method according to claim 1, wherein the relative expression of said miRNAs is determined using microarray profiling.
7. The method according to claim 1, wherein the relative expression of said miRNAs is determined using high throughput NGS sequencing.
8. The method according to claim 1, wherein the relative expression of miRNAs according to at least SEQ ID NOS: 12 and 33 is determined.
9. The method according to claim 1, wherein the relative expression of miRNAs according to at least SEQ ID NOS: 12 and 42 is determined.
10. The method according to claim 1, wherein the relative expression of miRNAs according to at least SEQ ID NOS: 12, 33 and 42 is determined.