Methods and materials for using pim1 inhibitors

EP4599063A1Pending Publication Date: 2025-08-13MAYO FOUNDATION FOR MEDICAL EDUCATION & RESEARCH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
EP2023875422
Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-10-07
Filing Date
2023-10-02
Publication Date
2025-08-13

AI Technical Summary

Technical Problem

Current treatments for idiopathic pulmonary fibrosis (IPF) have limited impact on patient mortality and do not effectively reduce the progression of fibrosis, as they minimally address the elevated levels of senescence-associated secretory phenotype (SASP) polypeptides that contribute to the disease progression.

Method used

Administration of PIM1 inhibitors to reduce the levels of SASP polypeptides in fibroblasts, such as lung fibroblasts, by inhibiting PIM1 polypeptide expression or activity, thereby reprogramming the secretome and slowing fibrosis progression.

Benefits of technology

The use of PIM1 inhibitors effectively decreases the production of SASP polypeptides, leading to a significant reduction in fibrosis progression and potential improvement in patient survival and quality of life by targeting the underlying cause of IPF.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000039_0000
    Figure 00000039_0000
  • Figure 00000039_0001
    Figure 00000039_0001
  • Figure 00000039_0002
    Figure 00000039_0002
Patent Text Reader

Abstract

This document provides methods and materials for treating a mammal (e.g., a human) having a disease or disorder condition associated with an elevated level of a plurality of senescence-associated secretory phenotype (SASP) polypeptides (e.g., a fibrotic condition such as idiopathic pulmonary fibrosis (IPF)). For example, one or more proviral integration site for Moloney murine leukemia virus kinase (PIM1) inhibitors can be administered to a mammal (e.g., a human) to reduce a level of a plurality of SASP polypeptides within cell types associated with a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides within the mammal. In some cases, one or more PIM1 inhibitors can be administered to a mammal having a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides (e.g., a fibrotic condition such as IPF) to treat the mammal.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] METHODS AND MATERIALS FOR USING PIM1 INHIBITORS

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This application claims the benefit of U.S. Patent Application Serial No. 63 / 414,311, filed on October 7, 2022. The disclosure of the prior application is considered part of, and is incorporated by reference in, the disclosure of this application.

[0004] SEQUENCE LISTING

[0005] This application contains a Sequence Listing that has been submitted electronically as an XML file named “07039-2172W01_SL.xml.” The XML file, created on September 22, 2023, is 19000 bytes in size. The material in the XML file is hereby incorporated by reference in its entirety.

[0006] TECHNICAL FIELD

[0007] This document relates to methods and materials for treating a mammal (e.g, a human) having a disease or disorder condition associated with an elevated level of a plurality of senescence-associated secretory phenotype (SASP) polypeptides (e.g, a fibrotic condition such as idiopathic pulmonary fibrosis (IPF)). For example, one or more proviral integration site for Moloney murine leukemia virus kinase (PIM1) inhibitors can be administered to a mammal (e.g., a human) to reduce a level of a plurality of SASP polypeptides within a cell type associated with a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides within the mammal. In some cases, one or more PIM1 inhibitors can be administered to a mammal having a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides (e.g., a fibrotic condition such as IPF) to treat the mammal.

[0008] BACKGROUND INFORMATION

[0009] The onset of senescence burden can contribute to fibrosis progression (Nemeth et al., Front. Med-Lausanne, 7:2020; Liu et al., Experimental Gerontology, 132:2020; Merkt et al., Semin. Cell. Dev. Biol., 101 : 104-110 (2020); Hohmann et al., Am. J. Respir. Cell. Mol. Biol., 60:28-40 (2019); Schafer et al., Nat. Commun., 8: 14532 (2017); and Lin et al., Front. Cell. Dev. Biol., 8:593283 (2020)).

[0010] IPF is the most common interstitial lung disease (King et al., Lancet, 378:1949-1961 (2011)), with an annual incidence in North America and Europe of approximately 3-9 per 100,000 (Hutchinson et al., Eur. Respir. J., 46:795-806 (2015)) and a median survival rate of 2-4 years (Khor et al., Eur. Respir. Rev., 29:2020; and Ley et al., Am. J. Respir. Crit. Care Med., 183:431-440 (2011)). There are currently two FDA-approved therapies for IPF: nintedanib and pirfenidone (Glassberg et al., Am. J. Manag. Care, 25:S 195-S203 (2019)). While these therapies can slow IPF progression, they have minimal impact on patient mortality (Richeldi et al., Lancet, 389: 1941-1952 (2017); and Valenzuela et al., Respir. Res., 21 :7 (2020)).

[0011] SUMMARY

[0012] This document provides methods and materials for treating a mammal (e.g., a human) having a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides (e.g., a fibrotic condition such as IPF). For example, one or more PIM1 inhibitors can be administered to a mammal (e.g., a human) to reduce a level of a plurality of SASP polypeptides within a cell type associated with a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides within the mammal (e.g., within fibroblasts of the mammal). In some cases, one or more PIM1 inhibitors can be administered to a mammal having a disease or disorder condition associated an elevated level of a plurality of SASP polypeptides (e.g., a fibrotic condition such as IPF) to treat the mammal.

[0013] As demonstrated herein, PIM1 polypeptides can induce secretion of SASP polypeptides in fibroblasts (e.g., lung fibroblasts) to induce cellular senescence (e.g., premature senescence) in those fibroblasts. Also as demonstrated herein, one or more PIM1 inhibitors can reprogram the secretome of senescent fibroblasts to reduce the production of SASP polypeptides and slow the progression of fibrosis in those fibroblasts. Having the ability to reduce a level of a plurality of SASP polypeptides within a mammal as described herein (e.g., by administering one or more PIM1 inhibitors) provides a unique and unrealized opportunity to slow the progression of fibrosis within cell types associated with a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides within a mammal (e.g., a human) such as a mammal having a fibrotic condition such as IPF.

[0014] In general, one aspect of this document features methods for reducing a level of each of a plurality of SASP polypeptides expressed by a cell type present within a mammal. The methods can include, or consist essentially of, (a) identifying a mammal as having the presence of a cell type associated with a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides, (b) identifying the cell type as expressing the plurality of SASP polypeptides, and (c) administering a PIM1 inhibitor to the mammal, thereby reducing a level of each of the plurality of SASP polypeptides expressed by the cell type. The mammal can be a human. The mammal can be identified as having fibrosis. The mammal can be identified as having IPF. The plurality of SASP polypeptides can include at least two polypeptides selected from an interleukin (IL)-6 polypeptide, a chemokine (C-C motif) ligand 2 (CCL2) polypeptide, an IL 10 polypeptide, an IL 16 polypeptide, a C-X-C motif chemokine ligand 2 (CXCL2) polypeptide, an IL 13 polypeptide, a CXCL16 polypeptide, a bone morphogenetic protein 4 (BMP4) polypeptide, a CXCL12 polypeptide, a CX3CL1 polypeptide, a TNF superfamily member 13b (TNFSF13B) polypeptide, a CXCL1 polypeptide, a CXCL8 polypeptide, a TNFSF11 polypeptide, a CCL1 polypeptide, a transforming growth factor beta 2 (TGFB2) polypeptide, a CCL11 polypeptide, a CCL13 polypeptide, a TNFSF10 polypeptide, a CXCL10 polypeptide, and a CCL2 polypeptide. The cell type can be a fibroblast cell type. The cell type can be a lung fibroblast cell type. The PIM1 inhibitor can inhibit PIM1 polypeptide expression. The PIM1 inhibitor can be a nucleic acid molecule designed to induce RNA interference of the PIM1 polypeptide expression. The PIM1 inhibitor can inhibit PIM1 polypeptide activity. The PIM1 inhibitor can be TCS, SMI- 4a, AZDI 208, epigallocatechin gallate (EGCG), quercetin, fisetin, luteolin, quercetagetin, TP-3654, or SMI- 16a. The method can include detecting a reduction in a level of each of the plurality of SASP polypeptides expressed by the cell type following the administering step. In some cases, the PIM1 inhibitor can be selected from the group consisting of LGH447, TP- 3654, Uzansertib, ETP-339, IBL-100, and LGB-321. In some cases, the PIM1 inhibitor can be selected from the group consisting of BLX-0676, IBL-202, IBL-101, SAR-413792, and RF-1302. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described herein can be used to practice the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

[0015] The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims.

[0016] DESCRIPTION OF THE DRAWINGS

[0017] Figures 1 A - 1C. A PIM1 polypeptide regulates phosphorylation and activity of p65 / RelA. Figure 1 A. Non-IPF adult lung fibroblasts were transfected with non-targeting (NT) siRNA or siRNA targeting PIM1 for 72 hours. 15 minutes prior to collecting total cell protein for western blot analysis the indicated wells were stimulated with 50 ng / mL TNF-a. A representative image is shown, and band density for three independent experiments was quantified (* p < 0.05, ** p < 0.01 vs. the indicated group). Figure IB. Non-IPF adult lung fibroblasts were transfected with NT siRNA or siRNA targeting PIM1 for 72 hours. 6 hours prior to collecting RNA for qPCR analysis the indicated wells were stimulated with 50 ng / mL TNF-a. N=3 independent experiments (** p < 0.01, *** p < 0.001, ***** p < 0.0001 vs. the indicated group). Figure 1C. Non-IPF adult lung fibroblasts were treated for 3 hours with the PIM1 inhibitor TCS PIM1 1 (TCS; 3 pM), and 15 minutes prior to collecting total cell protein for western blot analysis the indicated wells were stimulated with 50 ng / mL TNF-a. A representative image is shown, and band density for three independent experiments was quantified (** / ? < 0.01, *** p < 0.001 vs. the indicated group).

[0018] Figures 2A - 2C. Senescent IPF patient-derived lung fibroblasts express spontaneously elevated PIM1 and p65 / Rel phosphorylation. Figure 2A. Lung fibroblasts from non-IPF or IPF donors were cultured for 24 hours in the absence of serum prior to total cell protein isolation and western Blot analysis. N=3 non-IPF and 4 IPF biologically independent samples (** / ? < 0.01 vs. non-IPF). Figure 2B. Lung fibroblasts from non-IPF or IPF donors were cultured for 24 hours in the absence of serum prior to RNA isolation and qPCR analysis. RNA transcript levels were quantified relative to the same representative non-IPF sample, using GAPDH as a housekeeping gene. N=4 non-IPF and 7 IPF biologically independent samples (* p < 0.05, ** p < 0.01 vs. non-IPF). Figure 2C. Lung fibroblasts from non-IPF or IPF donors were stained for SA-P-gal staining as a marker of cellular senescence. Representative examples for non-IPF and IPF are shown.

[0019] Figures 3 A - 3D. PIM1 / NF-KB and IL6 / JAK2 / STAT3 form a positive feedback loop. Figure 3A. IPF patient-derived lung fibroblasts were cultured for 24 hours in the presence of an IL6 neutralizing antibody (IL6 Nab, 10 pg / mL), a JAK2 inhibitor (AZD 1480, 10 pM), or a STAT3 inhibitor (LLL12, 1 pM) prior to RNA isolation and qPCR analysis. RNA transcript levels were quantified relative to the same representative NT sample, using GAPDH as a housekeeping gene. N=3 biologically independent and experimentally independent experiments (** p < 0.01 vs. the control treated groups). Figure 3B. IPF patient- derive lung fibroblasts were transfected with NT siRNA or siRNA targeting PIM1 for 72 hours prior to collecting whole cell protein for western blot analysis. Representative images are shown, and band density for three independent experiments was quantified (** p < 0.01 vs. the NT control group). Figure 3C. IPF patient-derived lung fibroblasts were transfected with NT siRNA or siRNA targeting PIM1 and cultured for 72 hours prior to collecting RNA for qPCR analysis. RNA transcript levels were quantified relative to the same representative NT sample, using GAPDH as a housekeeping gene. N=3 independent experiments (** p < 0.01, *** p < 0.001, ***** p < 0.0001 vs. the indicated group). Figure 3D. An exemplary positive feedback model. PIM1 phosphorylates p65 / RelA, supporting NF-KB transcriptional activity which stimulates IL6 synthesis. IL6 signals though its receptor system and JAK2 / STAT3 to transcribe PIMP

[0020] Figures 4A - 4B. PIM1 can regulate expression of a broad range of cytokines and chemokines. Figure 4A. IPF patient-derived lung fibroblasts were treated for 24 hours with PIM1 inhibitor (TCS, 3pM). RNA was isolated and a PCR profiler measuring expression of 84 cytokines and chemokines was performed, amplifying the cDNA 40 cycles, detecting 49 genes. RNA transcript levels were calculated and plotted to a heatmap by normalizing all samples relative to the average delta Ct for the two control treated samples, using GAPDH as a housekeeping gene. Genes were ranked by the average change in the two TCS treated samples. Figure 4B. IPF patient-derived lung fibroblasts were cultured for 24 hours with PIM1 inhibitor (TCS, 3pM) prior to RNA isolation and qPCR analysis. RNA transcript levels in the TCS treated group were quantified relative to their respective control, using GAPDH as a housekeeping gene. N=3 biologically independent and experimentally independent experiments (** / ? < 0.01, *** p < 0.001, **** p < 0.0001 vs. the control treated groups).

[0021] Figures 5 A - 5C. PIM1 can regulate secretion of GRO, IL6, MCP-1 and MCP-3. IPF patient-derived lung fibroblasts were treated for 24 hours with PIM1 inhibitor (TCS, 3 pM) in media without fetal bovine serum (FBS). After incubation, conditioned media was collected and assessed by a cytokine immuno-array. Figure 5A. Representative images of the cytokine array from control and TCS treated samples. + / - controls labeled along with the 6 cytokines exhibiting the strongest signal intensity. Figure 5B. Raw signal intensity - background quantified for all cytokines included in the array. N=3 biological and experimentally independent experiments. Figure 5C. Signal intensity for each cytokine was normalized relative to the same DMSO-treated, representative sample. N=3 biologically and experimentally independent experiments (* p < 0.05, ** p < 0.01 vs. DMSO treated groups).

[0022] Figures 6A - 6F. PIM1 can promote lung fibroblast premature senescence. Figure 6A. Non-IPF adult lung fibroblasts were infected with control lentiviral vector or lentiviral vector carrying the human PIM1 gene. Total protein was isolated in three independent western blot experiments. Representative images are shown, and band density was quantified (** p < 0.01 vs. the lenti-control group). Figure 6B. Lenti-control and lenti-PIMl expressing cells were treated for 3 hours or 24 hours with 3uM TCS prior to total protein isolation and western blot analysis. Representative images are shown, and band density for three independent experiments was quantified (** p < 0.01, *** p < 0.01 vs. the indicated group). Figures 6C and 6E. qPCR analysis from three independent experiments comparing gene expression between lenti-control and lenti-PIMl fibroblasts (* p < 0.05, ** p < 0.01, *** p < 0.01 vs. the lenti-control group). Figure 6D. Lenti-control and lenti-PIMl expressing fibroblasts were cultured for 0 and 4 days and then stained for DAPI and quantified using automated imaging software. Representative images are shown for the number of DAPI objects (nuclei) on day 4. Quantification of three independent experiments plots the number of cells in each field of view, for each cell line, relative to the number of cells in each field of view immediately after the cells attached (day 0) (** p < 0.01 vs. the lenti-control group). Scale bar represents 200 pm. Figure 6F. SA-0-gal staining comparing lenti-control vs. lenti-PIMl lung fibroblasts as the progress through cell culture passages 4-8. Representative images comparing fibroblasts at passage 8. Data were automated quantification of SA-P-gal positive cells relative to the total number of cells in each field of view from three independent experiments (** p < 0.01, **** p < 0.0001 vs. the lenti-control group). Scale bar represents 100 pm.

[0023] Figure 7. Non-IPF adult lung fibroblasts were transfected with NT siRNA or siRNA targeting PIMP RNA was collected for qPCR analyses. N=3 independent experiments (*** p < 0.001 vs. NT siRNA).

[0024] Figure 8. Correlation comparisons between PIM1 and senescence associated genes. Lung fibroblasts from non-IPF or IPF donors were cultured for 24 hours in the absence of serum prior to RNA isolation and qPCR analysis. RNA transcript levels were quantified relative to the same representative non-IPF sample, using GAPDH as a housekeeping gene. N=4 non-IPF and 7 IPF biologically independent samples. These are the same data shown in Fig. 2B, set as XY correlations between two genes. Lighter gray datapoints are non-IPF and darker gray datapoints are IPF-patient derived.

[0025] Figures 9A - 9C. TCS is non-cytotoxic at concentrations used in these studies. Figure 9 A. IPF patient-derived lung fibroblasts were treated for 24 hours with TCS (3pM) or staurosporine (Staur, 1 pM (positive control for apoptosis)) prior to staining with a LIVE / DEAD assay. Representative images are shown. Figure 9B. Quantification of the cells / field of view observed using a 10X objective. N=3 biologically independent samples. Figure 9C. Dose-response curves up to 100 pM for TCS.

[0026] Figures 10A - 10B. Selectivity of three previously established PIM kinase inhibitors. IPF patient-derived lung fibroblasts were cultured for 24 hours with PIM1 inhibitor (TCS - 3 pM, SMI-4a (SMI) - 10 pM, or the pan-PIM kinase inhibitor: AZD1208 (AZD) - 10 pM) for 24 hours prior to RNA isolation and qPCR analysis. RNA transcript levels were quantified relative to the DMSO treated control, using GAPDH as a housekeeping gene. N=4 biologically independent and experimentally independent experiments (**** p < 0.0001 vs. the control group). Figure 10B. IPF patient-derive lung fibroblasts were transfected with NT siRNA or siRNA targeting PIM3 and cultured for 24 hours prior to collecting RNA for qPCR analysis. RNA transcript levels are quantified relative to their NT control, using GAPDH as a housekeeping gene. N=3 independent experiments (***** p < 0.0001 vs. the indicated group).

[0027] Figures 11 A-B. Ex vivo treatment with a Pirn kinase inhibitor reduces expression of IL-6 and CCL2 in lung slices from aged mice. Figure 11 A. Experimental design: lungs from 2-month-old (young) and 22-month-old (aged) mice were collected, inflated with gelatin, and sliced using a vibratome to generate 300 pm thick “precision cut lung slices.” Lung slices were then cultured for 72 hours ex vivo without or without 3 pM TCS PIM-1 1 (TCS).

[0028] Figure 1 IB. Lung slice RNA was then collected, and qPCR analysis performed. mRNA expression is calculated relative to the housekeeping gene Gush. N=3.

[0029] Figure 12A-B. Clinically tested Pirn kinase inhibitors reduce expression of age- related inflammation associated soluble factors in senescent adult lung fibroblasts. Figure 12A. Published pharmacological characteristics of two clinically tested Pirn kinase inhibitors. TP-3654 and LGH447 inhibit Piml, Pim2, and Pim3. Figure 12B. Human adult lung fibroblasts were passaged 20 times in culture to replicative senescence. The fibroblasts were then incubated with or without the indicated concentration with Pirn kinase inhibitors. After 24 hours, RNA was isolated, and qPCR was performed. mRNA expression is calculated relative to the housekeeping gene Gusb. N=3.

[0030] Figure 13A-C. Pirn kinase inhibitor reduces markers of age-related inflammation from multiple organs. Figure 13A. Experimental design: 2-month-old (young) and 22- month-old (aged) mice were treated for 5-days, once daily orally delivered LGH447 (30 mg / kg). Figure 13B. Whole organ RNA was collected, and qPCR analysis was performed. mRNA expression is calculated relative to the housekeeping gene Gusb. N=4 for young mice, and N=8 for aged mice. Figure 13C. Expression of a senescence associated marker CDKN2A (p 16) and Piml, Pim2, and Pim3 was compared in aged organs vs. young organs. mRNA expression is calculated relative to the housekeeping gene Gusb. N=4 for young mice, and N=8 for aged mice.

[0031] DETAILED DESCRIPTION

[0032] This document provides methods and materials for treating a mammal (e.g., a human) having a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides e.g., a fibrotic condition such as IPF). For example, one or more PIM1 inhibitors can be administered to a mammal (e.g, a human) to reduce a level of a plurality of polypeptides within a cell type associated with a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides within the mammal (e.g, within fibroblasts of the mammal). In some cases, one or more PIM1 inhibitors can be administered to a mammal having a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides (e.g, a fibrotic condition such as IPF) to treat the mammal.

[0033] The term “elevated level” as used herein with respect to a level of a SASP polypeptide in a mammal refers to any level that is higher than a reference level of that SASP polypeptide. The term “reference level” as used herein with respect to a level of a SASP polypeptide refers to the level of the polypeptide (or mRNA) typically observed in a control sample. Control samples are samples obtained from humans that do not have a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides (e.g., a fibrotic condition such as IPF) such as young, healthy humans. Examples of SASP polypeptides that can be elevated within a cell type associated with a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides include, without limitation, IL6 polypeptides, CCL2 polypeptides, IL 10 polypeptides, IL 16 polypeptides, CXCL2 polypeptides, IL 13 polypeptides, CXCL16 polypeptides, BMP4 polypeptides, CXCL12 polypeptides, CX3CL1 polypeptides, TNFSF13B polypeptides, CXCL1 polypeptides, CXCL8 polypeptides, TNFSF11 polypeptides, CCL1 polypeptides, TGFB2 polypeptides, CCL11 polypeptides, CCL13 polypeptides, TNFSF10 polypeptides, CXCL10 polypeptides, and CCL2 polypeptides.

[0034] In some cases, one or more PIM1 inhibitors can be administered to a mammal (e.g, a human) to reduce a level of a plurality of SASP polypeptides within a cell type associated with a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides within the mammal (e.g., within fibroblasts of the mammal). For example, one or more PIM1 inhibitors can be administered to a mammal (e.g., a human) in need thereof (e.g, a human having a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides (e.g., a fibrotic condition such as IPF) to reduce a level of a plurality of SASP polypeptides within a cell type associated with a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides within the mammal. Examples of SASP polypeptides that can be reduced within a cell type associated with a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides within the mammal by administering one or more PIM1 inhibitors include, without limitation, IL6 polypeptides, CCL2 polypeptides, IL 10 polypeptides, IL 16 polypeptides, CXCL2 polypeptides, IL 13 polypeptides, CXCL16 polypeptides, BMP4 polypeptides, CXCL12 polypeptides, CX3CL1 polypeptides, TNFSF13B polypeptides, CXCL1 polypeptides, CXCL8 polypeptides, TNFSF11 polypeptides, CCL1 polypeptides, TGFB2 polypeptides, CCL11 polypeptides, CCL13 polypeptides, TNFSF10 polypeptides, CXCL10 polypeptides, and CCL2 polypeptides. One or more PIM1 inhibitors can be used to reduce a level of a plurality of SASP polypeptides within any appropriate type of cell within a mammal. Examples of types of cells that one or more PIM1 inhibitors can be used to reduce a level of a plurality of SASP polypeptides within include, without limitation, fibroblasts (e.g., lung fibroblasts), endothelial cells, epithelial cells, leukocytes, adipocytes, osteoblasts, osteoclasts, glial cells, astrocytes, neurons, and keratinocytes. The term “reduced level” as used herein with respect to a level of a SASP polypeptide in a mammal refers to any level that is lower than the level of that SASP polypeptide observed in that mammal prior to being treated as described herein (e.g., by administering one or more PIM1 inhibitors). In some cases, a reduced level of a SASP polypeptide can be a level that is at least 5 percent (e.g., at least 10, at least 15, at least 20, at least 25, at least 35, at least 50, at least 75, at least 100, or at least 150 percent) lower than the level of that SASP polypeptide prior to being treated as described herein. In some cases, a reduced level of a SASP polypeptide can be a level that is at least 1.5 fold (e.g., about 1.5 fold, about 2 fold, about 2.5 fold, about 3 fold, about 3.5 fold, about 4 fold, about 5 fold, about 6 fold, or more) less than the level of that SASP polypeptide prior to being treated as described herein. It will be appreciated that levels from comparable samples are used when determining whether or not a particular level is a reduced level.

[0035] In some cases, one or more PIM1 inhibitors can be administered to a mammal (e.g., a human) in need thereof (e.g., a human having a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides (e.g., a fibrotic condition such as IPF)) to reduce a level of a plurality of inflammatory cytokines within a cell type associated with a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides within the mammal (e.g., within fibroblasts of the mammal). In some cases, an inflammatory cytokine that can be reduced within a cell type associated with a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides within a mammal having a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides (e.g, a fibrotic condition such as IPF) after one or more PIM1 inhibitors were administered to the mammal can be a chemokine. In some cases, an inflammatory cytokine that can be reduced in a mammal having a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides (e.g, a fibrotic condition such as IPF) after one or more PIM1 inhibitors were administered to the mammal can be an interleukin. Examples of inflammatory cytokines that can be reduced in a mammal having a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides (e.g, a fibrotic condition such as IPF) as described herein (e.g., by administering one or more PIM1 inhibitors) include, without limitation, IL1 polypeptides, IL6 polypeptides, IL12 polypeptides, IL18 polypeptides, tumor necrosis factor alpha (TNF-a) polypeptides, interferon gamma (IFNy) polypeptides, granulocytemacrophage colony stimulating factor (GM-CSF) polypeptides, CCL2 polypeptides, IL10, IL 16 polypeptides, CXCL2 polypeptides, IL 13 polypeptides, CXCL16 polypeptides, BMP4 polypeptides, CXCL12 polypeptides, CX3CL1 polypeptides, TNFSF13B polypeptides, CXCL1 polypeptides, CXCL8 polypeptides, TNFSF11 polypeptides, CCL1 polypeptides, TGFB2 polypeptides, CCL11 polypeptides, CCL13 polypeptides, TNFSF10 polypeptides, CXCL10 polypeptides, and CCL2 polypeptides. For example, one or more PIM1 inhibitors can be administered to a mammal having a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides (e.g., a fibrotic condition such as IPF) to reduce the level of one or more inflammatory cytokines within a cell type associated with a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides within the mammal (e.g., within fibroblasts of the mammal) by, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or more percent. For example, one or more PIM1 inhibitors can be administered to a mammal having a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides (e.g., a fibrotic condition such as IPF) to reduce the level of a plurality of inflammatory cytokines within a cell type associated with a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides within the mammal (e.g., within fibroblasts of the mammal) by, for example, at least 1.5 fold (e.g, about 1.5 fold, about 2 fold, about 2.5 fold, about 3 fold, about 3.5 fold, about 4 fold, about 5 fold, about 6 fold, or more).

[0036] In some cases, one or more (e.g., one, two, three, four, or more) PIM1 inhibitors can be used to induce apoptosis of cells (e.g, senescent cells) within a mammal (e.g, a mammal such as a human having a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides (e.g, a fibrotic condition such as IPF)). For example, one or more PIM1 inhibitors can be administered to a mammal (e.g, a human) in need thereof (e.g., a human having a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides (e.g, a fibrotic condition such as IPF)) to induce apoptosis in senescent cells within the mammal. One or more PIM1 inhibitors can be used to induce apoptosis in any appropriate type of senescent cell within a mammal. Examples of types of cells that can be senescent and that one or more PIM1 inhibitors can be used to induce apoptosis in include, without limitation, fibroblasts (e.g, lung fibroblasts), endothelial cells, epithelial cells, leukocytes, adipocytes, osteoblasts, osteoclasts, glial cells, astrocytes, neurons, and keratinocytes. For example, one or more PIM1 inhibitors can be used to reduce the number of senescent cells within a mammal. In some cases, one or more PIM1 inhibitors can be administered to a mammal (e.g., a human) in need thereof (e.g, a human having a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides (e.g., a fibrotic condition such as IPF)) to reduce the number senescent cells within the mammal. In some cases, one or more (e.g., one, two, three, four, or more) PIM1 inhibitors can be effective to reduce the number of senescent cells within a mammal having a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides (e.g., a fibrotic condition such as IPF) by, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or more percent. In some cases, one or more (e.g., one, two, three, four, or more) PIM1 inhibitors can be effective to reduce the number of senescent cells within a mammal having a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides (e.g., a fibrotic condition such as IPF) by, for example, at least 1.5 fold (e.g., about 1.5 fold, about 2 fold, about 2.5 fold, about 3 fold, about 3.5 fold, about 4 fold, about 5 fold, about 6 fold, or more).

[0037] In some cases, one or more (e.g., one, two, three, four, or more) PIM1 inhibitors can be used to reduce of one or more symptoms of a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides (e.g, a fibrotic condition such as IPF). For example, one or more PIM1 inhibitors can be administered to a mammal (e.g, a human) in need thereof (e.g., a human having a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides (e.g, a fibrotic condition such as IPF)) to reduce one or more symptoms of the disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides (e.g, a fibrotic condition such as IPF). Examples of symptoms of IPF disease include, without limitation, shortness of breath (dyspnea), persistent dry cough, tiredness, loss of appetite and weight loss, aching muscles and joints, and clubbing, which is widening and rounding of the tips of the fingers or toes. In some cases, one or more PIM1 inhibitors can be used to reduce one or more symptoms of a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides (e.g., a fibrotic condition such as IPF) in a mammal having the disease or disorder by, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or more percent. In some cases, one or more PIM1 inhibitors can be used to reduce one or more symptoms of a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides (e.g., a fibrotic condition such as IPF) in a mammal having the disease or disorder by, for example, at least 1.5 fold (e.g, about 1.5 fold, about 2 fold, about 2.5 fold, about 3 fold, about 3.5 fold, about 4 fold, about 5 fold, about 6 fold, or more).

[0038] In some cases, one or more (e.g., one, two, three, four, or more) PIM1 inhibitors can be used to reduce one or more complications associated with a fibrotic condition. For example, one or more PIM1 inhibitors can be administered to a mammal (e.g., a human) in need thereof (e.g, a human having a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides (e.g., a fibrotic condition such as IPF)) to reduce one or more complications associated with the fibrotic condition. Examples of complications associated with IPF include, without limitation, pulmonary hypertension, acute exacerbation of pulmonary fibrosis, respiratory infection, acute coronary syndrome, thromboembolic disease, adverse medication effects, and lung cancer. In some cases, one or more PIM1 inhibitors can be used to reduce one or more complications associated with a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides (e.g., a fibrotic condition such as IPF) in a mammal having the disease or disorder by, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or more percent. In some cases, one or more PIM1 inhibitors can be used to reduce one or more complications associated with a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides (e.g., a fibrotic condition such as IPF) in a mammal having the disease or disorder by, for example, at least 1.5 fold (e.g, about 1.5 fold, about 2 fold, about 2.5 fold, about 3 fold, about 3.5 fold, about 4 fold, about 5 fold, about 6 fold, or more).

[0039] In some cases, one or more (e.g, one, two, three, four, or more) PIM1 inhibitors can be used to slow the progression of fibrosis in a mammal (e.g, a mammal such as a human having a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides (e.g, a fibrotic condition such as IPF)). For example, one or more PIM1 inhibitors can be administered to a mammal (e.g, a human) in need thereof (e.g, a human having a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides (e.g, a fibrotic condition such as IPF)) to slow the progression of fibrosis in the mammal. One or more PIM1 inhibitors can be used to slow the progression of fibrosis in any appropriate tissue within a mammal. Examples of tissues that can be fibrotic and where the progression of fibrosis can be slowed by one or more PIM1 inhibitors include, without limitation, lung, liver, bile ducts, renal tissue, skin, central nervous system (CNS) arthritic tissue, macular tissue (e.g., macular tissue in a mammal having macular degeneration), and cardiovascular tissue. In some cases, one or more PIM1 inhibitors can be effective to slow the progression of fibrosis in a mammal having fibrosis by, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or more percent. In some cases, one or more PIM1 inhibitors can be used to slow the progression of fibrosis in a mammal having fibrosis by, for example, at least 6 months (e.g., about 6 months, about 8 months, about 10 months, about 1 year, about 1.5 years, about 2 years, about 2.5 years, about 3 years, about 4 years, about 5 years, or more).

[0040] In some cases, one or more (e.g., one, two, three, four, or more) PIM1 inhibitors can be used to increase the survival of a mammal (e.g., a mammal such as a human having a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides (e.g., a fibrotic condition such as IPF)). For example, a composition containing one or more PIM1 inhibitors can be administered to a mammal (e.g., a human) in need thereof (e.g., a human having a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides (e.g., a fibrotic condition such as IPF)) to increase the survival of the mammal. In some cases, one or more PIM1 inhibitors can be used to increase the survival of a mammal having a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides (e.g, a fibrotic condition such as IPF) by, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or more percent.

[0041] In some cases, one or more (e.g, one, two, three, four, or more) PIM1 inhibitors can be used to reduce inflammation in one or more tissues within a mammal (e.g, a mammal such as a human having a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides (e.g., a fibrotic condition such as IPF)). For example, one or more PIM1 inhibitors can be administered to a mammal (e.g., a human) in need thereof (e.g, a human having a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides (e.g., a fibrotic condition such as IPF)) to reduce inflammation in one or more tissues within the mammal. One or more PIM1 inhibitors can be used to reduce inflammation in any appropriate tissue within a mammal. Examples of tissues that can be inflamed and where inflammation can be reduced by one or more PIM1 inhibitors include, without limitation, lung, liver, bile ducts, renal tissue, skin, CNS tissue, arthritic tissue, macular tissue (e.g., macular tissue in a mammal having macular degeneration), and cardiovascular tissue. In some cases, one or more PIM1 inhibitors can be used to reduce inflammation in one or more tissues within a mammal having a fibrotic condition (e.g., IPF) by, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or more percent.

[0042] Any appropriate mammal (e.g., a mammal such as a human having a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides (e.g., a fibrotic condition such as IPF)) can be treated as described herein (e.g, by administering one or more PIM1 inhibitors). In some cases, a mammal in need of reducing a level of a plurality of SASP polypeptides within a cell type associated with a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides within the mammal can be treated by administering one or more PIM1 inhibitors. For example, a mammal having a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides (e.g., a fibrotic condition such as IPF) can be treated by administering one or more PIM1 inhibitors. Examples of mammals that can be treated as described herein include, without limitation, humans, non-human primates (e.g, monkeys), dogs, cats, horses, cows, pigs, sheep, mice, and rats. In some cases, a human having a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides (e.g., a fibrotic condition such as IPF) can be treated by administering PIM1 inhibitors as described herein.

[0043] When treating a mammal (e.g., a human) having a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides as described herein, the mammal can have any type of disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides. In some cases, a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides can be an age-related disease. In some cases, a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides can be a fibrotic condition. Examples of diseases and disorder conditions associated with an elevated level of a plurality of SASP polypeptides that can treated as described herein (e.g., by administering one or more PIM1 inhibitors) include, without limitation, pulmonary fibrosis (e.g., IPF), aged-related CNS disorders, arthritis, macular degeneration, and cardiovascular disease.

[0044] In some cases, the methods described herein can include identifying a mammal (e.g., a human) as having elevated levels of a plurality of SASP polypeptides within a particular cell type. Any appropriate method can be used to identify a mammal as having elevated levels of a plurality of SASP polypeptides within a particular cell type (e.g., fibroblasts such as lung fibroblasts). For example, blood tests, bronchial alveolar lavage, skin collection, urinalysis, and / or exhaled breath condensate can be used to identify mammals (e.g, humans) as having elevated levels of a plurality of SASP polypeptides within a particular cell type (e.g, fibroblasts such as lung fibroblasts).

[0045] In some cases, the methods described herein can include identifying a mammal (e.g., a human) as having a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides (e.g., a fibrotic condition such as IPF). Any appropriate method can be used to identify a mammal as having a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides (e.g, a fibrotic condition such as IPF). For example, high-resolution computed tomography (HRCT), blood test, and / or lung function tests can be used to identify mammals (e.g., humans) as having a fibrotic condition (e.g., IPF). A mammal (e.g., a mammal such as a human having a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides e.g., a fibrotic condition such as IPF)) can be administered or instructed to self-administer any appropriate one or more (e.g., one, two, three, four, or more) PIM1 inhibitors. In some cases, a PIM1 inhibitor can be specific to PIM1 (e.g., does not inhibit other PIMs such as PIM2 and PIM3, or can selectively inhibit PIM1 over PIM2 and PIM3). In some cases, a PIM1 inhibitor can be a pan-PIM kinase inhibitor (e.g., can also inhibit PIM2 and / or PIM3). A PIM1 inhibitor can inhibit PIM1 polypeptide activity or can inhibit PIM1 polypeptide expression. Examples of compounds that can inhibit PIM1 polypeptide activity include, without limitation, antibodies (e.g., neutralizing antibodies) that target (e.g., target and bind) to a PIM1 polypeptide, and small molecules that target (e.g., target and bind) to a PIM1 polypeptide. Examples of compounds that can inhibit of PIM1 polypeptide expression include, without limitation, nucleic acid molecules designed to induce RNA interference of polypeptide expression of a PIM1 polypeptide (e.g., a siRNA molecule a shRNA molecule), antisense molecules, miRNAs, and nucleic acid molecules designed to induce CRISPR interference (CRISPRi) of PIM1 polypeptide expression (e.g., a guide RNA (gRNA) molecule complexed with a Cas9 polypeptide such as catalytically dead Cas9 polypeptide (see, e.g., Saifaldeen et al., Cells, 9:2518 (2020) at, for example, Figure 1, Figure 2, and Table 1)). Examples of PIM1 inhibitors that can be administered to mammal (e.g., a human) as described herein include, without limitation, TCS (also referred to as TCS PIM-1 1; CAS No.: 491871-58-0), SMI-4a (CAS No.: 438190-29-5), AZD1208 (CAS No.: 1204144-28-4), EGCG (Epigallocatechin Gallate), quercetin, fisetin, luteolin, quercetagetin, TP-3654 (CAS No.: 1361951-15-6), SMI-16a (CAS No.: 587852-28-6), LGH447 (also referred to as PIM447; CAS No. 1210608-43-7), TP-3654 (CAS No.: 1361951-15-6), Uzansertib (CAS No.: 1620012-39-6), BLX-0676, ETP-339 (4-[6-[(4-fluorophenyl)methylamino]imidazo[2,3- f]pyridazin-3-yl]phenol; also referred to as IBL-302 and AUM-302), IBL-202 (Cancer Research, Volume 76, Issue 14_Supplement (15 July 2016); Abstract 394 “Novel pan- PIM / pan-PI3K / mTOR inhibitors are highly active in preclinical models of pancreatic ductal adenocarcinoma.”), IBL-101 (Inflection Biosciences), SAR-413792, RF-1302 (Cancer

[0046] Research, Volume 83, Issue 7_Supplement (1 April 2023); Abstract 5269 “RF-1302, a novel dual inhibitor of PIM1 and FLT3 in preclinical treatment of acute myeloid leukemia.”), IBL- 100 (also referred to as ETP-45299; Cancer Lett., 300(2): 145-53 (2011)), and LGB-321 (U.S. Patent No. 8,592,455).

[0047] One or more PIM1 inhibitors can be administered to a mammal (e.g., a human) in need thereof (e.g., a human having a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides (e.g, a fibrotic condition such as IPF)) by any appropriate route e.g, oral, topical, intranasal, inhalation, transdermal, and parenteral). One or more PIM1 inhibitors can be administered to a mammal locally or systemically. For example, one or more PIM1 inhibitors can be administered locally by topical administration to a mammal (e.g, to the skin of a human). For example, PIM1 inhibitors can be administered systemically by oral administration to a mammal (e.g, a human). For example, PIM1 inhibitors can be administered both locally and systemically administration to a mammal (e.g, a human) by inhalation.

[0048] One or more PIM1 inhibitors can be administered to a mammal (e.g, a human) in need thereof (e.g, a human having a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides (e.g, a fibrotic condition such as IPF)) in any appropriate amount (e.g, any appropriate dose). An effective amount of one or more PIM1 inhibitors can be any amount that reduces a level of a plurality of SASP polypeptides within a cell type associated with a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides within the mammal being treated without producing significant toxicity to the mammal. In cases where one or more PIM1 inhibitors includes TCS, an effective amount of TCS can be from about 0.0001 milligrams of TCS per kilogram body weight (mg / kg) per day to about 1000 mg / kg per day (e.g., from about 0.0001 mg / kg per day to about 750 mg / kg, from about 0.0001 mg / kg per day to about 500 mg / kg, from about 0.0001 mg / kg per day to about 250 mg / kg, from about 0.0001 mg / kg per day to about 100 mg / kg, from about 0.0001 mg / kg per day to about 75 mg / kg, from about 0.0001 mg / kg per day to about 50 mg / kg, from about 0.0001 mg / kg per day to about 25 mg / kg, from about 0.0001 mg / kg per day to about 10 mg / kg, from about 0.0001 mg / kg per day to about 5 mg / kg, from about 0.0001 mg / kg per day to about 1 mg / kg, from about 0.0001 mg / kg per day to about 0.5 mg / kg, from about 0.0001 mg / kg per day to about 0.1 mg / kg, from about 0.1 mg / kg per day to about 1000 mg / kg, from about 0.5 mg / kg per day to about 1000 mg / kg, from about 1 mg / kg per day to about 1000 mg / kg, from about 10 mg / kg per day to about 1000 mg / kg, from about 25 mg / kg per day to about 1000 mg / kg, from about 50 mg / kg per day to about 1000 mg / kg, from about 75 mg / kg per day to about 1000 mg / kg, from about 100 mg / kg per day to about 1000 mg / kg, from about 250 mg / kg per day to about 1000 mg / kg, from about 500 mg / kg per day to about 1000 mg / kg, from about 750 mg / kg per day to about 1000 mg / kg, from about 0.1 mg / kg per day to about 750 mg / kg, from about 0.5 mg / kg per day to about 500 mg / kg, from about 1 mg / kg per day to about 250 mg / kg, from about 5 mg / kg per day to about 100 mg / kg, from about 10 mg / kg per day to about 75 mg / kg, from about 25 mg / kg per day to about 50 mg / kg, from about 0.1 mg / kg per day to about 5 mg / kg, from about 0.5 mg / kg per day to about 10 mg / kg, from about 1 mg / kg per day to about 25 mg / kg, from about 25 mg / kg per day to about 50 mg / kg, from about 50 mg / kg per day to about 75 mg / kg, from about 75 mg / kg per day to about 100 mg / kg, from about 100 mg / kg per day to about 250 mg / kg, from about 250 mg / kg per day to about 500 mg / kg, or from about 500 mg / kg per day to about 750 mg / kg per day). The effective amount can remain constant or can be adjusted as a sliding scale or variable dose depending on the mammal’s response to treatment. Various factors can influence the actual effective amount used for a particular application. For example, the frequency of administration, duration of treatment, use of multiple treatment agents, route of administration, and / or severity of the condition(s) in the mammal being treated may require an increase or decrease in the actual effective amount administered.

[0049] One or more PIM1 inhibitors can be administered to a mammal (e.g, a human) in need thereof (e.g., a human having a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides e.g., a fibrotic condition such as IPF)) at any appropriate frequency. The frequency of administration can be any frequency that reduces a level of a plurality of SASP polypeptides within a cell type associated with a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides within the mammal being treated without producing significant toxicity to the mammal. For example, the frequency of administration can be from about twice a month to about once a month, from about twice a day to about one every other day, from about once a day to about once a week, from about once a day to about once a month, or from about once a week to about once a month. The frequency of administration can remain constant or can be variable during the duration of treatment. As with the effective amount, various factors can influence the actual frequency of administration used for a particular application. For example, the effective amount, duration of treatment, use of multiple treatment agents, and / or route of administration may require an increase or decrease in administration frequency.

[0050] One or more PIM1 inhibitors can be administered to a mammal (e.g, a human) in need thereof (e.g., a huma having a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides e.g., a fibrotic condition such as IPF)) for any appropriate duration. An effective duration for administering or using one or more PIM1 inhibitors can be any duration that reduces a level of a plurality of SASP polypeptides within a cell type associated with a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides within the mammal being treated without producing significant toxicity to the mammal. For example, the effective duration can vary from several days to a lifetime, from several weeks to several months, from several months to several years, or from several years to a lifetime. Multiple factors can influence the actual effective duration used for a particular treatment. For example, an effective duration can vary with the frequency of administration, effective amount, use of multiple treatment agents, and / or route of administration.

[0051] In some cases, the methods for treating a mammal (e.g., a mammal such as a human having a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides (e.g., a fibrotic condition such as IPF)) as described herein (e.g., by administering one or more PIM1 inhibitors) can include administering to the mammal one or more PIM1 inhibitors as the sole active ingredient(s) to treat the mammal. For example, a composition containing one or more PIM1 inhibitors can include the PIM1 inhibitors as the sole active ingredient in the composition that is effective to treat a mammal (e.g., a mammal having one or more fibrotic conditions such as IPF).

[0052] In some cases, the methods for treating a mammal (e.g., a mammal such as a human having a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides (e.g., a fibrotic condition such as IPF)) as described herein (e.g, by administering one or more PIM1 inhibitors) also can include administering to the mammal one or more (e.g., one, two, three, four, five or more) additional agents / therapies. In some cases, a mammal (e.g., a mammal such as a human having a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides (e.g., a fibrotic condition such as IPF)) can be administered (or instructed to self-administer) one or more PIM1 inhibitors and can be administered (or instructed to self-administer) one or more antisenescence treatments. An anti-senescence treatment is a treatment designed to inhibit or reduce cellular senescence within a mammal. For example, an anti-senescence treatment that can be administered to a mammal (e.g, a human) and / or assessed as described herein can be a treatment that includes administering one or more senotherapeutic agents to the mammal (e.g., the human). Examples of senotherapeutic agents that can be used as at least a part of an anti-senescence treatment described herein include, without limitation, dasatinib, navitoclax, A1331852, Al 155463, geldanamycin, tanespimycin, alvespimycin, piperlongumine, panobinostat, FOX04-related peptides, nutlin3a, ruxolitinib, metformin, rapamycin, JAK1 / 2 inhibitors (e.g., ruxolitinib, AZD 1480), NF-KB inhibitors, p38 inhibitors, IL6 inhibitors, and STAT3 inhibitors (e.g., LLL12).

[0053] In cases where one or more PIM1 inhibitors are used in combination with one or more senotherapeutic agents, the one or more senotherapeutic agents can be administered at the same time (e.g., in a single composition containing both one or more PIM1 inhibitors and the one or more senotherapeutic agents) or independently. For example, one or more PIM1 inhibitors can be administered first, and the one or more senotherapeutic agents administered second, or vice versa.

[0054] In some cases, a mammal (e.g., a mammal such as a human having a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides (e.g., a fibrotic condition such as IPF)) can be administered (or instructed to self-administer) one or more PIM1 inhibitors and can be administered (or instructed to self-administer) one or more additional agents / therapies used to treat one or more fibrotic conditions (e.g., IPF). For example, a combination therapy used to treat one or more fibrotic conditions (e.g., IPF) can include administering to the mammal (e.g., a human) one or more PIM1 inhibitors and one or more (e.g., one, two, three, four, five or more) agents used to treat one or more fibrotic conditions (e.g, IPF). In some cases, an agent that can be used to treat one or more fibrotic conditions (e.g, IPF) can be a lysophosphatidic acid (LPA) antagonist. In some cases, an agent that can be used to treat one or more fibrotic conditions (e.g., IPF) can be a phosphodiesterase-4 (PDE4) inhibitor. Examples of agents that can be administered to a mammal to treat IPF include, without limitation, pirfenidone, nintedanib, atezolizumab, deupirfenidone, and any combinations thereof.

[0055] In cases where one or more PIM1 inhibitors are used in combination with additional agents used to treat one or more fibrotic conditions, the one or more additional agents can be administered at the same time (e.g., in a single composition containing both one or more PIM1 inhibitors and the one or more additional agents) or independently. For example, one or more PIM1 inhibitors can be administered first, and the one or more additional agents administered second, or vice versa.

[0056] In some cases, the methods for treating a mammal (e.g., a mammal such as a human having one or more fibrotic conditions such as IPF) as described herein (e.g., by administering one or more PIM1 inhibitors) also can include performing one or more (e.g., one, two, three, four, five or more) additional therapies used to treat one or more fibrotic conditions (e.g, IPF) on the mammal. Examples of therapies used to treat IPF include, without limitation, oxygen therapy, pulmonary rehabilitation, and / or lung transplantation.

[0057] In cases where one or more PIM1 inhibitors are used in combination with one or more additional therapies used to treat one or more fibrotic conditions (e.g., IPF), the one or more additional therapies can be performed at the same time or independently of the administration of one or more PIM1 inhibitors. For example, one or more PIM1 inhibitors can be administered before, during, or after the one or more additional therapies are performed.

[0058] In some cases, a course of treatment can be monitored as described herein. For example, the levels of a plurality of SASP polypeptides within a cell type associated with a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides within the mammal can be monitored over the course of treatment to determine whether or not the treatment is effective and / or remains effective over time.

[0059] The invention will be further described in the following examples, which do not limit the scope of the invention described in the claims. EXAMPLES

[0060] Example 1: PIM1 Kinase is a Positive Feedback Regulator of the Senescent Lung Fibroblast Inflammatory Secretome

[0061] This Example describes the identification of a PIM1 kinase as a regulatory polypeptide for the secretome of senescent, IPF patient-derived lung fibroblasts. As such, a PIM1 kinase can drive premature lung fibroblast senescence.

[0062] Methods

[0063] Cell Culture

[0064] Primary human lung fibroblasts (non-IPF) or IPF patient-derived (IPF) fibroblasts were purchased from ATCC or Lonza; fibroblasts were isolated by explant culture from IPF donors or non-IPF donors whose lungs were rejected for transplantation. Fibroblasts were cultured in a humidified 37°C, 5% CO2 incubator with Eagle’s minimal essential medium (EMEM) (ATCC) containing 10% fetal bovine serum (FBS), and antibiotic-antimycotic (Thermo Fisher Scientific) unless otherwise noted. Cells were routinely characterized by PCR or western blotting using specific fibroblast markers including type I collagen and vimentin. Mycoplasma contamination was monitored routinely by PCR. Experiments were performed with cells between passages three and six. The age and sex of all cells used in this are provided in Table 1.

[0065] Table 1. Human lung fibroblasts utilized in this example. Chemicals and Reagents

[0066] Dimethyl sulfoxide (DMSO) was purchased from Fisher Scientific. 2- mercaptoethanol was purchased from Bio-Rad Laboratories, and was used for RNA isolation, per the RNeasy Plus Mini Kit (Qiagen) protocol. TCS PIM1 1 (TCS) and AZD 1480 were purchased from Cayman Chemical. LLL12 was purchased from BioVision. Endotoxin / azi defree IL6 neutralizing antibody (IL6 Nab) was purchased from Biolegend (501110). Recombinant TNFa was purchased from R&D systems (10291-TA).

[0067] RNA Interference

[0068] Cells were transfected in 6- well plates using Lipofectamine RNAiMAX (Life Technologies) with siGENOME siRNA SMARTpool (Dharmacon) targeting PIM1 (L- 003923-00-0005) or a nontargeting SMARTpool (D-001810-10-05) according to the manufacturers’ suggested protocols. Cells were cultured for 72 hours before collecting RNA or protein.

[0069] Western Blot

[0070] Fibroblasts were plated in 6-well plates and treated as specified for each experiment. Total cellular protein was collected using RIPA buffer (Thermo) containing Pierce Phosphatase Inhibitor and Halt Protease Inhibitor Cocktail (Thermo). BCA Protein Assay Kit (Thermo) was used to measure the total protein concentration of the lysate samples, which were then run on gradient polyacrylamide gels. After transfer and blocking with 5% non-fat dry milk for 60 minutes, the membranes were incubated with the following primary antibodies overnight: GAPDH (Cell Signaling, 14C10), PIM1 (Santa Cruz, sc-13513), p65 (Cell Signaling, 8242), and pS276-p65 (Novus, NB 100-82086). Blocking Buffer was used to dilute all primary antibodies 1 : 1000. Tris-buffered saline (TBS)-Tween was used to wash the blots, which were then incubated with Horseradish peroxidase (HRP)-conjugated secondary antibodies for 1 hour. Secondary antibodies were diluted 1 :10,000 in blocking buffer. Membranes were imaged via a ChemiDoc™ Imaging System (Bio-Rad) and protein quantification was performed via densitometry using Image Lab v6.0 (Bio-Rad). PIM1 Overexpression

[0071] The control lentiviral vector (lenti-control) (pLV-EGFP-CMV-mCherry) and lentiviral vector carrying the human PIM1 gene (lenti-PIMl) (pLV-EGFP-CMV-hPIMl) were bought packaged in viral particles from VectorBuilder (Chicago, IL, USA). Normal human lung fibroblasts at passage 3 were transduced at an MOI of 3 with lenti-control or lenti-PIMl in MEM containing 10% FBS, 100 U / mL penicillin, 100 pg / mL streptomycin and 5 pg / mL polybrene for 48 hours. After which, transduced cells were expanded and FACS sorted for GFP+cells. After sorting, cells were expanded and used for experiments.

[0072] RNA isolation / qPCR

[0073] Fibroblasts were treated as indicated for each experiment. The RNeasy Plus Mini Kit (Qiagen) was used to isolate RNA, following Qiagen’s protocol. The SuperScript VILO cDNA Synthesis Kit (Invitrogen) and PTC-200 Peltier Thermal Cycler (MJ Research) was used to synthesize cDNA. The FastStart Essential DNA Green Master (Roche) and LightCycler 96 (Roche) was used to perform quantitative PCR (qPCR) on the cDNA. Data were expressed as a fold change compared to control treated cells, by AACt relative to GAPDH. Primers were designed using the IDT RealTime PCR tool: GAPDH (F: ACATCGCTCAGACACCATG (SEQ ID NO:1), R: TGTAGTTGAGGTCAATGAAGGG (SEQ ID NO:2)), PIM1 (F: CGACATCAAGGACGAAAACATC (SEQ ID NO:3), R: ACTCTGGAGGGCTATACACTC (SEQ ID NO:4)), IL6 (F: CCACTCACCTCTTCAGAACG (SEQ ID N0:5), R: CATCTTTGGAAGGTTCAGGTTG (SEQ ID NO:6)), CDKN2A (F: GATGTCGCACGGTACCTG (SEQ ID NO:7), R: TCTCTGGTTCTTTCAATCGGG (SEQ ID NO:8)), CDKN1A (F: TGTCCGTCAGAACCCATGC (SEQ ID NO: 9), R: AAAGTCGAAGTTCCATCGCTC (SEQ ID NO: 10)), CCL7 (F: GAGAGCTACAGAAGGACCAC (SEQ ID NO: 11), R: GTTTTCTTGTCCAGGTGCTTC (SEQ ID NO: 12)), CXCL10 (F: CCTTATCTTTCTGACTCTAAGTGGC (SEQ ID NO: 13), R: ACGTGGACAAAATTGGCTTG (SEQ ID NO: 14)), CCL2 (F: TGTCCCAAAGAAGCTGTGATC (SEQ ID NO: 15), R: ATTCTTGGGTTGTGGAGTGAG (SEQ ID NO: 16)), CXCL8 (F: ATACTCCAAACCTTTCCACCC (SEQ ID NO: 17), R: TCTGCACCCAGTTTTCCTTG (SEQ ID NO: 18)), IL1B (F: ATGCACCTGTACGATCACTG (SEQ ID NO: 19), R: ACAAAGGACATGGAGAACACC (SEQ ID NO:20)).

[0074] Cellular Proliferation

[0075] Fibroblasts were plated into 96-well plates (3,000 cells / well) and cultured for 4 days. Cells were then fixed in 4% paraformaldehyde, then permeabilized with 0.25% triton x-100, and DAPI stained. Images were then taken using a Cytation5 imaging reader (BioTek) and the number of DAPI objects within each field-of-view was quantified by automated Gen5 software (BioTek).

[0076] Senescence-associated beta-galactosidase staining

[0077] Fibroblasts were plated into 12-well plates and SA-0 Galactosidase staining was performed per the manufacturer’ s protocol (Senescence 0-Galactosidase Staining Kit #9860, Cell Signaling Technology). Briefly, cells were washed with IX PBS and then IX fixative solution for 15 minutes at room temperature. The plates were then washed two times with IX PBS. 0-Galactosidase staining solution was made by diluting 100X solution A and solution B and 20 mg / mL X-gal solution in DMSO to IX staining solution, diluted from 10X solution provided with distilled water; then, the pH was adjusted to 6.0. 0-Galactosidase staining solution was added to each well. The plate was sealed with parafilm to prevent evaporation and crystal formation. The plate was incubated at 37°C overnight in a dry incubator (no CO2). The 0-Galactosidase staining solution was removed and rinsed with IX PBS. The cells were imaged with an optical microscope using a 10X objective. For quantification of SA- 0 Galactosidase staining (Fig. 6). Phase contrast images were first taken of the 0-Galactosidase staining followed by DAPI staining, imaging, and quantification using a Cytation5 imager with on-board automated software- Gen5 (Biotek). Data are plotted as the percentage of SA- 0 Galactosidase positive cells / total number of cells in each field of view.

[0078] Cytokine and Chemokine PCR Array

[0079] Fibroblasts were plated into 6-well plates and treated with 30 pM quercetin, 60 pM epigallocatechin gallate (EGCG), or 3 pM TCS in EMEM containing 0.1% FBS. Total RNA was isolated using RNeasy Plus Mini Kit (Qiagen), following the manufacturer’s protocol. 1 pg of RNA was then used for synthesis of cDNA using SuperScript VILO (Invitrogen). qPCR was performed using RT2 SYBR Green qPCR Mastermix (Qiagen) and run on a QuantStudio 5 (Applied Biosystems) 384 well real-time PCR thermocycler. Data were expressed as a fold change compared to control treated cells, by AACt relative to GAPDH.

[0080] Cytokine Protein Array

[0081] Fibroblasts were plated into 6-Well plates (Thermo Fischer Scientific) in EMEM containing 10% FBS and allowed to attach for 24 hours. Media was then exchanged with EMEM containing 0.1% FBS and cells were treated for 24 hours with 3 pM TCS. All wells were treated with a final concentration of 0. 1% DMSO. Conditioned media was harvested for the detection of cytokines, using the Human Cytokine Antibody Array (Abeam, ab 133997) according to the manufacturer’s instructions. All reagents and conditioned media samples were thawed on ice and prepared prior to use, and all membrane incubation periods were performed under gentle rocking. Briefly, array membranes were incubated with blocking buffer for 30 minutes at room temperature. Subsequently, conditioned media samples were incubated with array membranes overnight at 4°C. Membranes were washed and incubated with biotin-conjugated anti-cytokines for 2 hours at room temperature. Afterwards, membranes were washed and incubated with HRP-Conjugated Streptavidin for 2 hours at room temperature. Membranes were then washed and incubated with chemiluminescent detection reagents and imaged via ChemiDoc™ Imaging System (Bio-Rad). Spot density was quantified via densitometry analysis using Image Lab v6.0 (Bio-Rad). Data is presented as raw signal intensity-background (Fig. 5B) and fold change relative to the control treated well for each donor sample (Fig. 5C).

[0082] LIVE / DEAD Assay

[0083] Fibroblasts were plated into 96-well plates. Cells were treated with the indicated compounds for 24 hours. Cells were incubated with each component of the LIVE / DEAD™ kit (Thermo Fisher Scientific) for 30 minutes. A Cytation5 microplate fluorescence microscope (BioTek) was used to obtain fluorescent images of each well and cell counts were determined using Gen5 software (BioTek). Statistics

[0084] Data analysis and plotting were performed using Prism 9.0 (GraphPad). Statistical comparison between two groups was performed by paired or unpaired t-test, or Mann- Whitney test, according to the data characteristics and the need for parametric or nonparametric testing, respectively. A statistical analysis of three or more groups was performed by repeated measures (RM) one-way ANOVA with Dunnett’s multiple comparison test, where the mean value of each group was compared against a control group. Results are expressed as the mean ± s.e.m. The sample number (n) indicates the number of independent samples in each experiment.

[0085] Results

[0086] PIM1 regulates phosphorylation and activity of p65 / RelA

[0087] To evaluate the role of PIM1 kinase in lung fibroblast NF-KB activity, a western blot was performed to measure the phosphorylation of S276 on p65 / RelA, relative to total p65 in non-IPF lung fibroblasts treated with or without TNF-a after knocking down PIM1 using siRNA. Fibroblast stimulation with TNF-a promoted phosphorylation of p65 / RelA on S276 (pS276-p65), and this response was dramatically reduced by the knockdown of PIM1 (Fig. 1 A). An added impact to regulating NF-KB transcriptional activity, S276 phosphorylation of p65 by PIM1 also prevented ubiquitin-mediated proteolysis. PIM1 targeting siRNA also reduced total p65 expression (Fig. 1A). To confirm that PIM1 kinase regulates NF-KB signaling, transcript expression of the well-defined NF-KB target genes: IL6, CCL2, andlLIB was measured by qPCR. As shown in Fig. IB, TNFa enhanced gene expression, which was inhibited by knockdown of PIM1 (Fig. IB). siRNA targeting PIM1 was also performed in non-IPF lung fibroblasts not stimulated with TNFa and consistent impact in the expression of IL6, CCL2, and IL1B was observed, suggesting this pathway is inactive in these cells in the absence of exogenous stimuli (Fig. 7). To further confirm that PIM1 kinase is necessary for the phosphorylation of p65 on S276, non-IPF lung fibroblasts were treated with or without TNFa in the presence of selective PIM1 kinase inhibitor: TCS PIM1 1 (hereinafter referred to as: TCS). As shown in Fig. 1C, consistent with PIM1 siRNA experiments, TCS blocked p65 / RelA phosphorylation induced by TNFa, and promoted a loss in p65 total protein. Taken together, these results demonstrate that PIMl kinase promoted phosphorylation of p65 / RelA on S275 and modulated the activity of NF-KB in cultured human lung fibroblasts stimulated with TNF-a.

[0088] Senescent IPF patient-derived lung fibroblasts express spontaneously elevated PIM1 and p65 / Rel phosphorylation

[0089] To determine if PIM1 transcript and protein levels are upregulated in IPF patient- derived lung fibroblasts, protein expression of PIM1 and pS276-p65 in low passage IPF patient-derived fibroblasts were compared to age-matched, non-IPF control fibroblasts. Both PIM1 polypeptide expression and phosphorylation of p65 / RelA (S276) were increased in IPF fibroblasts compared to normal fibroblasts (Fig. 2A, Table 1). To begin investigating the mechanism of Piml overexpression, transcript levels of PIM1 and IL6 were compared along with markers of senescence CDKN2A (pl6INK4A) and CDKN1A (p21Clpl). IPF patient-derived lung fibroblasts expressed elevated levels of senescence associated cyclin dependent kinase inhibitors and IL6 (Fig 2B). Correlation comparisons were plotted for each gene, an PIMl expression in cultured lung fibroblasts was found to align better with CDKN2A than either IL6 or CDKN1A (Fig. 8). Senescence associated P-galactosidase (SA-fl-Gal) staining was performed to confirm the senescence phenotype in IPF patient-derived fibroblasts (Fig. 2C). IPF patient-derived fibroblasts were positive for P-galactosidase staining.

[0090] PIM1 / NF-KB and IL6 / JAK2 / STAT3 form a positive feedback loop

[0091] Expression of PIM1 was measured in IPF lung fibroblasts treated with a neutralizing antibody against IL6 (IL6 Nab), a JAK2 kinase inhibitor (AZD 1480), and a STAT3 kinase inhibitor (LLL12). In all scenarios, blockade of the IL6 / JAK / STAT axis resulted in decreased PIM1 expression (Fig. 3 A), confirming the involvement of STAT3 pathways in maintaining / regulating PIM1 expression in IPF fibroblasts. Next, to confirm that PIM1 kinase is involved in the phosphorylation and activation of NF-KB in IPF fibroblasts, which display spontaneously high PIM1 and activation of p65 / RelA, PIM1 was knocked down using siRNA and it was observed that PIM1 inhibition reduced S276 phosphorylation and p65 total protein expression in these cells (Fig. 3B). Consistent with these findings, reduced expression of IL6 transcript also was detected in IPF patient-derived fibroblasts treated with PIM1 targeted siRNA (Fig. 3C). These findings suggest that the IL6 / STAT3 axis promotes expression of PIM1, which in turn, stimulates expression of IL6, demonstrating a positive feedback loop existing within senescent IPF lung fibroblasts (Fig. 2D).

[0092] PIM1 is involved in controlling expression of a broad range of cytokines and chemokines

[0093] The broader role of PIM1 kinase in regulating the secretion of other inflammatory mediators in IPF fibroblasts was evaluated. IPF patient-derived fibroblasts were treated for 24 hours with the PIM1 inhibitor TCS followed by gene expression analysis using a profiler PCR array. Transcripts of 84 genes encoding for cytokines and chemokines were amplified, and among them, 49 were found to be expressed in these cells. In response to PIM1 inhibition, numerous genes encoding for chemokines and NF-KB responders were repressed (Fig. 4A). Primers were designed for the three most repressed genes (CCL7, CXCL10, and CCL2), and robust repression of these genes after exposure of IPF fibroblasts to TCS was confirmed (Fig. 4B). To validate that this effect was not the result of cytotoxic effects of the compound, a LIVE / DEAD assay was performed in IPF lung fibroblasts treated for the same duration with TCS. These findings confirmed that 3 pM TCS was not cytotoxic to the cells (Fig. 9). The effects of TCS were compared to two additional established Pim kinase inhibitors (Fig. 10A). Similar to TCS, SMI-4a is thought to be selective for PIM1, whereas AZDI 208 is a pan-Pim kinase inhibitor. All three compounds blocked the expression of IL6, CCL2, and IL1B without impacting the expression of CXCL8 (Figs. 1-4). siRNA targeting PIM3 was performed in IPF lung fibroblasts, and no reduction in IL6, CCL2, and IL IB was found, further supporting that the effects of TCS are through inhibition of PIM1 (Fig. 10B). Taken together, these findings suggest that PIM1 kinase is a broadly influential regulator of inflammatory secretome transcription in cultured IPF patient-derived lung fibroblasts.

[0094] Building upon the RNA findings, the expression of inflammatory cytokines at protein levels was evaluated. A cytokine array measuring the protein abundance of inflammatory cytokines in the conditioned media derived from IPF lung fibroblasts, treated with or without TCS, was performed. Consistent with what was observed for RNA (Fig. 4), PIM1 kinase inhibition repressed the secretion of numerous chemokines, including GRO (detected via an antibody recognizing CXCL 1 / 2 / 3), GRO-a (detected via an antibody that selectively binds to CXCL1), IL6 (IL6), MCP-1 (CCZ2), and MCP-3 (CCL7) (Fig. 5). IL8 also was strongly secreted by cultured fibroblasts. However, it was not significantly repressed by PIM1 inhibition. These findings further confirm PIM1 as a regulator of the inflammatory secretome and demonstrate that PIM1 kinase inhibition can be used to reduce expression of inflammatory secretomes, thereby treating IPF.

[0095] PIM1 promotes premature senescence of human lung fibroblasts in vitro.

[0096] To investigate gain-of-function, stable PIM1 overexpression was generated in low- passage non-IPF human lung fibroblasts by lentiviral infection, confirmed by western blot (Fig. 6A). TCS is an ATP competitive inhibitor of PIM1 kinase. As such, a dramatic overexpression of PIM1, while maintaining the same concentration, should reduce inhibitor potency. Infection control (lenti-control) and PIM1 overexpressing cells (lenti-PIMl) were treated with 3 pM TCS for 3 and 24 hours prior to collecting total protein. In these experiments, p65 phosphorylation was impacted by TCS only in the control cells. The PIM1 overexpressing cells were refractory to the impact of TCS in this experiment (Fig. 6B). p65 phosphorylation was stably enhanced in the PIM1 over expressing cells. These results further reinforce the role of PIM1 in p65 phosphorylation and validate the specificity of TCS. PIM1 overexpression enhanced RNA production of inflammatory SASP factors: II.6, CCL2, and IL1B. A consistent repression of proliferation was observed in PIM1 overexpressing cells (Fig. 6D). It was next explored if the enhanced expression of SASP factors and reduction in cellular proliferation were hints of premature senescence. Indeed, PIM1 overexpression coincided with increased transcription of senescence-associated cyclin-dependent kinase inhibitors CDKN2A (pl6INK4a) and CDKN1A (p2 lwafl) (Fig. 6E). Premature senescence was further confirmed in vitro by monitoring SA-0-Gal staining in control or PIM1 overexpressing lung fibroblasts from culture passage 4-8. Remarkably, by passage 8 nearly 50% of the PIM1 overexpressing cells stained positively for SA-0-Gal. Significantly earlier than their matched passage control cells (Fig. 6F), identifying PIM1 overexpression as a sufficient driver of lung fibroblast senescence.

[0097] Together, these results demonstrate that PIM1 inhibitors can be used to reduce a level of a plurality of SASP polypeptides within fibroblasts, and can thus be used to treat a mammal having disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides (e.g, a fibrotic condition such as IPF).

[0098] Example 2: Reducing Expression of a Plurality of SASP Polypeptides

[0099] A human in need thereof (e.g., a human having a disease or disorder condition associated with an elevated level of a plurality of SASP polypeptides (e.g, a fibrotic condition such as IPF)) is administered or self-administered one or more PIM1 inhibitors. The administered PIM1 inhibitor(s) can reduce a level of a plurality of SASP polypeptides in the human (e.g, can reduce SASP polypeptides expression by cells such as fibroblasts within the human).

[0100] Example 3: Treating IPF

[0101] A human identified as having IPF is administered or self-administered one or more PIM1 inhibitors. The administered PIM1 inhibitor(s) reduce the severity of one or more symptoms of IPF.

[0102] Example 4: Reducing Expression of a Plurality of SASP Polypeptides ex vivo, in vitro, and in vivo

[0103] The Pirn kinase inhibitor TCS (TCS Pim-1 1) reduced expression of IL-6 and CCL2, two markers of age-related inflammation, in an ex vivo model of aged lung (Figures 11 A and 1 IB). In addition, both TP-3654 and LGH447 reduced expression of IL-6, CCL2, and CCL7 in senescent lung fibroblasts (Figures 12A and 12B).

[0104] The clinically tested Pirn kinase inhibitor LGH447 reduced expression of age-related inflammation genes (e.g., IL-6, CCL2, and IL-10) from multiple organs in vivo in aged mice without impacting expression of these genes in young mice (Figures 13A-13C). This is likely driven by the selective overexpression of the PIM kinase genes in these organs. Uniquely, expression of PIM1, PIM2, and PIM3 was not enhanced in whole brain.

[0105] OTHER EMBODIMENTS

[0106] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

WHAT Is CLAIMED IS:

1. A method for reducing a level of each of a plurality of senescence-associated secretory phenotype (SASP) polypeptides expressed by a cell type present within a mammal, wherein said method comprises:(a) identifying said mammal as having a disease or disorder condition associated with the presence of said cell type,(b) identifying said cell type as expressing said plurality of SASP polypeptides, and(c) administering a proviral integration site for Moloney murine leukemia virus kinase (PIM1) inhibitor to said mammal, thereby reducing a level of each of said plurality of SASP polypeptides expressed by said cell type.

2. The method of claim 1, wherein said mammal is a human.

3. The method of any one of claims 1-2, wherein said mammal is identified as having fibrosis.

4. The method of any one of claims 1-3, wherein said mammal is identified as having idiopathic pulmonary fibrosis (IPF).

5. The method of any one of claims 1-4, wherein said plurality of SASP polypeptides comprises at least two polypeptides selected from the group consisting of an interleukin (IL)- 6 polypeptide, a chemokine (C-C motif) ligand 2 (CCL2) polypeptide, an IL1 p polypeptide, an IL 16 polypeptide, a C-X-C motif chemokine ligand 2 (CXCL2) polypeptide, an IL 13 polypeptide, a CXCL16 polypeptide, a bone morphogenetic protein 4 (BMP4) polypeptide, a CXCL12 polypeptide, a CX3CL1 polypeptide, a TNF superfamily member 13b (TNFSF13B) polypeptide, a CXCL1 polypeptide, a CXCL8 polypeptide, a TNFSF11 polypeptide, a CCL1 polypeptide, a transforming growth factor beta 2 (TGFB2) polypeptide, a CCL11 polypeptide, a CCL13 polypeptide, a TNFSF10 polypeptide, a CXCL10 polypeptide, and a CCL2 polypeptide.

6. The method of any one of claims 1-5, wherein said cell type is a fibroblast cell type.

7. The method of any one of claims 1-6, wherein said cell type is a lung fibroblast cell type.

8. The method of any one of claims 1-7, wherein said PIM1 inhibitor inhibits PIM1 polypeptide expression.

9. The method of claim 8, wherein said PIM1 inhibitor is a nucleic acid molecule designed to induce RNA interference of said PIM1 polypeptide expression.

10. The method of any one of claims 1-7, wherein said PIM1 inhibitor inhibits PIM1 polypeptide activity.

11. The method of claim 10, wherein said PIM1 inhibitor is selected from the group consisting of TCS, SMI-4a, AZD1208, epigallocatechin gallate (EGCG), quercetin, fisetin, luteolin, quercetagetin, TP-3654, and SMI- 16a.

12. The method of any one of claims 1-11, wherein said method comprises detecting a reduction in a level of each of said plurality of SASP polypeptides expressed by said cell type following said administering step.

13. A method for reducing expression of an IL-6 polypeptide, a CCL2 polypeptide, or an IL- 1 p polypeptide in one or more organs of a mammal, wherein said method comprises administering PIM1 inhibitor to said mammal, thereby reducing the level of said IL-6 polypeptide, said CCL2 polypeptide, or said IL- 1 p polypeptide expressed in said one or more organs.

14. The method of claim 13, wherein said mammal is at an age within the last half of normal life expectancy for the species of said mammal.

15. The method of claim 13, wherein said mammal is at an age within the last 20 percent of normal life expectancy for the species of said mammal.

16. The method of any one of claims 13-15, wherein said mammal is a human.

17. The method of claim 16, wherein said human is older than 45, older than 50, older than 55, older than 60, older than 65, older than 70, older than 75, older than 80, older than 85, or older than 90.

18. The method of any one of claims 13-17, wherein said method comprises identifying said mammal being in need of reduced expression of said IL-6 polypeptide, a CCL2 polypeptide, or an IL- 10 polypeptide.

19. The method of any one of claims 13-18, wherein said method comprises identifying said mammal as having fibrosis.

20. The method of any one of claims 13-19, wherein said method comprises identifying said mammal as having idiopathic pulmonary fibrosis (IPF).

21. The method of any one of claims 13-20, wherein said method comprises reducing the level of said IL-6 polypeptide.

22. The method of any one of claims 13-21, wherein said method comprises reducing the level of said CCL2 polypeptide.

23. The method of any one of claims 13-22, wherein said method comprises reducing the level of said IL- 10 polypeptide.

24. The method of any one of claims 13-23, wherein said one or more organs is selected from the group consisting of a lung, a liver, a kidney, a spleen, and a heart.

25. The method of any one of claims 13-24, wherein said one or more organs is a lung.

26. The method of any one of claims 13-25, wherein said one or more organs is a liver.

27. The method of any one of claims 13-26, wherein said one or more organs is a kidney.

28. The method of any one of claims 13-27, wherein said one or more organs is a spleen.

29. The method of any one of claims 13-28, wherein said one or more organs is a heart.

30. The method of any one of claims 13-29, wherein said PIM1 inhibitor inhibits PIM1 polypeptide expression.

31. The method of claim 30, wherein said PIM1 inhibitor is a nucleic acid molecule designed to induce RNA interference of said PIM1 polypeptide expression.

32. The method of any one of claims 13-31, wherein said PIM1 inhibitor inhibits PIM1 polypeptide activity.

33. The method of claim 32, wherein said PIM1 inhibitor is selected from the group consisting of TCS, SMI-4a, AZD1208, EGCG, quercetin, fisetin, luteolin, quercetagetin, TP- 3654, and SMI-16a.

34. The method of any one of claims 13-33, wherein said method comprises detecting a reduction in a level of said IL-6 polypeptide, said CCL2 polypeptide, or said IL- 10 polypeptide expressed in said one or more organs.

35. The method of any one of claims 1-7, 10, 12-29, 32, and 34, wherein said PIM1 inhibitor is selected from the group consisting of LGH447, TP-3654, Uzansertib, ETP-339, IBL-100, and LGB-321.

36. The method of any one of claims 1-7, 10, 12-29, 32, and 34, wherein said PIM1 inhibitor is selected from the group consisting of BLX-0676, IBL-202, IBL-101, SAR- 413792, and RF-1302.