Lipid nanoparticles for the prevention of tuberculosis or other mycobacterial infections

EP4637810A2Pending Publication Date: 2025-10-29AKAGERA MEDICINES INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
EP2023908620
Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-12-22
Filing Date
2023-12-22
Publication Date
2025-10-29

AI Technical Summary

Technical Problem

Current lipid nanoparticles (LNPs) used for delivering nucleic acids, such as mRNA, are sensitive to oxidative degradation during storage, which affects their stability and transfection efficiency, and there is a need for improved ionizable cationic lipids that maintain stability while retaining high potency for therapeutic delivery.

Method used

Development of dendritic-cell targeted lipid nanoparticles comprising specific ionizable cationic lipids, such as KC3, and phospholipids like phosphatidylserine, which enhance stability and transfection efficiency by optimizing the lipid composition and structure to resist oxidative degradation and improve cellular targeting.

Benefits of technology

The improved LNP compositions demonstrate enhanced stability and transfection efficiency, effectively delivering mRNA-encoded epitopes from Mycobacterium tuberculosis, promoting a robust immune response for tuberculosis prevention and other mycobacterial infections.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 1.1
    Figure 1.1
Patent Text Reader

Abstract

Aspects of the present disclosure provides for improved mycobacterium tuberculosis vaccine compositions of ionizable lipid nanoparticles for the delivery of immunogenic nucleic acids to cells. Anionic phospholipids, including phosphatidyl serine and phosphatidylglycerol are included in the lipid nanoparticles to increase the transfection efficiency in dendritic cells. In some embodiments, the incorporation of mono-unsaturated alkyl chain analogs in dimethylaminopropyl - dioxolane or heterocyclic ketal ionizable lipids in the formulation provided high levels of transfection in human dendritic cells, compared to other ionizable lipids in the same family, and demonstrated good stability to oxidative damage. Other aspects of the present disclosure provide mRNA that encodes for concatenated peptides encoding for multiple MHC-II tuberculosis epitopes, and optionally includes a second mRNA encoding for concatenated MHC-I tuberculosis epitopes.
Need to check novelty before this filing date? Find Prior Art

Description

[0001]Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 LIPID NANOPARTICLES FOR DELIVERY OF NUCLEIC ACIDS AND VACCINE FOR THE PREVENTION OF TUBERCULOSIS OR OTHER MYCOBACTERIAL INFECTIONS RELATED APPLICATIONS This patent application claims the benefit of and priority to U.S. Provisional Patent Application No.63 / 476,916, filed December 22, 2022, which is incorporated herein by reference in its entirety. REFERENCE TO SEQUENCE LISTING This specification includes a sequence listing submitted herewith, which includes the file entitled 191016-010702_PCT_SL.xml having the following size: 324,933 bytes which was created December 21, 2023, the contents of which are incorporated by reference herein. FIELD Aspects of present disclosure relates to dendritic-cell targeted lipid nanoparticles (LNP) incorporating mRNA encoding for combinations of specific CD8 and CD4 T-cell epitopes found in mycobacterium tuberculosis. In some embodiments, a LNP comprising one or more cationic ionizable lipid(s) is useful for delivery of mRNA, for dendritic cell targeting or methods of using these LNP compositions as a vaccine for the prevention of tuberculosis or other mycobacterial infections. BACKGROUND Lipid nanoparticles (LNP) are used for the delivery of therapeutic nucleic acids to cells. For example, LNP pharmaceutical compositions are employed in vaccines to deliver mRNA therapeutics. LNP formulations typically include an ionizable cationic lipid (ICL). However, it is known in the art that certain ICL compounds are undesirably sensitive to oxidation during storage. Therefore, there is a need for improved ICL compounds with improved stability to oxidative degradation while in storage, while also providing desired transfection activity or potency in cells when incorporated in a LNP with a therapeutic agent such as a nucleic acid. LNP compositions, including stable nucleic acid lipid particle (SNALP) compositions, are useful for delivery of nucleic acid therapies for various infectious diseases. Infectious diseases 1 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 such as tuberculosis, HIV / AIDS, malaria, and COVID-19 represent significant challenges to human health. Mycobacteria, for example, is a genus of bacteria responsible for tuberculosis (TB). According to the World Health Organization, worldwide, TB is one of the top 10 causes of death and the leading cause of death from a single infectious agent. Despite current best efforts, there have been significant challenges in the development of effective vaccines for the prevention of many infectious diseases. New efforts in the identification of individual or combinations of antigenic peptides has helped improved the efficiency of vaccines. Nonetheless, significant opportunities remain in the engineering of adjuvants to help efficiently deliver and present these antigenic sequences to professional antigen presenting cells, like dendritic cells. mRNA coding for antigenic peptides or proteins combined with ionizable cationic lipid nanoparticles represent a particularly promising strategy in the development of a vaccine. There is a need for safe and effective therapies comprising LNP pharmaceutical compositions for delivery of mRNA for treatment and prevention of various diseases, including vaccine compositions. SUMMARY Lipid nanoparticle (LNP) compositions are provided herein, and methods of making and using the same. In some embodiments, the LNP compositions comprise a nucleic acid such as messenger ribonucleic acid (mRNA). In some embodiments, the LNP compositions are vaccines, including LNP formulations comprising mRNA that encodes an immune system epitope, or an antigen recognized by the immune system. In some aspects, the LNP comprises nucleic acid containing a chemically modified mRNA, wherein the chemically modified mRNA comprises N1-methylpseudouridine. In some aspects, the LNP comprises nucleic acid comprising a 5’ untranslated region (UTR) and 3’ UTR, polyA tail of about 80 to about 140 nucleotides in length, and (i) a 5’ enzymatic or (ii) a 5’ clean cap. In some aspects, the LNP comprises a chemically modified mRNA, wherein the chemically modified mRNA comprises N1-methylpseudouridine In some embodiments, the LNP composition comprises: (a) a nucleic acid; (b) an ionizable cationic lipid comprising a KC3 ionizable cationic lipid at a N / P ratio of 3 to 7 relative to the nucleic acid, the ionizable cationic lipid present in the LNP composition in a total amount of 46- 54 mol% of a total lipid content of the LNP composition; (c) one or more phospholipids in a total amount of 5-20 mol% of the total lipid content of the LNP composition; (d) one or more anionic phospholipids in a total amount of 2-8 mol% of the total lipid content of the LNP composition; (e) 2 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 a conjugated lipid in a total amount of 1-3.5 mol% of the total lipid content of the LNP composition; and (f) a sterol such cholesterol (e.g., in an amount providing the remainder of the LNP composition). In some aspects, the one or more anionic phospholipids is a phosphatidylserine (PS) or phosphatidylglycerol (PG). In some aspects, the one or more anionic phospholipids is selected from the group consisting of: dipalmitoylphosphatidyl-L-serine (DPPS), or distearoylphosphatidyl-L-serine (DSPS), distearoylphosphatidylglycerol (DSPG), and dipalmitoyphosphatidylglycerol (DPPG). In some aspects, the one or more phospholipids comprises distearoylphosphatidylcholine (DSPC), hydrogenated soy phosphatidylcholine (HSPC), dipalmitoylphosphatidylcholine (DPPC) or a combination thereof. In some aspects, the conjugated lipid is PEG(2000)-dimyristoylglycerol (PEG-DMG). In some aspects, the sterol is cholesterol. In some aspects, the ionizable cationic lipid comprises 3-((S)-2,2-di((Z)-octadec-9- en-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylpropan-1-amine (KC3-OA). In some aspects, the ionizable cationic lipid further comprises a KC4 ionizable cationic lipid, such as 4-rac-2,2-di((Z)- octadec-9-en-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylbutan-1-amine (AKG-KC4-OA). In some aspects, the LNP composition consists of: 48 mol% KC3-OA; 5 mol% DPPS or DSPG; 5-10 mol% DSPC or HSPC; 1.5 mol% PEG-DMG; and cholesterol. In some aspects, the LNP composition consists of: 48 mol% KC3-OA; 5 mol% DPPS or DSPG; 5 mol% DSPC or HSPC; 1.5 mol% PEG- DMG; and 40.5 mol% cholesterol. In some aspects, the LNP composition consists of: 48 mol% KC3-OA; 5 mol% DPPS or DSPG; 10 mol% DSPC or HSPC; 1.5 mol% PEG-DMG; and 35.5 mol% cholesterol. In some embodiments, a method of eliciting a T cell response in a host is provided, comprising administering to the host a nucleic acid sequence disclosed herein or a nucleic acid having at least 90% sequence identity or complementarity to a sequence disclosed herein, and / or a sequence encoding a T cell epitope from Mycobacterium tuberculosis (Mtb), or a polynucleotide sequence having at least 90% identity or complementarity to a sequence disclosed herein and / or a polynucleotide sequence of a Mtb antigen recognized by T cells. A lipid nanoparticle (LNP) composition consisting of: a messenger ribonucleic acid (mRNA) encoding one or more Mycobacterium tuberculosis (Mtb) proteins selected from the group consisting of CFP10 / Rv3874, ESAT-6 / Rv3875, Mtb32A / Rv0125, Mtb39A / Rv1196, Ag85B / Rv1886c, EsxW / Rv3620c, EsxV / Rv3619c, PE13 / Rv1195, PPE30 / Rv1802, PPE40 / Rv2356c and TB10.4 / Rv0288; an ionizable cationic lipid comprising a KC3 ionizable 3 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 cationic lipid at a N / P ratio of 4 to 6 relative to the mRNA, the ionizable cationic lipid present in the LNP composition in a total amount of 46-54 mol% of a total lipid content of the LNP composition; one or more phospholipids selected from the group consisting of distearoylphosphatidylcholine (DSPC), hydrogenated soy phosphatidylcholine (HSPC), and dipalmitoylphosphatidylcholine (DPPC), in a total amount of 10-18 mol% of the total lipid content of the LNP composition; one or more anionic phospholipids selected from the group consisting of dipalmitoylphosphatidyl-L-serine (DPPS), or distearoylphosphatidyl-L-serine (DSPS), distearoylphosphatidylglycerol (DSPG), and dipalmitoyphosphatidylglycerol (DPPG) in a total amount of 2-8 mol% of the total lipid content of the LNP composition; PEG(2000)- dimyristoylglycerol (PEG-DMG) in a total amount of 1-3.5 mol% of the total lipid content of the LNP composition; and cholesterol (e.g., 35.5 – 40.5 mol% cholesterol). Aspects of the disclosure relate to a lipid nanoparticle (LNP) composition comprising a KC3 ionizable cationic lipid, cholesterol, one or more phospholipids comprising at least one anionic phospholipid, a conjugated lipid and one or more nucleic acid sequence encoding a T cell epitope from Mycobacterium tuberculosis (Mtb). In some embodiments, the LNP composition comprises 48 mol% of the KC3 ionizable cationic lipid, 40.5 mol% cholesterol, 5 mol% (L-Serine) DPPS lipid, 5 mol% DSPC or DPPC; and a total of 10 mol% phospholipid concentration, wherein each mol% refers to the mol% of the total lipid content of the LNP composition. In some embodiments, the LNP composition comprises 48 mol% of the KC3 ionizable cationic lipid, 40.5 mol% cholesterol, and 5 mol% (L-Serine) DPPS lipid, wherein each mol% refers to the mol% of the total lipid content of the LNP composition. In some embodiments, the LNP composition comprises 48 mol% of the KC3 ionizable cationic lipid, 38.5 mol% cholesterol, and 5 mol% (L-Serine) DPPS lipid, wherein each mol% refers to the mol% of the total lipid content of the LNP composition. In some embodiments, the LNP composition comprises 45 mol% of the KC3 ionizable cationic lipid, 42.7 mol% cholesterol, and 5 mol% (L-Serine) DPPS lipid, wherein each mol% refers to the mol% of the total lipid content of the LNP composition. In some embodiments, the LNP composition comprises 50 mol% of the KC3 ionizable cationic lipid, 38.5 mol% cholesterol, 5 mol% (L-Serine) DPPS lipid, and a total of 10 mol% phospholipid concentration, wherein each mol% refers to the mol% of the total lipid content of the LNP composition. In some embodiments, the LNP composition comprises 48 mol% of the KC3 4 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 ionizable cationic lipid, 40.5 mol% cholesterol, 5 mol% (L-Serine) DPPS lipid, and a total of 10 mol% phospholipid concentration, wherein each mol% refers to the mol% of the total lipid content of the LNP composition. In some embodiments, the LNP composition comprises 48 mol% of the KC3 ionizable cationic lipid, 40.5 mol% cholesterol, 5 mol% (L-Serine) DPPS lipid, 5 mol% DSPC or DPPC; and a total of 10 mol% phospholipid concentration, wherein each mol% refers to the mol% of the total lipid content of the LNP composition. In some embodiments, the LNP composition comprises 46.5 mol% of the KC3 ionizable cationic lipid, 42 mol% cholesterol, 5 mol% (L-Serine) DPPS lipid, wherein each mol% refers to the mol% of the total lipid content of the LNP composition. In some embodiments, the LNP composition comprises 15 mol% total phospholipid and 35.5 mol% cholesterol. In some embodiments, the LNP composition comprises 10 mol% total phospholipid and 40.5 mol% cholesterol. In some embodiments, the LNP composition comprises 40.5 mol% cholesterol, 5% anionic lipid (DPPS) and 5% PC (DSPC or DPPC) and a total of 10 mol% phospholipid concentration. In some embodiments, the LNP composition comprises 48 mol% cationic ionizable lipid, 5 mol% PC (DPPC), 5 mol% anionic lipid (DPPS), 40.5 mol% cholesterol, 1.5 mol% conjugated lipid (PEG-DMG). In some aspects, the LNP comprises a nucleic acid sequence (e.g., mRNA) encoding a T cell epitope from Mycobacterium tuberculosis (Mtb), or a Mtb antigen recognized by T cells. In some aspects, the LNP comprises a nucleic acid sequence that is mRNA encoding a concatenated sequence of T-cell epitopes present in Mtb or a Mtb antigen recognized by T Cells. In some aspects, the LNP comprises a nucleic acid sequence that is mRNA encoding one or more Mtb proteins selected from the group consisting of CFP10 / Rv3874, ESAT-6 / Rv3875, Mtb32A / Rv0125, Mtb39A / Rv1196, and Ag85B / Rv1886c. In some aspects, the LNP comprises a nucleic acid sequence that is mRNA comprising one or more nucleic acid sequences selected from the group consisting of: SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, and SEQ ID NO:220. In some aspects, the LNP comprises a nucleic acid sequence that is mRNA encoding one or more Mtb proteins selected from the group consisting of EsxW / Rv3620c, EsxV / Rv3619c, PE13 / Rv1195, PPE30 / Rv1802, PPE40 / Rv2356c and TB10.4 / Rv0288. In some aspects, the LNP comprises a nucleic acid sequence that is mRNA comprising one or more nucleic acid sequences selected from the group consisting of: SEQ ID NO:1, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:31, SEQ ID NO:221, and SEQ ID NO:222. In some aspects, the LNP comprises a nucleic acid sequence that comprises the concatenated nucleic acid-encoded sequence includes an N- 5 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 terminal and C-terminal signal peptide selected from Sec / MITD, Lamp1, HLA-Dra, or tPA. In some aspects, the LNP comprises a nucleic acid sequence that is an mRNA having a sequence selected from SEQ ID NOs: 34, 36, 38, 40, 42, 44, 224 and 226. In some aspects, the LNP comprises nucleic acid that is an mRNA encoding an amino acid sequence selected from SEQ ID NOs: 33, 35, 37, 39, 41, 43, 86-105, 207-210, 223 and 225. In some embodiments, the one or more nucleic acids is a mRNA. In some embodiments, the mRNA encodes a concatenated sequence of T-cell epitopes present in Mtb. In some embodiments, the concatenated sequence of T-cell epitopes comprise an amino acid sequence set forth in SEQ ID NOs: 1-17, 106-137, 138-203. In some embodiments, the concatenated sequence of T-cell epitopes comprises an amino acid sequence with at least 90% sequence identity (e.g. 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more) with amino acid sequence set forth in SEQ ID NOs: 1-17, 45-85, 106-137, 138-203. In some embodiments, the concatenated nucleotide sequence comprises two or more sequences encoding for peptides or proteins that can elicit MHC class II-restricted CD4 T cell responses. In some embodiments, the two or more MHC class II epitopes selected from the group: EsxV (Rv3619), EsxW (Rv3620c), EsxB / CFP10 (Rv3874), EsxA / ESAT-6 (Rv3875), ^Mtb39A (Rv1196), Ag85B (Rv1886c), and EsxH / TB10.4 (Rv0288). In some embodiments, the two or more MHC class II epitopes comprises peptides or proteins from EsxV (Rv3619), EsxW (Rv3620c), EsxB / CFP10 (Rv3874), EsxA / ESAT-6 (Rv3875), ^Mtb39A (Rv1196), Ag85B (Rv1886c), and EsxH / TB10.4 (Rv0288) (SEQ ID NOs.1-7). In some embodiments, the concatenated nucleic acid-encoded sequence includes the seven proteins in and order N-terminal to C-terminal selected from: EsxB / CFP10 (Rv3874), EsxA / ESAT-6 (Rv3875), EsxH / TB10.4 (Rv0288), ^Ag85B (Rv1886c), ^Mtb39A (Rv1196), EsxW (Rv3620c), and EsxV (Rv3619), or EsxB / CFP10 (Rv3874), EsxA / ESAT-6 (Rv3875), EsxW (Rv3620c), EsxV (Rv3619), EsxH / TB10.4 (Rv0288), ^Ag85B (Rv1886c), and ^Mtb39A (Rv1196), or EsxB / CFP10 (Rv3874), ^Mtb39A (Rv1196), EsxA / ESAT-6 (Rv3875), EsxW (Rv3620c), EsxH / TB10.4 (Rv0288), EsxV (Rv3619), and ^Ag85B (Rv1886c). (SEQ ID NOs.18, 19, and 20) In some embodiments, the composition comprises a nucleic acid encoding for 5 or more non-overlapping CD4 T cell epitopes in the form of peptides, wherein optionally the peptides are from 12 to 50 amino acids long. 6 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 In some embodiments, the concatenated nucleic acid-encoded sequence optionally comprises 10 selected MHC-II epitopes comprising: AQIYQAVSAQAAAIH (SEQ ID NO. 9), PSPSMGRDIKVQFQS (SEQ ID NO. 10), GINTIPIAINEAEYV (SEQ ID NO. 11), AAFQGAHARFVAAAA (SEQ ID NO. 12), AGWLAFFRDLVARGL (SEQ ID NO. 13), ASIIRLVGAVLAEQH (SEQ ID NO. 14), MSFVTTQPEALAAAA (SEQ ID NO. 8), MHVSFVMAYPEMLAA (SEQ ID NO. 15), AYGSFVRTVSLPVGA (SEQ ID NO. 16), and LENDNQLLYNYPGAL (SEQ ID NO.17). In some embodiments, the concatenated nucleic acid-encoded sequence includes GPGPG (SEQ ID NO.228) linker sequences between each of the concatenated epitopes. In some embodiments, the one or more nucleic acid comprises a nucleic acid sequence set forth in SEQ ID NOs: 34, 36, 38, 40, 42, and 44. In some embodiments, the one or more nucleic acid comprises a nucleic acid sequence having at least 90% identity, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% with a nucleic acid sequence set forth in SEQ ID NOs: 34, 36, 38, 40, 42, and 44. In some embodiments, the concatenated nucleic acid-encoded sequence includes an N- terminal and C-terminal signal peptide selected from Sec / MITD, Lamp1, HLA-Drα, or tPA. In some embodiments, the one or more nucleic acid comprises a chemically modified mRNA, wherein the chemically modified mRNA comprises N1-methylpseudouridine. In some embodiments, the one or more nucleic acid comprises a 5’ untranslated region (UTR) and 3’ UTR, polyA tail of about 80 to about 140 nucleotides in length, and (i) a 5’ enzymatic or (ii) a 5’ clean cap. In some embodiments, the one or more nucleic acid is an mRNA having a sequence selected from SEQ ID NOs: 34, 36, 38, 40, 42, 44, 224 and 226. In some embodiments, the one or more nucleic acid is an mRNA and wherein the amino acid sequence encoded by the mRNA is selected from SEQ ID NOs: 33, 35, 37, 39, 41, 43, 86- 105, 207-210, 223 and 225. In some embodiments, the nucleic acid-encoded concatenated sequence comprises two or more MHC class I epitopes selected from SEQ ID NOs: 106-137 and 138-203. 7 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 In some embodiments, the nucleic acid-encoded concatenated sequence includes two or more MHC class I epitopes found in mycobacterium tuberculosis, depleted of epitopes found in BCG, and selected from SEQ ID NOs: 86-95. In some embodiments, the nucleic acid-encoded concatenated sequence includes two or more MHC class I epitopes that are ordered to minimize junctional neoepitope generation, and selected from SEQ ID NOs: 86-105. In some embodiments, the cationic lipid is KC3-OA, KC3-PA, KC3-01, KC3-C17 (8:1), or KC3-C15 (C8:1). In some embodiments, the LNP comprises the conjugated lipid in a total amount of less than 2 mol% of the total lipid content of the LNP composition. In some embodiments, the ionizable cationic lipid in a total amount of 45-55 mol% of the total lipid content of the LNP composition; cholesterol is in a total amount of 35-45 mol% of the total lipid content of the LNP composition; the total amount of the one more phospholipid is 7-15 mol% of the total lipid content of the LNP composition; the one or more phospholipids consist of DSPC and the PS lipid is one or more lipids selected from the group consisting of the L-serine configuration of DPPS and DSPS; and the total amount of the PS lipid is about 5 mol% of the total lipid content of the LNP composition. In some embodiments, the conjugated lipid is PEG-DMG; and the PS lipid is selected from the group consisting of: DSPS (L-isomer) and DPPS. In some embodiments, the ionizable cationic lipid is KC3-OA. In some embodiments, the LNP composition has a N / P ratio of 4 to 7. In some embodiments, the LNP composition has a N / P ratio of 5 to 6. Provided in some aspect of the disclosure is a nucleic acid lipid nanoparticle (LNP) composition comprising: a mRNA having at least 90% identity (e.g.90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more) with a nucleic acid sequence set forth in SEQ ID NOs: 34, 36, 38, 40, 42, and 44, ionizable cationic lipid KC3-PA, and a (L-Serine) PS lipid in a total amount of 2.5-10 mol% of the total lipid content of the LNP composition. In some embodiments, the PS lipid is (L-Serine) DSPS, (L-Serine) DPPS, or a mixture thereof, and the LNP composition further comprises cholesterol and a second phospholipid selected from the group consisting of: DSPC, DOPC, DPPC, HSPC, and SM. 8 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 Provided in some aspect of the disclosure isa nucleic acid lipid nanoparticle (LNP) composition comprising: a mRNA having at least 90% identity (e.g.90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more) with a nucleic acid sequence set forth in SEQ ID NOs: 34, 36, 38, 40, 42, and 44; a KC3 ionizable cationic lipid in a total amount of 40-65 mol% of the total lipid content of the LNP composition; cholesterol in a total amount of 23.5 - 43.5 mol% of the total lipid content of the LNP composition; a (L-Serine) PS lipid in a total amount of 2.5-10 mol% of the total lipid content of the LNP composition; DSPC or HSPC phospholipid in a total amount of 5-25 mol% of the total lipid content of the LNP composition; and a PEG-containing conjugated lipid in a total amount of 0.5 mol% to 2.5 mol% of the total lipid content of the LNP composition. In some embodiments, the ionizable lipid having the chemical structure: , 2, 3 or 4; R2and R3are each independently methyl; and n is an integer equal to 2 or 3. In some embodiments, n is 3. In some embodiments, the composition is a vaccine. Provided in some aspects of the disclosure is a pharmaceutical composition comprising the lipid nanoparticle described herein, and a pharmaceutically acceptable carrier. Aspects of the disclosure relate to a nucleic acid encoding a concatenated amino acid sequence of T-cell epitopes present in mycobacterium tuberculosis, the nucleic acid having at least 90% (e.g.90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more) identity with a nucleic acid sequence set forth in SEQ ID NOs: 34, 36, 38, 40, 42, and 44. In some embodiments, ionizable cationic lipids (ICLs) are provided. Cationic lipids are engineered with improved stability to oxidative degradation while in storage, while retaining high transfection activity or potency in cells. Aspects of the disclosure are based in part on the discovery 9 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 that LNP compositions comprising mRNA and certain ionizable cationic lipids (ICL) enhanced expression of the mRNA in human dendritic cells. In some embodiments, LNP compositions comprise a targeting ligand directed against cell surface receptors to target lipid nanoparticles in a highly specific manner, including to dendritic cells. In some embodiments, the LNP composition comprises a phosphatidyl-L-serine compound as a targeting ligand, such as dipalmitoylphosphatidyl-L-serine (DPPS), or distearoylphosphatidyl- L-serine (DSPS). In some embodiments, the LNP composition comprises a phosphatidyl-L-serine compound as a targeting ligand and an anionic phospholipid. In some embodiments, the LNP composition comprises a phosphatidylglycerol-containing compound as a targeting ligand such as distearoylphosphatidylglycerol (DSPG) or dipalmitoyphosphatidylglycerol (DPPG), for enhancing expression in human dendritic cells. In some embodiments, LNP compositions comprise both a phosphatidyl-L-serine compound as a targeting ligand, and distearoylphosphatidylcholine (DSPC) as the second phospholipid. In some embodiments, LNP compositions comprise both a phosphatidyl-L-serine compound as a targeting ligand, and distearoylphosphatidylcholine (DSPC) as the second phospholipid without dipalmitoylphosphatidylcholine (DPPC). Aspects of the disclosure are based in part on the discovery that selection of certain cationic ionizable lipids can enhance the transfection of human dendritic cells. For example, the KC3 cationic ionic lipids were more active in transfecting human dendritic cells in LNP compositions than either the KC2 or diacyl ionizable lipids (UO series). Among the LNP compositions comprising KC3 ionizable cationic lipids, those LNP compositions with ionizable cationic lipids having monounsaturated alkyl chains were unexpectedly both more active and more stable to oxidative degradation than those containing those with the dilinoleyl alkyl chains. In some embodiments, certain salts of the phosphatidylserine targeting lipids are provided. For example, in some embodiments, the phosphatidylserine targeting lipids can be provided as an ammonium salt of DPPS having improved biophysical properties and higher solubility in the presence of ethanol, a preferred solvent for preparation of LNPs. The sodium salts of DSPS or DSPS were insoluble in ethanol and required both the presence of methanol and heating to allow for their formation, as did the ammonium salt of DSPS. It is contemplated that the other ammonium salts of phosphatidylserine will give rise to the same advantages in solubility and biophysical properties. 10 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 In some embodiments, ionizable cationic lipid compositions useful in the preparation of liposomal nanoparticle (LNP) compositions are provided. In some embodiments, liposomal compositions are provided comprising an ionizable cationic lipid having (a) a pair of linear C16or C18hydrocarbon chains each comprising a single unsaturated alkenyl double bond within each polyene hydrocarbon chain, covalently bound to a head group comprising a dialkyl amino alkyl group. In some embodiments, the head group of the ionizable cationic lipid has a dialkyl amino group having a pKa of about 6.3 -7.5. In some embodiments, the head group of the ionizable cationic lipid comprises a heterocyclyl or alkyl portion covalently bound to the dialkyl amino group. In some embodiments, the head group of the ionizable cationic lipid optionally further comprises a phosphate group. In some embodiments, each lipid tail of the ionizable cationic lipid compound is identical, and each lipid tail has a total of one olefin with a total length of 15, 16, 17 or 18 carbons. In some embodiments, the LNP compositions comprises a KC3 ionizable cationic lipid. Unless otherwise indicated, the term “KC3 ionizable cationic lipid” as used herein refers to an ionizable cationic lipid having the chemical , wherein each R1is the same or different and is a linear C15 one or more unsaturated alkenyl double bond within each polyene hydrocarbon chain; R2and R3are each independently methyl; and n is 3. In some aspects, each R1in the KC3 ionizable cationic lipid is the same and is a linear C16or C18hydrocarbon chain each comprising a single unsaturated alkenyl double bond within each polyene hydrocarbon chain. In some embodiments, the LNP compositions comprises a KC4 ionizable cationic lipid. Unless otherwise indicated, the term “KC4 ionizable cationic lipid” as used herein refers to an ionizable cationic lipid having the chemical , wherein each R is t 1 he same or different and is a linear C15one 11 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 or more unsaturated alkenyl double bond within each polyene hydrocarbon chain; R2and R3are each independently methyl; and n is 4. In some aspects, each R1in the KC4 ionizable cationic lipid is the same and is a linear C16or C18hydrocarbon chain each comprising a single unsaturated alkenyl double bond within each polyene hydrocarbon chain. In some embodiments, the LNP compositions comprises a mixture of a KC3 ionizable cationic lipid and a KC4 ionizable cationic lipid. In some embodiments, a lipid nanoparticle (LNP) composition comprises an ionizable cationic lipid having the chemical structure of Formula (I): wherein , 2, 3 or 4; R2and R3are each independently (C1-C4) alkyl optionally substituted with hydroxyl; and n is an integer equal to 2, 3 or 4. In some embodiments, ionizable cationic lipid compositions are provided. In some embodiments, a lipid nanoparticle (LNP) composition comprises an ionizable cationic lipid having the chemical structure of Formula (I) wherein a is 0 or 1; b is 1, 2, 3 or 4, provided the sum a+b is 1, 2, 3 or 4; R2and R3are each methyl; and n is an integer equal to 3. In some embodiments, ionizable cationic lipid compositions are provided. In some embodiments, a lipid nanoparticle (LNP) composition comprises an ionizable cationic lipid having the chemical structure of Formula (I-A): ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 (I-A), wherein , 2, 3 or 4; n is an integer equal to 3. In some embodiments, a LNP composition comprises an ionizable cationic lipid comprises a pair of identical, lipid hydrocarbon tails having a total of 15, 16, 17 or 18 carbons and comprising a single olefin group, or a pair of olefin groups. In some embodiments, a LNP composition comprises an ionizable cationic lipid selected from the group consisting of: 13 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 N DLIN-KC3-DMA O some some the ionizable cationic lipid is KC3-C15 (C8:1). In some embodiments, the ionizable cationic lipid is KC3-C16 (C8:1). In some embodiments, the ionizable cationic lipid is KC3-C17 (C8:1). In some embodiments, the ionizable cationic lipid is KC3-C18 (C8:1). In some embodiments, the ionizable cationic lipid is KC3-15. In some embodiments, the ionizable cationic lipid is KC3-16. In some embodiments, the ionizable cationic lipid is KC3-17. In some embodiments, the ionizable cationic lipid is KC3-18. 14 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 The salt form of the targeting lipid can influence it’s solubility in alcohol containing solvents used in the preparation of lipid nanoparticles. In some embodiments, ionizable cationic lipid compositions are provided. In some embodiments, a lipid nanoparticle (LNP) composition comprises a nucleic acid; an ionizable lipid disclosed herein; a sterol; one or more phospholipids comprising a phosphatidylserine (PS) lipid; and optionally further comprising a conjugated lipid. In some embodiments, a lipid nanoparticle (LNP) composition comprises a mRNA nucleic acid; an ionizable lipid disclosed herein; cholesterol;.one or more phospholipids selected from the group consisting of: DSPC, DPPC and DOPC; and a PS lipid selected from the group consisting of: DPPS, DSPS and DOPS; and optionally further comprising a conjugated lipid comprising PEG. In some embodiments, a LNP composition can comprise an anionic phospholipid. In some embodiments, a LNP composition is prepared using a sodium or ammonium salt of an anionic phospholipid. In some embodiments, the anionic phospholipid salt is a compound of Formula (V- A-1), having the chemical structure: wherein X+is an ammonium (NH4+) or sodium (Na+) cation; and a is 14, 15 or 16. In some embodiments, the anionic phospholipid salt is selected from the group consisting of: 15 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 O O O 9 3 -181O O P - O O DSPS (L-isomer) – – – – In some embodiments, the anionic phospholipid salt is DSPS (L-isomer) sodium salt. In some embodiments, the anionic phospholipid salt is DSPS (L-isomer) ammonium salt. In some embodiments, the anionic phospholipid salt is DPPS (L-isomer) sodium salt. In some embodiments, the anionic phospholipid salt is DPPS (L-isomer) ammonium salt. In some embodiments the targeting lipid is a sodium or ammonium salt of dipalmitoylphosphatidyl-L- serine (DPPS) or distearoylphosphatidyl-L-serine (DSPS). In some embodiments the targeting lipid is a sodium or ammonium salt of dipalmitoylphosphatidyl-L-serine (DPPS) or distearoylphosphatidyl-L-serine (DSPS). In some embodiments, a LNP composition can comprise an anionic phospholipid selected from the group consisting of: 16 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 O O 9 3 OH 18P 16 14 101O O - O OH DSPG , In some embodiments, the salt form of phosphatidylserine is highly soluble in ethanol. In some embodiments it is soluble at greater than 0.5 mg / ml, greater than 1 mg / mL, greater than 5 mg / mL, greater than 10 mg / mL, or greater than 20 mg / mL. In some embodiments, the salt is an ammonium salt. In some embodiments, the salt is ammonium itself, an alkylammonium, a dialkylammonium, or a trialkylammonium salt. In some embodiments, the amine is chosen from ammonia, dimethylamine, diethylamine, triethylamine, trimethylamine, 2- (dimethyamino)ethanol, diethanolamine, 2-(diethyamino)ethanol, ethanolamine, ethylenediamine, 17 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 N-methyl-glucamine, imidazole, histidine, lysine, arginine, 4-(2-hydroxyethyl)-morpholine, piperazine, 1-(2-hydroxyethyl)-pyrrolidine, triethanolamine, and tromethamine (tris(hydroxymethyl)aminomethane), In some embodiments, this targeting lipid is an ammonium salt of DPPS. Anionic phospholipids, separate from phosphatidyl-L-serine, were also considered as targeting lipids for LNPs. These include phosphatidylglycerol (PG), phosphatidic acid (PA), N- glutaryl-phosphatidylethanolamine (N-Glu-PE), N-succinyl-phosphatidylethanolamine (N-Suc- PE), and cardiolipin. In some embodiments, a LNP comprises anionic phospholipids, separate from phosphatidyl-L-serine, useful as targeting lipids for LNPs. In some embodiments, a LNP comprises anionic phospholipids selected from the group consisting of: phosphatidylglycerol (PG), phosphatidic acid (PA), N-glutaryl-phosphatidylethanolamine (N-Glu-PE), N-succinyl- phosphatidylethanolamine (N-Suc-PE), and cardiolipin. Distearoylphosphatidylglycerol (DSPG), dipalmitoyphosphatidylglycerol (DPPG), N-succinyl-distearoylphosphatidylethanolamine (N- Suc-DSPE), N-glutaryl-distearoylphosphatidylethanolamine (N-glu-DSPE), distearoylphosphatidic acid (DSPA), and cardiolipin are also provided as anionic phospholipids. In some embodiments, lipid nanoparticle (LNP) compositions comprising an ionizable cationic lipid compositions are provided. In some embodiments, lipid nanoparticle (LNP) compositions comprising an ionizable cationic lipid are provided. In some embodiments, the LNP composition comprises a mRNA nucleic acid. In some embodiments, a lipid nanoparticle (LNP) composition further comprises the PS lipid in a total amount of 2.5-10 mol% of the total lipid in the composition of the LNP. In some embodiments, a lipid nanoparticle (LNP) composition further comprises a PS lipid selected from the group consisting of: DSPS (L-isomer) and DPPS. In some embodiments, a lipid nanoparticle (LNP) composition comprises a conjugated lipid in a total amount of 0.5-2.0 mol% of the total lipid content of the LNP composition. In some embodiments, a lipid nanoparticle (LNP) composition comprises the conjugated lipid in a total amount of less than 2 mol% of the total lipid content of the LNP composition, and the conjugated lipid is PEG-DMG. In some embodiments, a lipid nanoparticle (LNP) composition comprises a nucleic acid; an ionizable lipid disclosed herein; a sterol; one or more phospholipids comprising a phosphatidylserine (PS) lipid; and optionally further comprising a conjugated lipid. In some embodiments, a lipid nanoparticle (LNP) composition comprises a mRNA nucleic acid; an 18 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 ionizable lipid disclosed herein; cholesterol; one or more phospholipids selected from the group consisting of: SM, DSPC, HSPC, DPPC and DOPC; and a PS lipid selected from the group consisting of: DPPS and DSPS; and optionally further comprising a conjugated lipid comprising PEG. In some embodiments, a nucleic acid lipid nanoparticle (LNP) composition comprises: a nucleic acid; an ionizable cationic lipid in a total amount of 40-65 mol% of the total lipid content of the LNP composition; a sterol in a total amount of 25-45 mol% of the total lipid content of the LNP composition; and one or more phospholipids in a total amount of phospholipids of 5-25 mol% of the total lipid content of the LNP composition, and comprising a phosphatidylserine (PS) in a total amount of 2.5-10 mol% of the total lipid content of the LNP composition; and optionally further comprising a conjugated lipid in a total amount of 0.5 – 2.5 mol% of the total lipid content of the LNP composition. In some embodiments, the LNP composition further comprises an anionic lipid selected from the group consisting of: DSPS (L-isomer), DPPS (L-isomer), DMPS (L-isomer), DOPS (L- isomer), and DSPS (D-isomer). Aspects of the disclosure relate to a lipid nanoparticle (LNP) composition comprising an ionizable lipid having the chemical structure: , 2, 3 or 4; R2and R3are each independently (C1-C4) alkyl optionally substituted with hydroxyl; and n is an integer equal to 2, 3 or 4. In some embodiments, n is 2 or 3. In some embodiments, a is 0. In some embodiments, b is 1, 2 or 3. In some embodiments, a is 1. In some embodiments, b is 1, 2 or 3. In some embodiments, R2and R3are each methyl. In some embodiments, R1is 19 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 , or 3. In some embodiments, n In some embodiments, the comprises a nucleic acid; the ionizable lipid described herein, a sterol; one or more phospholipids comprising a phosphatidylserine (PS) lipid; and optionally a conjugated lipid. In some embodiments, the nucleic acid is mRNA. In some embodiments, the sterol is cholesterol. In some embodiments, the one or more phospholipids consist of: one or more phospholipids selected from the group consisting of: SM, DSPC, HSPC, DPPC and DOPC; and a PS lipid selected from the group consisting of: DPPS, and DSPS. In some embodiments, the one or more phospholipids consist of: DSPC; and one or more PS lipids selected from the group consisting of (L-Serine) DPPS and (L-Serine) DSPS. In some embodiments, the composition comprises the PS lipid in a total amount of 2.5-10 mol% of the total lipid in the composition. In some embodiments, the conjugated lipid comprises PEG. Aspects of the disclosure relate to a nucleic acid lipid nanoparticle (LNP) composition comprising: a nucleic acid; an ionizable cationic lipid in a total amount of 40-65 mol% of the total lipid content of the LNP composition; a sterol in a total amount of 25-45 mol% of the total lipid content of the LNP composition; and one or more phospholipids in a total amount of phospholipids of 5-25 mol% of the total lipid content of the LNP composition, and comprising a phosphatidylserine (PS) in a total amount of 2.5-10 mol% of the total lipid content of the LNP composition; and optionally a conjugated lipid in a total amount of 0.5 – 2.5 mol% of the total lipid content of the LNP composition. In some embodiments, the nucleic acid is mRNA. In some embodiments, the sterol is cholesterol. In some embodiments, the one or more phospholipids consist of: DSPC and a L-serine PS. In some embodiments, the composition comprises the PS in a total amount of 2.5-7.5 mol% of the total lipid in the composition. 20 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 In some embodiments, the conjugated lipid comprises PEG. In some embodiments, conjugated lipid is PEG-DMG. In some embodiments, the LNP comprises the conjugated lipid in a total amount of 0.5-2.0 mol% of the total lipid content of the LNP composition. In some embodiments, the conjugated lipid in a total amount of less than 2 mol% of the total lipid content of the LNP composition. In some embodiments, the nucleic acid is a mRNA, the ionizable cationic lipid in a total amount of 45-55 mol% of the total lipid content of the LNP composition; a sterol is cholesterol in a total amount of 35-45 mol% of the total lipid content of the LNP composition; the total amount of phospholipid of 7-15 mol% of the total lipid content of the LNP composition; the one or more phospholipids consist of DSPC and the PS lipid is one or more lipids selected from the group consisting of the L-serine configuration of DPPS and DSPS; and the total amount of the PS lipid is about 5 mol% of the total lipid content of the LNP composition. In some embodiments, the composition comprises the PS lipid in a total amount selected from 1.25 mol%, 2.5 mol%, 5 mol%, 7.5 mol%, and 10 mol% of the total lipid content of the LNP composition. Aspects of the disclosure relate to a nucleic acid lipid nanoparticle (LNP) composition comprising: a nucleic acid, wherein the nucleic acid is mRNA; an ionizable cationic lipid, the ionizable cationic lipid in a total amount of 45-55 mol% of the total lipid content of the LNP composition; a sterol, wherein the sterol is cholesterol in a total amount of 35-45 mol% of the total lipid content of the LNP composition; one or more phospholipids, wherein the one or more phospholipids in a total amount of phospholipids of 10 mol% of the total lipid content of the LNP composition, and comprising a phosphatidylserine (PS) in a total amount of 3-9 mol% of the total lipid content of the LNP composition; and a conjugated lipid, the conjugated lipid in a total amount of 0.5 – 2.0 mol% of the total lipid content of the LNP composition. In some embodiments, the one or more phospholipid is selected from the group consisting of: DSPS (L-isomer), DPPS (L-isomer), DMPS (L-isomer), DOPS (L-isomer), and DSPS (D-isomer). In some embodiments, the conjugated lipid is PEG-DMG; and the PS lipid is selected from the group consisting of: DSPS (L-isomer) and DPPS. In some embodiments, the ionizable cationic lipid is one or more compounds selected from the group consisting of: KC3-OA, KC3-PA, KC3-C17 (8:1), and KC3-C15 (C8:1). In some 21 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 embodiments, the ionizable cationic lipid is KC3-PA. In some embodiments, the ionizable cationic lipid is KC3-OA. In some embodiments, the ionizable cationic lipid is KC3-C17 (C8:1). In some embodiments, the LNP comprises a nucleic acid; an ionizable cationic lipid in a total amount of 50 mol% of the total lipid content of the LNP composition; cholesterol in a total amount of 38.5 mol% of the total lipid content of the LNP composition; one or more phospholipids in a total amount of 7-15 mol% of the total lipid content of the LNP composition, and comprising a phosphatidylserine (PS) lipid in a total amount of 3-9 mol% of the total lipid content of the LNP composition; and a PEG-containing lipid in a total amount of 0.5 –2.0 mol% of the total lipid content of the LNP composition. In some embodiments, the phospholipids consist of one or more phospholipids selected from the group consisting of: DSPC, DOPC, DPPC, HSPC, and SM. In some embodiments, the PS lipid is one or more L-serine lipids selected from the group consisting of DPPS and DSPS. In some embodiments, the one or more phospholipids comprise at least two (L-Serine) PS lipids having mismatched acyl chain lengths. In some embodiments, the phospholipids are DSPC and DPPS. In some embodiments, the DSPC and DPPS are each present in the LNP at a total amount of 5 mol% each, based on the total lipid content of the LNP composition. Aspects of the disclosure relate to a nucleic acid lipid nanoparticle (LNP) composition comprising: a nucleic acid, ionizable cationic lipid KC3-PA or KC3-OA, and a (L-Serine) PS lipid in a total amount of 2.5-10 mol% of the total lipid content of the LNP composition. In some embodiments, the nucleic acid is mRNA, the PS lipid is (L-Serine) DSPS, (L-Serine) DPPS, or a mixture thereof, and the LNP composition further comprises cholesterol and a second phospholipid selected from the group consisting of: DSPC, DPPC, HSPC, and SM. In some embodiments, the LNP composition further comprises 0.5-2.0 mol% PEG-DMG or PEG-DSG, based on the total lipid content in the LNP composition. In some embodiments, the ionizable cationic lipid is KC3-PA. In some embodiments, the ionizable cationic lipid KC3-OA. Aspects of the disclosure relate to a nucleic acid lipid nanoparticle (LNP) composition comprising: a nucleic acid, a KC3-C17 (C8:1) ionizable cationic lipid; and a (L-Serine) PS lipid in a total amount of 2.5-10 mol% of the total lipid content of the LNP composition. 22 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 In some embodiments, the LNP composition has a N / P ratio 4 to 7. In some embodiments, the composition has a N / P ratio of 5 to 6. In some embodiments, the composition has a N / P ratio of 5.3. Aspects of the disclosure relate to a nucleic acid lipid nanoparticle (LNP) composition comprising: a nucleic acid, ionizable cationic lipid KC3-PA, and a (L-Serine) PS lipid in a total amount of 2.5-10 mol% of the total lipid content of the LNP composition. In some embodiments, the nucleic acid is mRNA, the PS lipid is (L-Serine) DSPS, (L-Serine) DPPS, or a mixture thereof, and the LNP composition further comprises cholesterol and a second phospholipid selected from the group consisting of: DSPC, DOPC, DPPC, HSPC, and SM. In some embodiments, the LNP composition further comprises 0.5-2.0 mol% PEG-DMG or PEG-DSG, based on the total lipid content in the LNP composition. Aspects of the disclosure relate to a nucleic acid lipid nanoparticle (LNP) composition comprising: a nucleic acid, an ionizable cationic lipid selected from KC3-C17 (C8:1); and a (L- Serine) PS lipid in a total amount of 2.5-10 mol% of the total lipid content of the LNP composition. In some embodiments, the N / P ratio is 4 to 7. In some embodiments, the N / P ratio is 5 to 6. In some embodiments, the N / P ratio is 3. In some embodiments, the N / P ratio is 7. In some embodiments, the nucleic acid is mRNA encoding SARS-CoV-2 spike protein. Aspects of the disclosure relate to a nucleic acid lipid nanoparticle (LNP) vaccine composition comprising: a mRNA nucleic acid with a N / P ratio of 4 to 7; an KC3-PA ionizable cationic lipid in a total amount of 40-65 mol% of the total lipid content of the LNP composition; cholesterol in a total amount of 25-40 mol% of the total lipid content of the LNP composition; a (L-Serine) PS lipid in a total amount of 2.5-10 mol% of the total lipid content of the LNP composition; DSPC phospholipid in a total amount of 5-25 mol% of the total lipid content of the LNP composition; and PEG-DMG in a total amount of 0-2.5 mol% of the total lipid content of the LNP composition. Aspects of the disclosure relate to a nucleic acid lipid nanoparticle (LNP) vaccine composition comprising: a mRNA nucleic acid with a N / P ratio of 3 to 8; a KC3-C17 (C8:1) ionizable cationic lipid in a total amount of 40-65 mol% of the total lipid content of the LNP composition; cholesterol in a total amount of 25-40 mol% of the total lipid content of the LNP composition; a (L-Serine) PS lipid in a total amount of 2.5-10 mol% of the total lipid content of the LNP composition; DSPC phospholipid in a total amount of 5-25 mol% of the total lipid content of the LNP composition; and PEG-DMG in a total amount of 0-2.5 mol% of the total lipid content of the LNP composition. 23 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 Aspects of the disclosure relate to a nucleic acid lipid nanoparticle (LNP) vaccine composition comprising: a mRNA nucleic acid with a N / P ratio of 4 to 7; a KC3-C15 (C8:1) ionizable cationic lipid in a total amount of 40-65 mol% of the total lipid content of the LNP composition; cholesterol in a total amount of 25-40 mol% of the total lipid content of the LNP composition; a (L-Serine) PS lipid in a total amount of 2.5-10 mol% of the total lipid content of the LNP composition; DSPC phospholipid in a total amount of 5-25 mol% of the total lipid content of the LNP composition; and PEG-DMG in a total amount of 0-2.5 mol% of the total lipid content of the LNP composition. Aspects of the disclosure relate to a nucleic acid lipid nanoparticle (LNP) vaccine composition comprising: a mRNA nucleic acid with a N / P ratio of 3 to 8; a KC3-C18 ionizable cationic lipid in a total amount of 40-65 mol% of the total lipid content of the LNP composition; cholesterol in a total amount of 25-40 mol% of the total lipid content of the LNP composition; a (L-Serine) PS lipid in a total amount of 2.5-10 mol% of the total lipid content of the LNP composition; DSPC phospholipid in a total amount of 5-25 mol% of the total lipid content of the LNP composition; and PEG-DMG in a total amount of 0-2.5 mol% of the total lipid content of the LNP composition. In some embodiments, the nucleic acid is a mRNA encoding a concatenated sequence of T- cell epitopes. In some embodiments, the mRNA encodes a concatenated sequence of MHC-II epitopes. In some embodiments, the mRNA encodes a concatenated sequence of MHC-I epitopes. Aspects of the disclosure relate to the use of a (L-Serine) PS lipid in combination with an ionizable cationic lipid described herein in the LNP for targeting of the LNP to dendritic cells. In some embodiments, the LNP comprises mRNA. In some embodiments, the LNP further comprises cholesterol. In some embodiments, the total amount of (L-Serine) PS lipid in the LNP is 2.5-10 mol% of the total lipid content of the LNP composition. In some embodiments, the LNP further comprises one or more additional phospholipids including DSPC. In some embodiments, the LNP further comprises a conjugated lipid. In some embodiments, the LNP comprises: a mRNA nucleic acid with a N / P ratio of 3 to 8; a KC3-PA or KC3-C17 (C8:1) ionizable cationic lipid (ICL), in a total amount of 40-65 mol% of the total lipid content of the LNP composition; cholesterol in a total amount of 25-40 mol% of the total lipid content of the LNP composition; a (L-Serine) PS lipid in a total amount of 2.5-10 mol% of the total lipid content of the LNP composition; DSPC phospholipid in a total amount of 5-25 mol% of the total lipid content of the LNP composition; and a conjugated lipid in a total amount of 0-2.5 mol% of the total lipid content of the LNP 24 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 composition. In some embodiments, the ICL is KC3-PA. In some embodiments, the ICL is KC3- C17 (C8:1). Some aspects of the disclosure relate to a lipid nanoparticle (LNP) composition comprising an ionizable lipid having the chemical structure: , 2, 3 or 4; R2and R3are each independently methyl; and n is an integer equal to 2 or 3. In some embodiments, a is 0. In some embodiments, b is 1. In some embodiments, b is 3. In some embodiments, a is 1. In some embodiments, b is 1. In some embodiments, b is 3. In some embodiments, n is 2. In some embodiments, n is 3. In some embodiments, the composition comprises an anionic lipid selected from the group consisting of: phosphatidylglycerol (PG), phosphatidic acid (PA), N-glutaryl- phosphatidylethanolamine (N-Glu-PE), N-succinyl-phosphatidylethanolamine (N-Suc-PE), and cardiolipin. Distearoylphosphatidylglycerol (DSPG), dipalmitoyphosphatidylglycerol (DPPG), N-succinyl-distearoylphosphatidylethanolamine (N-Suc-DSPE), N-glutaryl- distearoylphosphatidylethanolamine (N-glu-DSPE), distearoylphosphatidic acid (DSPA), and cardiolipin. In some embodiments, the composition comprises an anionic targeting phospholipid other than phosphatidyl-L-serine. In some embodiments, the composition comprises an anionic phospholipid selected from the group consisting of: DSPG and DPPG. In some embodiments, the composition comprises an anionic phospholipid selected from the group consisting of: N-Glu-DSPE and N-Suc-DSPE. 25 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 In some embodiments, the composition comprises a DSPA anionic phospholipid. In some embodiments, the composition comprises a Cardiolipin anionic phospholipid. In some embodiments, the ionizable lipid has the chemical structure: . lipid has the chemical structure: . to a sodium or ammonia salt of a composition of an anionic phospholipid of Formula (V-A-1), having the chemical structure: wherein X+is an ammonium cation or a sodium (Na+) cation; and a is 14, 15 or 16. In some embodiments, a is 14 or 16. In some embodiments, X+is ammonium cation (NH4+). In some embodiments, X+is sodium cation (Na+) In some embodiments, X is an ammonium cation selected from the group consisting of: ammonium (NH4+), an alkylammonium, a dialkylammonium, and a trialkylammonium salt. In some embodiments, X is X is an ammonium cation selected from the group consisting of: ammonium, dimethylamine, diethylamine, triethylamine, trimethylamine, 2- (dimethyamino)ethanol, diethanolamine, 2-(diethyamino)ethanol, ethanolamine, ethylenediamine, 26 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 N-methyl-glucamine, imidazole, histidine, lysine, arginine, 4-(2-hydroxyethyl)-morpholine, piperazine, 1-(2-hydroxyethyl)-pyrrolidine, triethanolamine, and tromethamine (tris(hydroxymethyl)aminomethane). In some embodiments, the anionic phospholipid of Formula (V-A-1) is a sodium salt of distearoylphosphatidyl-L-serine (DSPS L-isomer). In some embodiments, the anionic phospholipid of Formula (V-A-1) is an ammonium salt of distearoylphosphatidyl-L-serine (DSPS L-isomer). In some embodiments, the anionic phospholipid of Formula (V-A-1) is a sodium salt of DPPS (L-isomer). In some embodiments, the anionic phospholipid of Formula (V-A-1) is an ammonium salt of DPPS (L-isomer). Some embodiments relate to the use of the salt form composition of any one of claims 90-97 in the preparation of a liposomal nanoparticle (LNP) composition. In some embodiments, the use is in combination with one or more of the following LNP components during the preparation of the LNP composition: a mRNA nucleic acid; an ionizable cationic lipid (ICL); cholesterol; a (L-Serine) PS lipid; one or more phospholipids; and a conjugated lipid. In some embodiments, the use comprises the step of combining the ammonium or salt form of a compound of Formula (V-A-1) with one or more of the following LNP components during the preparation of the LNP composition: a mRNA nucleic acid; an ionizable cationic lipid (ICL) of any one of claims 1-9 or 73-88; cholesterol; a (L-Serine) PS lipid; one or more phospholipids; and a conjugated lipid. In some embodiments, the LNP is a nucleic acid lipid nanoparticle vaccine composition comprising: a mRNA nucleic acid with a N / P ratio of 4 to 7; an ionizable cationic lipid of any one of claims 1-9 or 73-88 in a total amount of 40-65 mol% of the total lipid content of the LNP composition; cholesterol in a total amount of 25-40 mol% of the total lipid content of the LNP composition; a (L-Serine) PS lipid in a total amount of 2.5-10 mol% of the total lipid content of the LNP composition; DSPC phospholipid in a total amount of 5-25 mol% of the total lipid content of the LNP composition; and PEG-DMG in a total amount of 0-2.5 mol% of the total lipid content of the LNP composition. In some embodiments, the LNP composition comprises the ionizable cationic lipid in a total amount of 46-65 mol% of the total lipid content of the LNP composition. In some embodiments, the LNP composition comprises the PS in a total amount of about 5 mol% of the total lipid in the composition. In some embodiments, the LNP composition comprises the conjugated lipid in a total amount of about 1.5 mol% of the total lipid content of the LNP composition. 27 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 In some embodiments, the conjugated lipid is PEG-DMG; and the PS lipid is selected from the group consisting of: DSPS (L-isomer) and DPPS. In some embodiments, the ionizable cationic lipid is one or more compounds selected from the group consisting of: KC3-OA, KC3-PA, KC3-C17 (C8:1), and KC3-C15 (C8:1). In some embodiments, the ionizable cationic lipid is KC3-PA. In some embodiments, the ionizable cationic lipid is KC3-OA. In some embodiments, the ionizable cationic lipid is KC3-C17 (C8:1). Some embodiments relate to the use of a (L-Serine) PS lipid in combination with an ionizable cationic lipid described herein in the LNP for targeting of the LNP to dendritic cells. In some embodiments, the LNP comprises mRNA. In some embodiments, the LNP further comprises cholesterol. In some embodiments, the total amount of (L-Serine) PS lipid in the LNP is 2.5-10 mol% of the total lipid content of the LNP composition. In some embodiments, the LNP further comprises one or more additional phospholipids including DSPC. In some embodiments, the LNP further comprises a conjugated lipid. In some embodiments, the LNP comprises: a mRNA nucleic acid with a N / P ratio of 3 to 8; a KC3-PA or KC3-C17 (C8:1) ionizable cationic lipid (ICL), in a total amount of 40-65 mol% of the total lipid content of the LNP composition; cholesterol in a total amount of 25-40 mol% of the total lipid content of the LNP composition; a (L-Serine) PS lipid in a total amount of 2.5-10 mol% of the total lipid content of the LNP composition; DSPC phospholipid in a total amount of 5-25 mol% of the total lipid content of the LNP composition; and a conjugated lipid in a total amount of 0-2.5 mol% of the total lipid content of the LNP composition. In some embodiments, the ICL is KC3-PA. In some embodiments, the ICL is KC3-C17 (C8:1). In some embodiments, the composition comprises an anionic phospholipid selected from the group consisting of: DSPG and DPPG, in a total amount of 2.5-7.5% of the total lipid content of the LNP composition. In some embodiments, the composition comprises DSPG anionic phospholipid in a total amount of 2.5-7.5% of the total lipid content of the LNP composition. In some embodiments, the composition comprises DPPG anionic phospholipid in a total amount of 2.5-7.5% of the total lipid content of the LNP composition. In some embodiments, the LNP further comprises one or more additional phospholipids including DSPC. Aspects of the disclosure relate to a nucleic acid lipid nanoparticle (LNP) composition comprising: a nucleic acid; a KC3 ionizable cationic lipid in a total amount of 40-65 mol% of the 28 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 total lipid content of the LNP composition; cholesterol in a total amount of 23.5 - 43.5 mol% of the total lipid content of the LNP composition; a (L-Serine) PS lipid in a total amount of 2.5-10 mol% of the total lipid content of the LNP composition; DSPC or HSPC phospholipid in a total amount of 5-25 mol% of the total lipid content of the LNP composition; and a PEG-containing conjugated lipid in a total amount of 0.5 mol% to 2.5 mol% of the total lipid content of the LNP composition. In some embodiments, the nucleic acid is mRNA. In some embodiments, the N / P ratio is 3 to 8. In some embodiments, the KC3 ionizable cationic lipid is selected from the group consisting of: KC3-OA, KC3-PA, KC3-C17 (8:1), and KC3-C15 (C8:1). In some embodiments, the KC3 ionizable cationic lipid is KC3-OA. In some embodiments, the KC3 ionizable cationic lipid is KC3-PA. In some embodiments, the KC3 ionizable cationic lipid is KC3-C17(C8:1). In some embodiments, the KC3 ionizable cationic lipid is KC3-C15(C8:1). In some embodiments, the conjugated lipid is PEG-DMG or PEG-DSG. In some embodiments, the composition comprises the PEG-containing conjugated lipid in a total amount of 0.5 –2.0 mol% of the total lipid content of the LNP composition. In some embodiments, the composition comprises the KC3 ionizable cationic lipid in a total amount of 48 mol% of the total lipid content of the LNP composition. In some embodiments, the composition comprises DSPC and DSPS in a total amount of 10 mol% of the total lipid content of the LNP composition. In some embodiments, the composition comprises 5 % DSPC or HSPC in a total amount of 5 mol% of the total lipid content of the LNP composition. In some embodiments, the composition comprises PEG-DMG in a total of 1.5 mol % of the total lipid content of the LNP composition. In some embodiments, the composition comprises cholesterol in a total amount of 40.5 mol % cholesterol of the total lipid content of the LNP composition. In some embodiments, the composition comprises the DSPC phospholipid in a total amount of 10 mol% of the total lipid content of the LNP composition. In some embodiments, the PEG-containing conjugated lipid is PEG2000-DMG. In some embodiments, the composition comprises the cholesterol in a total amount of 23.5 mol% of the total lipid content of the LNP composition. In some embodiments, the composition 29 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 comprises the cholesterol in a total amount of 33.5 mol% of the total lipid content of the LNP composition. In some embodiments, the composition comprises the cholesterol in a total amount of 38.5 mol% of the total lipid content of the LNP composition. In some embodiments, the composition comprises the cholesterol in a total amount of 40.5 mol% of the total lipid content of the LNP composition. In some embodiments, the composition comprises the cholesterol in a total amount of 42.7 mol% of the total lipid content of the LNP composition. In some embodiments, the composition comprises the cholesterol in a total amount of 43.5 mol% of the total lipid content of the LNP composition. In some embodiments, the composition comprises the cholesterol in a total amount of 33.5-43.5 mol% of the total lipid content of the LNP composition. In some embodiments, the composition comprises the KC3 ionizable cationic lipid in a total amount of 45- 55 mol% of the total lipid content of the LNP composition. Aspects of the disclosure relate to a nucleic acid lipid nanoparticle (LNP) composition comprising: a mRNA nucleic acid; a KC3 ionizable cationic lipid selected from the group consisting of: KC3-OA, KC3-PA, KC3-C17 (8:1), and KC3-C15 (C8:1), in a total amount of 45- 55 mol% of the total lipid content of the LNP composition; cholesterol in a total amount of 33.5- 43.5 mol% of the total lipid content of the LNP composition; a (L-Serine) DPPS lipid in a total amount of 5 mol% of the total lipid content of the LNP composition; DSPC or HSPC phospholipid in a total amount of 5 mol% of the total lipid content of the LNP composition; and a PEG-DMG conjugated lipid in a total amount of 1.5 mol% of the total lipid content of the LNP composition. Aspects of the disclosure relate to a lipid nanoparticle (LNP) composition comprising a KC3 ionizable cationic lipid, a (L-Serine) PS lipid, cholesterol, one or more phospholipids comprising at least one anionic phospholipid, and a conjugated lipid, wherein the LNP is obtained by a process comprising the step of dissolving a sodium or ammonium salt of the anionic phospholipid. In some embodiments, the composition comprises a nucleic acid. In some embodiments, the nucleic acid is mRNA. In some embodiments, the composition is a vaccine. In some embodiments, the composition is an injectable vaccine composition. In some embodiments, the total amount of phospholipids in the composition is 5-25 mol% of the total lipid content of the LNP composition, and the total amount of the phosphatidylserine (PS) is 2.5-10 mol% of the total lipid content of the LNP composition; and the total amount of the 30 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 conjugated lipid in the composition is a total amount of 0.5 – 2.5 mol% of the total lipid content of the LNP composition. In some embodiments, the composition comprises 48 mol% of the KC3 ionizable cationic lipid, 40.5 mol% cholesterol, and 5 mol% (L-Serine) DPPS lipid, wherein each mol% refers to the mol% of the total lipid content of the LNP composition. In some embodiments, the composition comprises 48 mol% of the KC3 ionizable cationic lipid, 38.5 mol% cholesterol, and 5 mol% (L-Serine) DPPS lipid, wherein each mol% refers to the mol% of the total lipid content of the LNP composition. In some embodiments, the composition comprises 46-54 mol% of the KC3 ionizable cationic lipid, and 5 mol% (L-Serine) DPPS lipid, wherein each mol% refers to the mol% of the total lipid content of the LNP composition. In some embodiments, the composition comprises 45 mol% of the KC3 ionizable cationic lipid, 42.7 mol% cholesterol, and 5 mol% (L-Serine) DPPS lipid, wherein each mol% refers to the mol% of the total lipid content of the LNP composition. In some embodiments, the composition comprises 50 mol% of the KC3 ionizable cationic lipid, 38.5 mol% cholesterol, 5 mol% (L-Serine) DPPS lipid, and a total of 10 mol% phospholipid concentration; wherein each mol% refers to the mol% of the total lipid content of the LNP composition. In some embodiments, the composition comprises 48 mol% of the KC3 ionizable cationic lipid, 40.5 mol% cholesterol, 5 mol% (L-Serine) DPPS lipid, and a total of 10 mol% phospholipid concentration; wherein each mol% refers to the mol% of the total lipid content of the LNP composition. In some embodiments, the composition comprises 48 mol% of the KC3 ionizable cationic lipid, 40.5 mol% cholesterol, 5 mol% (L-Serine) DPPS lipid, 5 mol% DSPC or DPPC; and a total of 10 mol% phospholipid concentration; wherein each mol% refers to the mol% of the total lipid content of the LNP composition. In some embodiments, the composition comprises 46.5 mol% of the KC3 ionizable cationic lipid, 42 mol% cholesterol, 5 mol% (L-Serine) DPPS lipid, wherein each mol% refers to the mol% of the total lipid content of the LNP composition. In some embodiments, the composition further comprises a total of 5 mol% DSPC or HSPC of the total lipid content of the LNP composition. 31 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 In some embodiments, the composition further comprises a total of 1.5 mol% PEG-DMG of the total lipid content of the LNP composition. In some embodiments, the composition comprises a total of 10 mol% of DSPC / DPPC phospholipid of the total lipid content of the LNP composition. Aspects of the disclosure relate to a phosphatidylserine salt selected from the group consisting of DSPS sodium, DPPS sodium, DSPS ammonium and DPPS ammonium. Aspects of the disclosure relate to the use of a DSPS-Na salt or a DPPS-NH4+salt in the preparation of a LNP comprising a (L-Serine) PS lipid, a sterol, a conjugated lipid, a phospholipid for targeting the LNP to dendritic cells. Aspects of the disclosure relate to a solution comprising ethanol and DSPS or DPPS, the solution obtained by a process comprising the step of dissolving a phosphatidylserine salt in ethanol, wherein the phosphatidylserine salt is selected from the group consisting of DSPS sodium, DPPS sodium, DSPS ammonium and DPPS ammonium. BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1A Impact of DSPS inclusion from 0-2.5 mol % on transfection efficiency of dendritic cells (MutuDC1940) using mCherry mRNA LNPs formulated with DLin-KC2-DMA as the ionizable cationic lipid. ICL was kept at 50 mol%, cholesterol at 38.5 mol%, PEG-DMG at 1.5 mol% and the DSPS content varied. Inclusion of DSPS was made by reducing the DSPC content by the same mol% of DSPS that was added. Cells were incubated with each formulation at a concentration of 1 ug mRNA / mL for 24 h. UT sample corresponds to cells where no LNPs were added. Lipofect refers to Lipofectamine treated sample. FIG. 1B Impact of DSPS inclusion from 0-7.5 mol % on transfection efficiency of dendritic cells (MutuDC1940) using mCherry mRNA LNPs formulated with DLin-KC2-DMA as the ionizable cationic lipid. ICL was kept at 50 mol%, cholesterol at 38.5 mol%, PEG-DMG at 1.5 mol% and the DSPS content varied. Inclusion of DSPS was made by reducing the DSPC content by the same mol% of DSPS that was added. Cells were incubated with each formulation at a concentration of 1 ug mRNA / mL for 24 h. UT sample corresponds to cells where no LNPs were added. Lipofect refers to Lipofectamine treated sample. FIG. 1C Impact of DSPS inclusion from 0-7.5 mol % on transfection efficiency of dendritic cells (MutuDC1940) using mCherry mRNA LNPs formulated with DLin-KC2-DMA as the ionizable cationic lipid. ICL was kept at 50 mol%, cholesterol at 38.5 mol%, PEG-DMG at 32 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 1.5 mol% and the DSPS content varied. Inclusion of DSPS was made by reducing the DSPC content by the same mol% of DSPS that was added. Cells were incubated with each formulation at a concentration of 0.3 ug mRNA / mL for 24 h. UT sample corresponds to where no LNPs were added. FIG. 1D Impact of DSPS inclusion from 0-7.5 mol % on transfection efficiency of dendritic cells (MutuDC1940) using mCherry mRNA LNPs formulated with DLin-KC2-DMA as the ionizable cationic lipid. ICL was kept at 50 mol%, cholesterol at 38.5 mol%, PEG-DMG at 1.5 mol% and the DSPS content varied. Inclusion of DSPS was made by reducing the DSPC content by the same mol% of DSPS that was added Cells were incubated with each formulation at a concentration of 0.1 ug mRNA / mL for 24 h. UT sample corresponds to cells where no LNPs were added. FIG. 2 Transfection of murine dendritic cells (MutuDC1940) using LNPs containing various ICLs (KC2, KC2-OA, KC3-OA, and SM-102) and 5 mol % DSPS, and comparison to LNPs using Glu-DSPE or Suc-DSPE rather than DSPS. UT sample corresponds to cells where no LNPs were added. FIG.3 DSPS or DPPS increase mCherry LNP transfection with KC2, KC2-01, KC2-PA, KC3-01, and KC3-OA comprising ICLs. UT sample corresponds to cells where no LNPs were added. FIG. 4 Impact of PEG-DMG concentration in AUG-UO-1 containing LNPs with and without 5 mol % DSPS on transfection of dendritic cells. The Y-axis shows the % PEG used in the composition followed by the concentration of mRNA added to the cells (0.11, 0.33, or 1 µg / mL). UT sample corresponds to cells where no LNPs were added. FIG.5A Effect of N / P on mCherry expression of KC2-01 containing LNPs at 1 µg / ml in murine dendritic cells. UT sample corresponds to cells where no LNPs were added. FIG.5B Effect of N / P on mCherry expression of KC2-01 containing LNPs at 0.33 µg / ml in murine dendritic cells. UT sample corresponds to cells where no LNPs were added. FIG.6 Transfection efficiency of LNP formulations containing various concentrations of DOPS (0, 10, and 25 mol % as % of total lipid) and mCherry mRNA in murine dendritic cells. FIG. 7A mRNA sequence of VRN-029, a SARS-COV2 spike protein generating sequence. 33 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 FIG. 7B The effect of PEG-DMG (C14) concentration (mol %) on LNP vaccine immunogenicity. Total anti-spike antibody titers and CD4 responses from mice immunized with mRNA-LNPs using 7.5% DSPS and the ionizable lipid UO1 with increasing mol% of PEG-DMG. The middle graph shows day 34 endpoint antibody titers. The right graph shows the corresponding CD4 T cell responses. FIG. 7C The effect of PEG-DPPE (C16) concentration (mol %) on LNP vaccine immunogenicity. Total anti-spike antibody titers from mice immunized with mRNA-LNPs using 7.5% DSPS and the ionizable lipid UO1 with increasing mol% of PEG-DPPE. The middle graph shows day 34 endpoint antibody titers. The mol% of PEG-DPPE inversely impacted antibody levels. The right graph shows the corresponding CD4 T cell responses. FIG. 7D Total anti-spike antibody titers and CD4 responses from mice immunized with mRNA-LNPs using 7.5% DSPS and the ionizable lipid KC2OA with either 1.5 mol% PEG-DMG (14C) or PEG-DSG (18C). The left graph shows day 34 endpoint antibody titers. The right graph shows the corresponding CD4 T cell responses. FIG. 7E Total anti-spike antibody titers and CD4 responses from mice immunized with mRNA-LNPs using 7.5% DSPS and the ionizable lipid UO1 with either 1.5 mol% PEG-DMG (14C) or PEG-DSG (18C). The left graph shows day 34 endpoint antibody titers. The right graph shows the corresponding CD4 T cell responses. FIG.7F Effect of phosphatidylserine incorporation in mRNA-LNP immunogenicity. Total anti-spike antibody titers (A) and spike-specific CD4 T cell responses from mice immunized with mRNA-LNPs using various ionizable lipids and PEG-lipids plus / minus 7.5 mol% DSPS Antibody data were log-transformed and analyzed using two-way ANOVA with a Sidak’s multiple comparison test. CD4 T cell data were analyzed using a REML mixed-effects model with a Sidak’s multiple comparison test. FIG.7G Effect of phosphatidylserine lipid tail (DPPS vs DSPS) composition on mRNA- LNP priming of B (Panel A) and T cell (Panel B) responses. Antibody data were log-transformed prior to analysis. Data were analyzed using one-way ANOVA with a Tukey’s multiple comparison test. FIG. 8A Comparison of the mCherry expression of KC2-01 LNPs, 7.5 mol% DSPS (D isomer) and DSPS (L isomer) at 1 µg / mL mRNA for 24h. 34 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 FIG. 8B Comparison of the mCherry expression of KC2-01 LNPs, 7.5 mol% DSPS (D isomer) and DSPS (L isomer) at 0.33 µg / mL mRNA for 24h. FIG.9 Comparison of the mCherry expression of KC2 LNPs, with 5 and 7.5 mol% DSPS (L-isomer) to LNPs prepared with SM-102 or ALC-0315 at 1 µg / mL mRNA for 24h. The Y-axis is mean fluorescence intensity (MFI). UT sample corresponds to cells where no LNPs were added. FIG.10 Comparison of the mCherry expression of UO1, SM102, ALC-0315 formulations alone, or with added DSPS, at 1 µg / mL mRNA for 24h. Lipo refers to Lipofectamine MessengerMax (ThermoFisher) used according to manufacturer’s instructions at the same dosage level as the LNPs. UT sample corresponds to cells where no LNPs were added. FIG. 11 Oxidative degradation of liposomes containing KC3 (DLin-KC3-DMA), a polyunsaturated ICL with a single methylene between two olefins, to liposomes containing ICLs with monounsaturated alkyl chains (KC3-OA, KC3-PA, or KC3-C17(C8:1)) and the fully saturated ICL, KC3-C17. Effect of hydrogen peroxide on the stability of individual ionizable cationic lipids measured by CAD-HPLC. FIG. 12 Comparison of the mCherry expression in murine dendritic cells of LNPs containing the polyunsaturated KC3, the monounsaturated KC3-OA, KC3-PA, or KC3C17(C8:1), and the fully saturated KC3C17, all with or without DPPS (NH4+salt), at 0.3 or 1 µg / mL mRNA for 24h. UT sample corresponds to cells where no LNPs were added. FIG. 13 Comparison of the mCherry expression in human dendritic cells of LNPs containing the polyunsaturated KC2 or KC3 with a single methylene between two olefins, polyunsaturated KC3-01 with four methylenes between two olefins, monounsaturated KC3-OA, KC3-PA, or KC3C17(C8:1), and ALC-0315, all with except ALC-0315 with DPPS (NH4+salt), at 0.1 or 1 µg / mL mRNA for 24h. Untreated samples correspond to cells where no LNPs were added. FIG.14 Comparison of the mCherry expression of LNP formulations with 5 mol % DSPS and 46-54 mol % of KC3-OA to ALC-0315 and SM-102 LNP controls, at 0.1 and 1 µg / mL mRNA for 24h in human dendritic cells. Untreated DC sample corresponds to human dendritic cells where no LNPs were added. FIG.15 Comparison of the mCherry expression of LNP formulations with 0 or 5 mol % DSPS and 50 mol % KC2-O1 at N / P ratios of 4-7, at 0.1 µg / mL mRNA for 24h in human dendritic 35 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 cells. These were also compared to LNPs containing KC3-OA and 5 mol % DSPS at N / P of 5. Untreated DC sample corresponds to human dendritic cells where no LNPs were added. FIG.16A Comparison of polyunsaturated KC3 with monounsaturated KC3-OA and KC3- PA containing LNP formulations on vaccine immunogenicity. Total anti-spike antibody titers from mice immunized with mRNA-LNPs using 5 mol % DSPS or DPPS-targeted LNPs containing either KC3, KC3-OA, or KC3-PA. For KC3-OA and KC3-PA LNPs, each formulation was also evaluated with either the C16 DPPC or C18 DSPC neutral phosphatidylcholine component. All LNPs contained 1.5 mol % of PEG-DMG. The graph shows day 21 endpoint antibody titers after the initial prime injection of 1 µg mRNA per mouse. FIG.16B Comparison of polyunsaturated KC3 with monounsaturated KC3-OA and KC3- PA containing LNP formulations on vaccine immunogenicity. Total anti-spike antibody titers from mice immunized with mRNA-LNPs using 5 mol % DSPS or DPPS-targeted LNPs containing either KC3, KC3-OA, or KC3-PA. For KC3-OA and KC3-PA LNPs, each formulation was also evaluated with either the C16 DPPC or C18 DSPC neutral phosphatidylcholine component. All LNPs contained 1.5 mol % of PEG-DMG. The graph shows day 34 endpoint antibody titers after the prime then boost on day 21 of 1 µg mRNA per mouse. FIG. 17A Comparison of the mCherry expression of LNP formulations with 5 mol % DSPS and 43-48 mol % of KC3-OA to ALC-0315 and SM-102 LNP controls, at 1 µg / mL mRNA for 24h in human dendritic cells KC3-OA LNPs prepared at 45 mol % KC3-OA and 5 mol % DSPS of total lipid were also compared at N / P ratios of 5, 5.5, 6.0, and 6.5. Finally, LNPs with 45 mol % KC3-OA at N / P of 5 and 6 were evaluated with PEG-SA, at either 1 or 3 mol %, in place of 1.5 mol % PEG-DMG. Untreated DC sample corresponds to human dendritic cells where no LNPs were added. FIG. 17B Comparison of the mCherry expression of LNP formulations with 5 mol % DSPS and 43-48 mol % of KC3-OA to ALC-0315 and SM-102 LNP controls, at 0.1 µg / mL mRNA for 24h in human dendritic cells KC3-OA LNPs prepared at 45 mol % KC3-OA and 5 mol % DSPS of total lipid were also compared at N / P ratios of 5, 5.5, 6.0, and 6.5. Finally, LNPs with 45 mol % KC3-OA at N / P of 5 and 6 were evaluated with PEG-SA, at either 1 or 3 mol %, in place of 1.5 mol % PEG-DMG. Untreated DC sample corresponds to human dendritic cells where no LNPs were added. 36 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 FIG. 18A Comparison of the mCherry expression of UO-1 or KC3-01 containing LNP formulations with 0-10 mol % of DSPG in human dendritic cells following incubation for 24 h at 1 µg / mL mRNA. ALC-0315 and SM-102 LNPs controls were also included at 1 µg / mL mRNA and untreated DC sample corresponds to human dendritic cells where no LNPs were added. FIG. 18B Comparison of the mCherry expression of UO-1 or KC3-01 containing LNP formulations with 0-10 mol % of DSPG in human dendritic cells following incubation for 24 h at 0.1 µg / mL mRNA. ALC-0315 and SM-102 LNPs controls were also included at 0.1 µg / mL mRNA and untreated DC sample corresponds to human dendritic cells where no LNPs were added. FIG.19 Comparison of dilinoleyl KC2, monounsaturated KC3-OA, and four methylene interrupted poly unsaturated ICLs (KC3-01, AKG-UO1, and AKG-UO9) containing LNP formulations on vaccine immunogenicity. ALC-0315 containing LNPs were included as a control. All LNPs contained 1.5 mol % of PEG-DMG. Total anti-spike antibody titers from mice immunized with mRNA-LNPs were determined on day 21 after the initial prime injection of 1 µg mRNA per mouse on day 1. FIG.20A Comparison of the mCherry expression of 48 mol % KC3-OA containing LNP formulations with 5 mol % of various anionic phospholipids in human dendritic cells following incubation for 24 h at 1 µg / mL mRNA. All LNPs included 2.5 mol % of DSPC, 50 mol % of UO- 1, and 1.5 mol % of PEG-DMG. The anionic phospholipids included the phosphatidylglycerols, DOPG, DSPG, DPPG, and DMPG, as well as DSPS. In some LNPs, the DSPG and DSPS were combined either alone or together with DSPC. Two donors were used to produce human dendritic cells in this study and untreated DC sample corresponds to human dendritic cells where no LNPs were added. FIG.20B Comparison of the mCherry expression of 48 mol % KC3-OA containing LNP formulations with 5 mol % of various anionic phospholipids in human dendritic cells following incubation for 24 h at 0.1 µg / mL mRNA. All LNPs included 2.5 mol % of DSPC, 50 mol % of UO-1, and 1.5 mol % of PEG-DMG. The anionic phospholipids included the phosphatidylglycerols, DOPG, DSPG, DPPG, and DMPG, as well as DSPS. In some LNPs, the DSPG and DSPS were combined either alone or together with DSPC. Two donors were used to produce human dendritic cells in this study and untreated DC sample corresponds to human dendritic cells where no LNPs were added. 37 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 FIG. 21 Comparison of the mCherry expression in murine dendritic cells of LNPs containing KC3-OA LNPs with either 5 mol % DSPS (Na+salt) or 5 mol % DPPS (NH4+salt) after incubation at 1 µg / mL mRNA for 24h. ALC-0315 and SM-102 LNPs controls were also included at 1 µg / mL mRNA. UT sample corresponds to cells where no LNPs were added. FIG. 22A Immunogenicity of mRNA-LNPs vaccines encoding Mtb antigens containing four unique signal peptides and comparison of KC3OA / DPPS and ALC-0315 LNP formulations. Mtb-specific CD4 T cells were defined as any cell that produced either of these 3 cytokines following peptide stimulation. FIG. 22B Immunogenicity of mRNA-LNPs vaccines encoding Mtb antigens containing four unique signal peptides and comparison of KC3OA / DPPS and ALC-0315 LNP formulations. Mtb-specific CD8 T cells were identified as any cell that produced IFN-γ; TNF-α and IL-2 producing CD8 T cells were found within the IFN-γ-producing population. FIG.23A Proportion of total vaccine-induced T cell response to individual or subsets of Mtb antigens. Data correspond to cumulative T cell responses shown in Figure 22 and are normalized to 100%. Profile of CD4 T cell responses using the ALC-0315 comparator. FIG.23B Proportion of total vaccine-induced T cell response to individual or subsets of Mtb antigens. Data correspond to cumulative T cell responses shown in Figure 22 and are normalized to 100%. Profile of CD4 T cell responses using the KC3-OA / DPPS LNP formulation. FIG. 23C Proportion of total vaccine-induced T cell response to individual or subsets of Mtb antigens. Data correspond to cumulative T cell responses shown in Figure 22 and are normalized to 100%. Profile of CD8 T cell responses using the ALC-0315 comparator. FIG. 23D Proportion of total vaccine-induced T cell response to individual or subsets of Mtb antigens. Data correspond to cumulative T cell responses shown in Figure 22 and are normalized to 100%. Profile of CD8 T cell responses using the KC3-OA / DPPS LNP formulation. FIG.24A Cytokine polyfunctionality of vaccine-specific CD4 T cells where CD4 T cell responses were induced by the mRNA incorporating sec / MITD targeting of nascent proteins to the endosomal compartment and signal peptide / transmembrane domain into the LNP formulation. Concatenated CD4 T cell responses across peptide pools were Boolean gated on cells that produced IFN-γ, IL-2 and TNF-α. SP, single producer; DP, double producer; TP, triple producer. FIG.24B Cytokine polyfunctionality of vaccine-specific CD4 T cells where CD4 T cell responses were induced by the mRNA incorporating the LAMP-1 targeting of nascent proteins to 38 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 the late endosomal / lysosomal compartment into the LNP formulation. Concatenated CD4 T cell responses across peptide pools were Boolean gated on cells that produced IFN-γ, IL-2 and TNF- α. SP, single producer; DP, double producer; TP, triple producer. FIG. 24C Cytokine polyfunctionality of vaccine-specific CD4 T cells where CD4 T cell responses were induced by the mRNA using the tPA signal peptide that directs proteins to be secreted into the LNP formulation. Concatenated CD4 T cell responses across peptide pools were Boolean gated on cells that produced IFN-γ, IL-2 and TNF-α. SP, single producer; DP, double producer; TP, triple producer. FIG.25A Total CD4 T cell responses (cell IFN-γ) induced by mRNA delivered with the KC3- OA / DPPS or ALC-0315 LNP formulation. Data correspond to cumulative T cell responses shown in Figure 22. Mtb-specific T cell responses were concatenated across peptide pools. FIG.25B Total CD8 T cell responses (cell IFN-γ) induced by mRNA delivered with the KC3- OA / DPPS or ALC-0315 LNP formulation. Data correspond to cumulative T cell responses shown in Figure 22. Mtb-specific T cell responses were concatenated across peptide pools. FIG. 26A Comparison of BCG (s.c.) with KC3-OA / DPPS LNP (i.m.) CD4 T cell responses to individual Mtb antigens. Stim 1: EsxH / TB10.4 and Ag85B peptide pools, Stim 2: Mtb39a peptide pool, Stim 3: EsxW and EsxV peptide pools, Stim 4: EsxB / CFP10 and EsxA / ESAT-6 peptide pools, Stim 5: C-terminal set of ten tandem 15mer minimal epitope peptide pool. Mtb-specific CD4 T cells were defined as cells expressing IFN-γ, TNF-α, IL-2, IL-17a or combinations thereof. FIG. 26B Comparison of BCG (s.c.) with KC3-OA / DPPS LNP (i.m.) CD4 T cell responses. Cumulative CD4 T cell response from all peptide stimulations (Sim 1 + Stim 2 + Stim 3 + Stim 4 + Stim 5 – background). Mtb-specific CD4 T cells were defined as cells expressing IFN-γ, TNF-α, IL-2, IL-17a or combinations thereof. FIG. 27A Comparison of BCG (s.c.) with KC3-OA / DPPS LNP (i.m.) CD8 T cell responses to individual Mtb antigens. Stim 1: EsxH / TB10.4 and Ag85B peptide pools, Stim 2: Mtb39a peptide pool, Stim 3: EsxW and EsxV peptide pools, Stim 4: EsxB / CFP10 and EsxA / ESAT-6 peptide pools, Stim 5: C-terminal set of ten tandem 15mer minimal epitope peptide pool. Mtb-specific CD8 T cells expressing IFN-γ, TNF-α, IL-2, IL-17a or combinations thereof. 39 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 FIG. 27B Comparison of BCG (s.c.) with KC3-OA / DPPS LNP (i.m.) CD8 T cell responses. Cumulative CD8 T cell response from all peptide stimulations (Sim 1 + Stim 2 + Stim 3 + Stim 4 + Stim 5 – background). FIG.28 Vaccination with three different mRNA constructs encoding putative human MHC class I-restricted Mtb epitopes in a string-on-bead format generates antigen-specific CD8 T cell responses in CB6F1 mice. FIG.29A Kinetics of vaccine-specific T cell responses. CB6F1 mice were immunized with mRNA encoding for an HLA-II directed fusion protein consisting of 7 Mtb proteins plus 10 minimal epitopes; the antigen was flanked with sec / MITD sequences (SEQ ID NOs.37 and 38), encapsulated in KC3-OA / DPPS LNPs and boosted 4 weeks later. The cumulative CD4 and CD8 T cell responses to all peptide pools are shown. FIG.29B Kinetics of vaccine-specific CD8 T-cell responses following immunization with mRNA encoding putative human MHC class I Mtb epitopes encapsulated in KC3-OA / DPPS LNPs and boosted 4 weeks later. The cumulative CD8 T cell responses to all peptide pools are shown. FIG.30A Comparison of CD4 T cell responses between a 1stand 2ndgeneration HLA-II Mtb mRNA vaccine construct encapsulated in KC3-OA / DPPS LNPs showing the cumulative total of the CD4 T-cell response (sum of all individual peptide pools minus the background) following immunization of CB6F1 mice. One group was vaccinated with mRNA formulated with KC3- OA / DPPS LNPs containing an increased amount of 15 mol% DSPC (at the expense of cholesterol) versus the typical 5 mol% DSPC. FIG.30B Comparison of CD4 T cell responses between a 1stand 2ndgeneration HLA-II Mtb mRNA vaccine construct encapsulated in KC3-OA / DPPS LNPs showing the proportion of total vaccine-induced CD4 T cell responses to individual or subsets of Mtb antigens encoded by the mRNA following immunization of CB6F1 mice. Data correspond to cumulative T cell responses shown in (FIG. 30A) and are normalized to 100%. One group was vaccinated with mRNA formulated with KC3-OA / DPPS LNPs containing an increased amount of 15 mol% DSPC (at the expense of cholesterol) versus the typical 5 mol% DSPC. FIG.31A Comparison of CD8 T-cell responses between a 1stand 2ndgeneration HLA-II Mtb mRNA vaccine construct encapsulated in KC3-OA / DPPS LNPs showing the cumulative total of the CD8 T-cell response (sum of all individual peptide pools minus the background) following immunization of CB6F1 mice. One group was vaccinated with mRNA formulated with KC3- 40 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 OA / DPPS LNPs containing an increased amount of 15 mol% DSPC (at the expense of cholesterol) versus the typical 5 mol% DSPC. FIG.31B Comparison of CD8 T-cell responses between a 1stand 2ndgeneration HLA-II Mtb mRNA vaccine construct encapsulated in KC3-OA / DPPS LNPs showing the proportion of total vaccine-induced CD8 T-cell responses to individual or subsets of Mtb antigens encoded by the mRNA following immunization of CB6F1 mice. Data correspond to cumulative T cell responses shown in (FIG. 31A) and are normalized to 100%. One group was vaccinated with mRNA formulated with KC3-OA / DPPS LNPs containing an increased amount of 15 mol% DSPC (at the expense of cholesterol) versus the typical 5 mol% DSPC. FIG.32 is a scheme showing the synthesis of 2-((S)-2,2-di((6Z,12Z)-octadeca-6,12-dien- 1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylethan-1-amine (AKG-KC2-01) and 3-((S)-2,2-di((6Z,12Z)- octadeca-6,12-dien-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylpropan-1-amine (AKG-KC3-01) according to some embodiments of the disclosure. FIG. 33 is a scheme showing the synthesis 2-((S)-2,2-di((Z)-octadec-9-en-1-yl)-1,3- dioxolan-4-yl)-N,N-dimethylethan-1-amine (AKG-KC2-OA), 2-((S)-2,2-di((Z)-hexadec-9-en-1- yl)-1,3-dioxolan-4-yl)-N,N-dimethylethan-1-amine (AKG-KC2-PA), 3-((S)-2,2-di((Z)-octadec- 9-en-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylpropan-1-amine (AKG-KC3-OA), and 3-((S)-2,2- di((Z)-hexadec-9-en-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylpropan-1-amine, (AKG-KC3-PA, O- 12418) according to some embodiments of the disclosure. FIG. 34 is a scheme showing the synthesis of 3-((S)-2,2-di((Z)-heptadec-8-en-1-yl)-1,3- dioxolan-4-yl)-N,N-dimethylpropan-1-amine, AKG-KC3-C17(C8:1) and (S)-3-(2,2- diheptadecyl-1,3-dioxolan-4-yl)-N,N-dimethylpropan-1-amine, AKG-KC3-C17 according to some embodiments of the disclosure. FIG.35A Comparison of splenic CD4 T cell responses in CB6F1 mice after vaccination with a 2ndgeneration HLA-II Mtb mRNA formulated in LNPs containing increasing amounts of phospholipid (PL). DPPS was held constant at 5 mol% and the remaining mol% of PL consisted of DSPC (e.g.10 mol% PL consists of 5 mol% DPPS and 5 mol% DSPC). DSPC content increased at the expense of cholesterol. FIG. 35B Comparison of splenic CD8 T cell responses in CB6F1 mice after vaccination with a 2ndgeneration HLA-II Mtb mRNA formulated in LNPs containing increasing amounts of PL. CD8 T cell responses were quantified in the same mice as in FIG.35A. 41 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 FIG.35C Comparison of splenic CD4 T cell responses in CB6F1 mice after vaccination with a 2ndgeneration HLA-II Mtb mRNA formulated in LNPs containing increasing amounts of PL. DPPS was held constant at 5 mol% and the remaining mol% of PL consisted of DSPC. One group was immunized with mRNA produced with unmodified uridine formulated in 25 mol% PL; all other groups received mRNA with all uridines replaced with N1-methylpseudouridine. FIG.35D Comparison of splenic CD8 T cell responses in CB6F1 mice after vaccination with a 2ndgeneration HLA-II Mtb mRNA formulated in LNPs containing increasing amounts of PL. CD8 T cell responses were quantified in the same mice as in FIG.35C. FIG.36A Comparison of splenic CD8 T cell responses in CB6F1 mice after vaccination with a 2ndgeneration HLA-I “Mixed” mRNA formulated in LNPs containing increasing amounts of PL. DPPS was held constant at 5 mol% and the remaining mol% of PL consisted of DSPC. FIG. 36B Comparison of splenic CD8 T cell responses in CB6F1 mice after vaccination with a 2ndgeneration HLA-I “Mtb-only” mRNA formulated in LNPs containing increasing amounts of PL. DPPS was held constant at 5 mol% and the remaining mol% of PL consisted of DSPC. DETAILED DESCRIPTION It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the compositions and methods of the present disclosure. Liposomal nanoparticle (LNP) compositions can comprise an ionizable lipid, a sterol, and one or more phospholipids. In some embodiments, the LNP compositions further comprise a nucleic acid such as mRNA for administration in a pharmaceutical composition such as a vaccine. In some embodiments, the LNP compositions optionally further comprise a conjugated lipid. Lipid Nanoparticle (LNP) compositions comprising mRNA include Stabilized Nucleic Acid Lipid Particles (SNALP) used as a vehicle for the systemic delivery of mRNA or other nucleic acid therapeutics. SNALP compositions include cationic lipids such as MC3 or KC2, comprising a protonatable tertiary amine head group joined to a pair of linear 18 carbon aliphatic chains containing a pair of carbon-carbon double bonds separated by a single methylene group (e.g., linoleic acid). However, while the structure of these hydrocarbon chains, each containing a pair of double bonds separated by a single methylene group, imparts desirable biological properties to the SNALP compositions, this chemical sub-structure also results in the undesired problem of 42 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 increased sensitivity of the compound to oxidative degradation. What is needed are novel cationic lipids suitable for use in a SNALP composition, but having enhanced resistance to oxidative degradation. Aspects of the present disclosure relates to dendritic-cell targeted lipid nanoparticles (LNP) incorporating mRNA encoding for combinations of specific CD8 and CD4 T-cell epitopes found in mycobacterium tuberculosis. In some embodiments, a LNP comprising one or more cationic ionizable lipid(s) is useful for delivery of mRNA, for dendritic cell targeting or methods of using these LNP compositions as a vaccine for the prevention of tuberculosis or other mycobacterial infections. In some embodiments, a LNP can comprise phosphatidylserine or phosphatidylglycerol as targeting ligands to increase their recognition and activity in dendritic cells. In some embodiments, the mRNA is optimized for presentation of MHC-1 epitopes and activation of CD8 T-cell, while in other embodiments the mRNA is optimized for presentation of MHC-II epitopes and activation of CD4 T-cells. In some embodiments the LNP vaccine incorporates both MHC-I and MHC-II optimized mRNA sequences. Disclosed herein are compounds, compositions and methods related to the treatment of mycobacterial infections. As used herein, the term “compound”, “drug” and “active agent” are used interchangeably. Some aspects of the disclosure relate to novel ionizable lipids or bioreducible ionizable lipids. These lipids are cationic (i.e. positively charged) at acidic pH, such as encountered intracellularly following endocytosis or phagocytosis by a cell. The same lipids, and compositions containing them, are near neutral in charge when present at pH 7.4. These lipids may also have a single olefin group present in their alkyl or acyl groups. Other aspects relate to compositions comprising lipidic nanoparticles comprising ionizable cationic lipid, the lipidic nanoparticles containing nucleic acids. In some embodiments, nucleic acids are encapsulated into the lipidic nanoparticles. In some embodiments, a lipid nanoparticle (LNP) composition comprises an ionizable cationic lipid, sterol, one or more phospholipids comprising at least one anionic phospholipid, a conjugated lipid and one or more nucleic acid sequence encoding a T cell epitope from Mycobacterium tuberculosis (Mtb). In some embodiments, a lipid nanoparticle (LNP) composition comprises an ionizable cationic lipid, sterol, one or more phospholipids comprising at least one anionic phospholipid, a conjugated lipid and one or more nucleic acid sequence encoding Mycobacterium tuberculosis antigens recognized by T cells. 43 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 Other aspects of the disclosure relate to lipid nanoparticles or targeted lipid nanoparticles that incorporate mRNA coding for major histocompatibility complex class I (MHC-I) or class II (MHC-II) epitopes. In some embodiments, mRNAs coding for MHC-I and MHC-II epitopes are incorporated into a single LNP vaccine. In some embodiments, the epitopes are enriched for those present in mycobacterium tuberculosis when compared to BCG or nontuberculosis mycobacterium (NTM). In some embodiments, the epitopes in the mRNA cassette are linked with nonimmunogenic linkers. In other embodiments the junctions between epitopes have been optimized to reduce the propensity for forming neoepitopes. Aspects of the disclosure provide for improved compositions of ionizable lipid nanoparticles for the delivery of therapeutic nucleic acids to cells. Anionic phospholipids, including phosphatidylserine and phosphatidylglycerol are included in the lipid nanoparticles to increase the transfection efficiency in dendritic cells. The further incorporation of ionizable lipids in an LNP formulation with gem di-substitution of mono-unsaturated alkyl chains (single olefin) on 2-position of 1,3-dioxolane or ketal demonstrated high levels of transfection in human dendritic cells, compared to other ionizable lipids in the same family, and demonstrated good stability to oxidative damage. Definitions For convenience, certain terms employed in the specification, examples, and appended claims are collected here. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. As used herein, the following terms and phrases are intended to have the following meanings: The articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element. As used herein the term "comprising" or "comprises" is used in reference to compositions, methods, and respective component(s) thereof, that are present in a given embodiment, yet open to the inclusion of unspecified elements. As used herein the term "consisting essentially of" refers to those elements required for a given embodiment. The term permits the presence of additional elements that do not materially 44 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 affect the basic and novel or functional characteristic(s) of that embodiment of the disclosure. The term "consisting of" refers to compositions, methods, and respective components thereof as described herein, which are exclusive of any element not recited in that description of the embodiment. The term “comprising” when used in the specification includes “consisting of” and "consisting essentially of". If it is referred to “as mentioned above” or “mentioned above”, “supra” within the description it is referred to any of the disclosures made within the specification in any of the preceding pages. If it is referred to “as mentioned herein”, “described herein”, “provided herein,” or “as mentioned in the present text,” or “stated herein” within the description it is referred to any of the disclosures made within the specification in any of the preceding or subsequent pages. As used herein, the term “about” means acceptable variations within 20%, within 10% and within 5% of the stated value. In certain embodiments, "about" can mean a variation of + / -1%, 2%, 3%, 4%, 5%, 10% or 20%. The term "effective amount" as used herein with respect to a compound or the composition means the amount of active compound (also referred herein as active agent or drug) sufficient to cause a bactericidal or bacteriostatic effect. In some embodiments, the effective amount is a "therapeutically effective amount" meaning the amount of active compound that is sufficient alleviate the symptoms of the bacterial infection being treated. The term "subject" (or, alternatively, "patient") as used herein refers to an animal, preferably a mammal, most preferably a human that receives either prophylactic or therapeutic treatment. The term “administration” or “administering” as used herein includes all means of introducing the compounds or the pharmaceutical compositions to the subject in need thereof, including but not limited to, oral, intravenous, intramuscular, intraperitoneal, subcutaneous, transdermal, inhalation, buccal, ocular, sublingual, vaginal, rectal and the like. Administration of the compound or the composition is suitably parenteral. For example, the compounds or the composition can be preferentially administered intravenously, but can also be administered intraperitoneally or via inhalation like is currently used in the clinic for liposomal amikacin in the 45 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 treatment of mycobacterium avium (see Shirley et al., Amikacin Liposome Inhalation Suspension: A Review in Mycobacterium avium Complex Lung Disease. Drugs.2019 Apr; 79(5):555-562) The terms “treat,” “treating,” and “treatment,” as used herein, refer to therapeutic or preventative measures such as those described herein. The term “pharmaceutically acceptable salt" refers to a relatively non-toxic, inorganic or organic acid addition salt of a compound of the present disclosure which salt possesses the desired pharmacological activity. The term "alkyl" means saturated carbon chains having from one to twenty carbon atoms which may be linear or branched or combinations thereof, unless the carbon chain is defined otherwise. Examples of alkyl groups include methyl, ethyl, propyl, isopropyl, butyl, sec- and tert- butyl, pentyl, hexyl, heptyl, octyl, and the like. Unless stated otherwise specifically in the specification, an alkyl group is optionally substituted. The term “phosphatidylserine”, with any of it’s acyl chain compositions, refers to the L- isomer of serine in the headgroup unless specified in a particular example. The term “lipid conjugate” refers to a conjugated lipid that inhibits aggregation of lipid particles. Such lipid conjugates include, but are not limited to, polysarcosine (see e.g. WO2021191265A1 which is herein incorporated by reference in its entirety for all purposes), polyamide oligomers (e.g., ATTA-lipid conjugates), PEG-lipid conjugates, such as PEG coupled to dialkyloxypropyls, PEG coupled to diacylglycerols, PEG coupled to cholesterol, PEG coupled to phosphatidylethanolamines, PEG conjugated to ceramides (see, e.g., U.S. Pat. No.5,885,613, the disclosure of which is herein incorporated by reference in its entirety for all purposes), cationic PEG lipids, and mixtures thereof. PEG can be conjugated directly to the lipid or may be linked to the lipid via a linker moiety. Any linker moiety suitable for coupling the PEG to a lipid can be used including, e.g., non-ester containing linker moieties and ester-containing linker moieties. In preferred embodiments, non-ester containing linker moieties are used. The abbreviations for the ionizable cationic lipids may be truncated in the Examples from that used in the Tables. For example, AKG-UO-1 may be referred to as UO1: 46 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 The abbreviation UT used in various studies refers to untreated samples. The term ”lipidic nanoparticle”, or “LNP”, refers to particles having a diameter of from about 5 to 500 nm. In some embodiments, the lipid nanoparticle comprises one or more active agents. In some embodiments, the lipid nanoparticle comprises a nucleic acid. In some embodiments, the nucleic acid is condensed in the interior of the nanoparticle with a cationic lipid, polymer, or polyvalent small molecule and an external lipid coat that interacts with the biological milieu. Due to the repulsive forces between phosphate groups, nucleic acids are naturally stiff polymers and prefer elongated configurations. In the cell, to cope with volume constraints DNA can pack itself in the appropriate solution conditions with the help of ions and other molecules. Usually, DNA condensation is defined as the collapse of extended DNA chains into compact, orderly particles containing only one or a few molecules. By binding to phosphate groups, cationic lipidic can condense DNA by neutralizing the phosphate charges and allow close packing. In some embodiments, the active agent is encapsulated into the LNP. In some embodiments, the active agent can be an anionic compounds, for example, but not limited to DNA, RNA, natural and synthetic oligonucleotides (including antisense oligonucleotides, interfering RNA and small interfering RNA), nucleoprotein, peptide, nucleic acid, ribozyme, DNA- containing nucleoprotein, such as an intact or partially deproteinated viral particles (virions), oligomeric and polymeric anionic compounds other than DNA (for example, acid polysaccharides and glycoproteins)). In some embodiments, the active agent can be intermixed with an adjuvant. In a LNP vaccine product, the active agent is generally contained in the interior of the LNP. In some embodiments, the active agent comprises a nucleic acid. Typically, water soluble nucleic acids are condensed with cationic lipids or polycationic polymers in the interior of the particle and the surface of the particle is enriched in neutral lipids or PEG-lipid derivatives. Additional ionizable cationic lipid may also be at the surface and respond to acidification in the environment by becoming positively charged, facilitating endosomal escape. 47 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 Ionizable lipids can have different properties or functions with respect to LNPs. Due to the pKa of the amino group, the lipid molecules can become positively charged in acidic conditions. Under these conditions, lipid molecules can electrostatically bind to the phosphate groups of the nucleic acid which allows the formation of LNPs and the entrapment of the nucleic acid. In some embodiments, the pKa can be low enough that it renders the LNP substantially neutral in surface charge in biological fluids, such as blood, which are at physiological pH values. High LNP surface charge is associated with toxicity, rapid clearance from the circulation by the fixed and free macrophages, hemolytic toxicities, including immune activation (Filion et al Biochim Biophys Acta.1997 Oct 23;1329(2):345-56). In some embodiments, pKa can be high enough that the ionizable cationic lipid can adopt a positively charged form at acidic endosomal pH values. This way, the cationic lipids can combine with endogenous endosomal anionic lipids to promote membrane lytic nonbilayer structures such as the hexagonal HII phase, resulting in more efficient intracellular delivery. In some embodiments, the pKa ranges between 6.2-7.5. For example, the pKa can be about 6.2, about 6.3, about 6.4, about 6.5, about 6.6, about 6.7, about 6.8, about 6.9, about 7, about 7.1, about 7.2, about 7.3, about 7.4 or about 7.5. Unsaturated tails also contribute to the lipids’ ability to adopt nonbilayer structures. (Jayaraman et al., Angew Chem Int Ed Engl.2012 Aug 20;51(34):8529-33). Release of nucleic acids from LNP formulations, among other characteristics such as liposomal clearance and circulation half-life, can be modified by the presence of polyethylene glycol and / or sterols (e.g. cholesterol) or other potential additives in the LNP, as well as the overall chemical structure, including pKa of any ionizable cationic lipid included as part of the formulation. The terms “encapsulation” and “entrapped,” as used herein, refer to the incorporation or association of the mRNA, DNA, siRNA or other nucleic acid pharmaceutical agent in or with a lipidic nanoparticle. As used herein, the term “encapsulated” refers to complete encapsulation or partial encapsulation. A siRNA may be capable of selectively knocking down or down regulating expression of a gene of interest. For example, an siRNA could be selected to silence a gene associated with a particular disease, disorder, or condition upon administration to a subject in need thereof of a nanoparticle composition including the siRNA. A siRNA may comprise a sequence that is complementary to an mRNA sequence that encodes a gene or protein of interest. 48 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 The term “mol%" with regard to cholesterol refers to the molar amount of cholesterol relative to the sum of the molar amounts of cholesterol and non-PEGylated phospholipid expressed in percentage points. For example, “55 mol.% cholesterol” in a liposome containing cholesterol and HSPC refers to the composition of 55 mol. parts of cholesterol per 45 mol. parts of HSPC. The term “mol%" with regard to PEG-lipid refers to the ratio of the molar amount of PEG- lipid and non-PEGylated phospholipid expressed in percentage points. For example, “5 mol.% PEG-DSPE” in a LNP containing HSPC and PEG-DSPE refers to the composition having 5 mol. parts of PEG-DSPE per 100 mol. parts of HSPC. As used herein, the term “pharmaceutically acceptable carrier, diluent or excipient” includes without limitation any adjuvant, carrier, excipient, glidant, sweetening agent, diluent, preservative, dye / colorant, flavor enhancer, surfactant, wetting agent, dispersing agent, suspending agent, stabilizer, isotonic agent, solvent, or emulsifier which has been approved by the United States Food and Drug Administration as being acceptable for use in humans or domestic animals. The term “peptide,” “polypeptide” and “protein” are used interchangeably to denote a sequence polymer of at least two amino acids covalently linked by an amide bond (also referred herein as peptide bond). "Identity," as known in the art, is a relationship between two or more polypeptide or protein sequences, or nucleic acid sequences as determined by comparing the sequences. In the art, "identity" also refers to the degree of sequence relatedness between polypeptides or proteins, as determined by the match between strings of such sequences. "Identity" can be readily calculated by any bioinformational methods known in the art. “Percent (%) identity” is defined as the percentage of residues (amino acid residues or nucleic acid residues) in the candidate amino acid or nucleic acid sequence that are identical with the residues in the amino acid sequence or nucleic acid sequence of a second sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent identity. The term “substantial identity” or “substantial similarity,” as used herein, when referring to a nucleic acid or fragment thereof, indicates that when optimally aligned with appropriate nucleotide insertions or deletions with another nucleic acid (or its complementary strand), there is nucleotide sequence identity in at least about 95% to 99% of the sequence. The term “substantial identity” or “substantial similarity,” as used herein, when referring to a protein or fragment thereof, 49 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 indicates that when optimally aligned there is an amino acid sequence identity in at least about 95% to 99% of the sequence. Various aspects and embodiments are described in further detail in the following subsections. Ionizable Cationic Lipids Provided herein are compounds useful in the preparation of lipid nanoparticle (LNP) compositions. In some embodiments, a lipid nanoparticle (LNP) composition comprises an ionizable lipid having a chemical structure consisting of a pair of linear polyunsaturated lipid tails covalently bound to a head group, the head group comprising a dialkyl amino group; the head group comprising a heterocyclyl or alkyl portion covalently bound to the dialkyl amino group and optionally further comprising a phosphate group; and each polyunsaturated lipid tail being unsaturated except for at least two olefins separated by at least two methylene groups along the length of the lipid tail, and optionally comprising a single acyl group at the end of the lipid tail covalently bound to the head group. In some aspects, each lipid tail in the ionizable lipid is identical, and each lipid tail has a total of two olefins separated only by an unsubstituted ethylene, n-propyl, or n-butyl. In some embodiments, each lipid tail of the ioniziable lipid further comprises an acyl group joined to an oxygen of the headgroup to form an ester, and has a total of 16 or 18 carbon atoms including the acyl group. In some embodiments, a lipid nanoparticle (LNP) composition comprises an ionizable cationic lipid having the chemical structure of Formula (I): , 2, 3 or 4; 50 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 R2and R3are each independently (C1-C4) alkyl optionally substituted with hydroxyl; and n is an integer equal to 2, 3 or 4. In some embodiments, a lipid nanoparticle (LNP) composition comprises an ionizable cationic lipid having the chemical structure of Formula (I), wherein the total length of the R1hydrocarbon chain is C15- C18. In some embodiments, the total length of the R1hydrocarbon chain is C16- C18. In some embodiments, the total length of the R1hydrocarbon chain is C16or C18. In some embodiments, a lipid nanoparticle (LNP) composition comprises an ionizable cationic lipid having the chemical structure of Formula (I), wherein a is 0 and b is 1, 2, 3 or 4. In some embodiments, a lipid nanoparticle (LNP) composition comprises an ionizable cationic lipid having the chemical structure of Formula (I), wherein a is 0 and b is 1 or 3. In some embodiments, a lipid nanoparticle (LNP) composition comprises an ionizable cationic lipid having the chemical structure of Formula (I), wherein a is 0 and b is 1. In some embodiments, a lipid nanoparticle (LNP) composition comprises an ionizable cationic lipid having the chemical structure of Formula (I), wherein a is 0 and b is 3. In some embodiments, a lipid nanoparticle (LNP) composition comprises an ionizable cationic lipid having the chemical structure of Formula (I), wherein a is 1 and b is 1, 2, 3 or 4. In some embodiments, a lipid nanoparticle (LNP) composition comprises an ionizable cationic lipid having the chemical structure of Formula (I), wherein a is 1 and b is 1 or 3. In some embodiments, a lipid nanoparticle (LNP) composition comprises an ionizable cationic lipid having the chemical structure of Formula (I), wherein a is 1 and b is 1. In some embodiments, a lipid nanoparticle (LNP) composition comprises an ionizable cationic lipid having the chemical structure of Formula (I), wherein a is 1 and b is 3. In some embodiments, a lipid nanoparticle (LNP) composition comprises an ionizable cationic lipid having the chemical structure of Formula (I), wherein R10and R12are the same. In some embodiments, a lipid nanoparticle (LNP) composition comprises an ionizable cationic lipid having the chemical structure of Formula (I), wherein R10and R12are each (C1-C4)alkyl optionally substituted with hydroxyl. In some embodiments, a lipid nanoparticle (LNP) composition comprises an ionizable cationic lipid having the chemical structure of Formula (I), wherein R10and R12are each (C1-C4)alkyl. In some embodiments, a lipid nanoparticle (LNP) composition comprises an ionizable cationic lipid having the chemical structure of Formula (I), wherein R1051 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 and R12are each methyl. In some embodiments, a lipid nanoparticle (LNP) composition comprises an ionizable cationic lipid having the chemical structure of Formula (I), wherein R10and R12are each ethyl. In some embodiments, a lipid nanoparticle (LNP) composition comprises an ionizable cationic lipid having the chemical structure of Formula (I), wherein R10and R12are each independently selected from methyl or ethyl. In some embodiments, a lipid nanoparticle (LNP) composition comprises an ionizable cationic lipid having the chemical structure of Formula (I), wherein R10and R12are each independently selected from methyl, ethyl, -(CH2)(CH2)OH, and - (CH2)2(CH2)OH. In some embodiments, a lipid nanoparticle (LNP) composition comprises an ionizable cationic lipid having the chemical structure of Formula (I), wherein a is 0 or 1; b is 1, 2, 3 or 4, provided the sum a+b is 1, 2, 3 or 4; R2and R3are each methyl; and n is an integer equal to 2, 3 or 4. In some embodiments, a lipid nanoparticle (LNP) composition comprises an ionizable cationic lipid having the chemical structure of Formula (I), wherein a is 0 or 1; b is 1, 2, 3 or 4, provided the sum a+b is 1, 2, 3 or 4; R2and R3are each methyl; and n is an integer equal to 2 or 3. In some embodiments, a lipid nanoparticle (LNP) composition comprises an ionizable cationic lipid having the chemical structure of Formula (I), wherein a is 0 or 1; b is 1, 2, 3 or 4, provided the sum a+b is 1, 2, 3 or 4; R2and R3are each methyl; and n is an integer equal to 2. n some embodiments, a lipid nanoparticle (LNP) composition comprises an ionizable cationic lipid having the chemical structure of Formula (I), wherein a is 0 or 1; b is 1, 2, 3 or 4, provided the sum a+b is 1, 2, 3 or 4; R2and R3are each methyl; and n is an integer equal to 3. In some embodiments, an ionizable cationic lipid comprises the chemical structure of Formula (II): , or a pharmaceutically acceptable 22O R Y , n is 3 or 4; R22is a hydrocarbon chain with a single olefin and a total length of C15-C18; and 52 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 each of R10and R12is independently (C1-C4)alkyl optionally substituted with hydroxyl. In some aspects, R22in Formula (II) is a polyene hydrorcarbon chain of Formula A. In some aspects, R10and R12in Formula (II) are each independently selected from methyl, ethyl, propyl, -(CH2)(CH2)OH, and -(CH2)2(CH2)OH. In some aspects, R10and R12are each independently methyl in Formula (II). In some aspects, R10and R12are each independently ethyl in Formula (II). In some aspects, at least one of R10and R12is n-propyl optionally substituted with hydroxyl in Formula (II). In some aspects, R10is methyl and R12is selected from methyl, ethyl, - (CH2)(CH2)OH, and -(CH2)2(CH2)OH in Formula (II). In some aspects, R10is methyl and R12is selected from -(CH2)(CH2)OH, and -(CH2)2(CH2)OH in Formula (II). In some aspects, R10is methyl and R12is selected from -(CH2)(CH2)OH, and -(CH2)2(CH2)OH in a compound comprising the chemical structure of Formula (II). In some aspects, R10and R12are independently selected from methyl or ethyl, optionally substituted with one or more hydroxyl in Formula (II). In some aspects, one or both of R10and R12in Formula (II) are -(CH2)(CH2)OH, or -(CH2)2(CH2)OH in Formula (II). In some aspects, R10is methyl and R12is methyl or ethyl substituted with hydroxyl in Formula (II). In some aspects, one or both of R10in Formula (II) is methyl and R12is - (CH2)(CH2)OH in Formula (II). In some aspects, one or both of R10in Formula (II) is methyl and R12is -(CH2)2(CH2)OH in Formula (II). In some embodiments, the compounds have the structure of the compounds listed in the tables below. Table 1A show examples of cationic lipids. Table 1A. Exemplary cationic lipids 53 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 In some embodiments, the LNP compositions comprises a KC3 ionizable cationic lipid. Unless otherwise indicated, the term “KC3 ionizable cationic lipid” as used herein refers to an ionizable cationic lipid having the chemical 54 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 each R1is the same or different and is a linear C15to C19hydrocarbon chain each comprising one or more unsaturated alkenyl double bond within each polyene hydrocarbon chain; R2and R3are each independently methyl; and n is 3. In some aspects, each R1in the KC3 ionizable cationic lipid is the same or different and is a linear C16or C18hydrocarbon chain each comprising one or more unsaturated alkenyl double bond within each polyene hydrocarbon chain. In some embodiments, the LNP compositions comprises a KC4 ionizable cationic lipid. Unless otherwise indicated, the term “KC4 ionizable cationic lipid” as used herein refers to an ionizable cationic lipid having the chemical , wherein each R1is the same or different and is a linear C16 one or more unsaturated alkenyl double bond within each polyene hydrocarbon chain; R2and R3are each independently methyl; and n is 4. In some aspects, each R1in the KC3 or a KC4 ionizable cationic lipid is the same or different , wherein a is 0 or 1; b R1in the KC3 or a KC4 ionizable cationic lipid is the same or different and is , wherein a is 1 and b is 1 or 3. lipid is the same or different , wherein a is 1 and b is is the same or different is Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 In some aspects, each R1in the KC3 or a KC4 ionizable cationic lipid is the same or different , wherein a is 0 and b is lipid is the same or , wherein a is 0 lipid is the same or , wherein a is 0 and b is In some aspects, each R1in the KC3 or a KC4 ionizable cationic lipid is the same or different and is wherein a is 1, 2, 3 or 4; b is 2, 3 or 4; and c is 3, 4, 5, 6, or 7, provided that the sum of a, b and c is 10, 11, 12 or 13. In some aspects, each R1in the KC3 or a KC4 ionizable cationic lipid is the same or different and is wherein a is 1, 2, 3 or 4; b is 4; and c is 3, 4, 5, 6, or 7, provided that the sum of a, b and c is 11 or 13. 56 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 In some aspects, each R1in the KC3 or a KC4 ionizable cationic lipid is the same and is a linear C16hydrocarbon chain each comprising one unsaturated alkenyl double bond within each polyene hydrocarbon chain. In some aspects, each R1in the KC3 or a KC4 ionizable cationic lipid is the same and is a linear C18hydrocarbon chain each comprising one unsaturated alkenyl double bond within each polyene hydrocarbon chain. In some aspects, each R1in the KC3 or a KC4 ionizable cationic lipid is the same and is a linear C16hydrocarbon chain each comprising two unsaturated alkenyl double bonds within each polyene hydrocarbon chain. In some aspects, each R1in the KC3 or a KC4 ionizable cationic lipid is the same and is a linear C16hydrocarbon chain each comprising two unsaturated alkenyl double bonds within each polyene hydrocarbon chain, wherein the alkenyl double are separated by two or more saturated alkylene groups. In some aspects, each R1in the KC3 or a KC4 ionizable cationic lipid is the same and is a linear C18hydrocarbon chain each comprising one unsaturated alkenyl double bond within each polyene hydrocarbon chain. In some aspects, each R1in the KC3 or a KC4 ionizable cationic lipid is the same or different and is a linear C16or C18hydrocarbon chain each comprising one or two unsaturated alkenyl double bond within each polyene hydrocarbon chain. In some embodiments, the LNP compositions comprises a mixture of a KC3 ionizable cationic lipid and a KC4 ionizable cationic lipid. In some embodiments, the LNP composition comprises an ionizable lipid wherein the ionizable lipid comprises: (a) the dialkyl amino portion of the head group has a chemical structure of Formula (IV-A) wherein n is 2, 3 or 4 in Formula (IV-A); and 57 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 R10and R12in Formula (IV-A) are each independently selected from an alkyl group selected from the group consisting of: methyl, ethyl, and propyl, wherein the alkyl in R10and R12is optionally substituted with one or more hydroxyl; and O (b) the ionizable lipid further comprises the chemical comprising the acyl group of each lipid tail covalently bound to the group distal to the dialkyl amino portion of Formula (IV-A), indicates attachment to Formula IV-A within the head group, and R22 of each lipid tail covalently bound to the acyl group and having the chemical structure of Formula A: in Formula A indicates attachment of Formula A to R22within each and a is 4, 1, 2, or 3; b is 4, 2, or 3; and c is 4, 3, 5, 6, or 7, provided that the sum of a, b and c is in Formula A is 12, 10, 11, or 13. In some embodiments, the ionizable lipid is a compound of Formula (IV-A), wherein R10and R12in Formula (IV-A) are each independently methyl, ethyl, -(CH2)(CH2)OH, or – (CH2)2(CH2)OH. In some embodiments, the ionizable lipid is a compound of Formula (IV-A), wherein b is 4 and R10and R12in Formula (IV-A) are each methyl. In some embodiments, the present disclosure provides compositions comprising ionizable cationic lipids. Aspects of the disclosure include compositions comprising 3-rac-2,2-di((Z)- octadec-9-en-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylpropan-1-amine (AKG-KC3-OA racemate) 58 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 or chiral purified forms of the AKG-KC3-OA racemate such as KC3-OA(S) and KC3-OA(R), and methods of making and purifying the same. Aspects of the disclosure include compositions comprising 4-rac-2,2-di((Z)-octadec-9-en-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylbutan-1-amine (AKG-KC4-OA), and methods of making the same. In some embodiments, a composition comprises an ionizable cationic lipid selected from one or more of the following: (a) a racemic mixture of 3-rac-2,2-di((Z)-octadec-9-en-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylpropan-1-amine (KC3-OA racemate), or KC3-OA enantiomer; and (b) 4-rac-2,2-di((Z)-octadec-9-en-1-yl)-1,3- dioxolan-4-yl)-N,N-dimethylbutan-1-amine (AKG-KC4-OA racemate). In some embodiments, a composition comprises a mixture of (R) and (S) enantiomers of KC3-OA ionizable cationic lipid, or a mixture of (R) and (S) enantiomers of KC4-OA ionizable cationic lipid. In some embodiments, a composition comprises a mixture of (R) and (S) enantiomers of KC3-OA ionizable cationic lipid, or a mixture of (R) and (S) enantiomers of KC4-OA ionizable cationic lipid, and the mixture is racemic. In some embodiments, the ionizable lipid encapsulate the nucleic acid. In some embodiments, the ionizable lipid encapsulate the nucleic acid in a LNP formulation. In some embodiments, the nucleic acid is a mRNA molecule. In some embodiments, compositions further comprising ligands, such as antibody conjugates, directed against cell surface receptors to target lipid nanoparticles in a highly specific manner to dendritic cells are provided. In some embodiments, the composition further comprises a targeting ligand, wherein the targeting ligand is oriented to the outside of the nanoparticle. In some embodiments, the targeting ligand is an antibody. In some embodiments, the lipidic nanoparticles are in an aqueous medium. In some embodiments, the nucleic acid is entrapped in the lipidic nanoparticle with a compound disclosed herein, including compounds of Formula I, II, III, IV-B, V-A-1 or combinations thereof, wherein the nucleic acid is either RNA. In some embodiments, the nucleic acid is entrapped in the lipidic nanoparticle with a compound disclosed herein, including compounds of disclosed herein or combinations thereof, wherein the nucleic acid is either RNA or DNA. In some embodiments, the nucleic acid is mRNA. In some embodiments, the nucleic acid is siRNA. In some embodiments, the nucleic acid is DNA. In some embodiments, the lipidic nanoparticle comprises a membrane comprising phosphatidylcholine and a sterol. In some embodiments, the sterol is cholesterol. In some 59 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 embodiments, the lipidic nanoparticle comprises a membrane comprising phosphatidylcholine, ionizable cationic lipid (ICL). In some embodiments, the ICL have a structure of Formula I, II, III, IV-B, V-A-1, and cholesterol, wherein the membrane separates the inside of the lipidic nanoparticles from the aqueous medium. In some embodiment, the ICL have a structure as shown in Table 1. In some embodiments, the phosphatidylcholine is distearoylphosphatidylcholine (DSPC) or hydrogenated soy phosphatidylcholine (HSPC). In some embodiments, the ionizable cationic lipid to cholesterol molar ratios is from about 65:35 to 40:60. In some embodiments, the ICL to cholesterol molar ratio is from about 60:40 to about 45:55. In some embodiments, the phosphatidylcholine to cholesterol molar ratio is from about 1:5 to about 1:2. In some embodiments, the membrane further comprises a polymer-conjugated lipid. In some embodiments, the lipidic nanoparticle comprises ICL, DSPC, cholesterol and polymer-conjugated lipid in a about 49.5:10.3:39.6:2.5 molar ratio. In some embodiments, the polymer-conjugated lipid is PEG(2000)-dimyristoylglycerol (PEG-DMG) or PEG(Mol. weight 2,000)-dimyristoylphosphatidylethanolamine (PEG-DMPE). In some embodiments the percentage of oxidative degradation products for the ionizable lipid is less than 50 % of that for a DLin-KC2-DMA or DLin-MC3-DMA control formulation. In some embodiments, the composition is a liquid pharmaceutical formulation for parenteral administration. In some embodiments, the composition is a liquid pharmaceutical formulation for subcutaneous, intramuscular, or intradermal administration. In some embodiments, the composition is in the form of a lyophilized powder, that is subsequently reconstituted with aqueous medium prior to administration. Other aspects of the disclosure relate to a method of preventing a bacterial or viral infection, the method comprising administering to a subject in need thereof an effective amount of the composition provided herein to elicit an immune response. Some embodiments provide methods of vaccinating a subject in need thereof, the method comprising administering the composition comprising a nucleic acid encoding an antigenic protein. In some embodiments, the composition is administered subcutaneously, intramuscularly, or intradermally. In some embodiments, the bacterial infection is Mycobacterium tuberculosis infection. In 60 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 some embodiments, the bacterial infection is a form of nontuberculosis mycobacterium. In some embodiments, the lipidic nanoparticle is administered parenterally. In some embodiments, the lipidic nanoparticle composition is administered as part of a single injection. In some embodiments the lipid nanoparticle is administered in multiple injections spaced in time to optimize the T-cell response to them. In some embodiments the lipid nanoparticle is administered intramuscularly (IM). The present disclosure features a lipid nanoparticle comprising mRNA and lipids. Exemplary lipids include ionizable cationic lipids (ICLs), phospholipids, sterol lipids, alkylene glycol lipids (e.g., polyethylene glycol lipids), sphingolipids, glycerolipids, glycerophospholipids, prenol lipids, saccharolipids, fatty acids, and polyketides. In some embodiments, the LNP comprises a single type of lipid. In some embodiments, the LNP comprises a plurality (e.g. two or more) of lipids. An LNP may comprise one or more of an ionizable cationic lipid, a phospholipid, a sterol, or an alkylene glycol lipid (e.g., a polyethylene glycol lipid). In an embodiment, the LNP comprises an ionizable cationic lipid. As used herein “ionizable cationic lipid”, “ionizable lipid” and “ICL” are used interchangeably. An ICL is a lipid that comprises an ionizable moiety capable of bearing a charge (e.g., a positive charge e.g., a cationic lipid) under certain conditions (e.g., at a certain pH range, e.g., under physiological conditions). The ionizable moiety may comprise an amine, and preferably a substituted amine. An ionizable lipid may be a cationic lipid or an anionic lipid. In addition to an ionizable moiety, an ionizable lipid may contain an alkyl or alkenyl group, e.g., greater than six carbon atoms in length (e.g., greater than about 8 carbons, 10 carbons, 12 carbons, 14 carbons, 16 carbons, 18 carbons, 20 carbons or more in length). Additional ionizable lipids that may be included in an LNP described herein are disclosed in Jayaraman et al. (Angew. Chem. Int. Ed. 51:8529-8533 (2012)), Semple et al. Nature Biotechnol.28:172-176 (2010)), and U.S. Patent Nos.8,710,200 and 8,754,062, each of which is incorporated herein by reference in its entirety. In some embodiments, an LNP further comprises an ionizable lipid having a structure of Formula (IV-A), or a pharmaceutically acceptable salt thereof, 61 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 wherein each of R10and with hydroxyl; v equals 1 for compounds of Formula (III). In some embodiments, v equals 1 and q1 equals 1 for compounds of Formula (III). In some embodiments, v equals 1 and q1 equals 2 for compounds of Formula (III). In some embodiments, the sum of a and c is 6, 7, 8 or 9 in R22for compounds of Formula (III). In some embodiments, the sum of a and c is 6 in R22for compounds of Formula (III). In some embodiments, the sum of a and c is 7 in R22for compounds of Formula (III). In some embodiments, the sum of a and c is 9 in R22for compounds of Formula (III). In some embodiments, v equals 0 and the sum of a and c is 6, 7, 8 or 9 in R22for compounds of Formula (III). In some embodiments, v equals 0 and the sum of a and c is 6 in R22for compounds 62 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 of Formula (IV-B). In some embodiments, v equals 0 and the sum of a and c is 7 in R22for compounds of Formula (III). In some embodiments, v equals 0 and the sum of a and c is 9 in R22for compounds of Formula (III). In some embodiments, R10and R12are independently selected from methyl, ethyl, - (CH2)(CH2)OH, and -(CH2)2(CH2)OH for compounds of Formula (III). In some embodiments, R10and R12are each methyl and the sum of a and c is 6, 7, 8 or 9 in R22for compounds of Formula (III). In some embodiments, R10and R12are each methyl, v is 0 and the sum of a and c is 6, 7, 8 or 9 in R22for compounds of Formula (III). 22O R O In some embodiments, v equals 0 and R22is for compounds of Formula (IV- In some embodiments, v equals 0 and R is2O B).22R2, and the sum of a and c is 7 or 9 22O R for compounds of Formula (III). In some embodiments, v equals 0 and R22, and a is 4 and c is 5 for compounds of Formula (III). In some embodiments, v is 22O R , and a is 1 and c is 8 for compounds of Formula (III). In some embodiments, v 2 O R2equals 0 and R22, and a is 2 and c is 5 for compounds of Formula (III). An LNP an ionizable lipid at a concentration greater than about 0.1 mol%, e.g., of the total lipid content of the LNP. In an embodiment, the LNP comprises an ionizable lipid at a concentration of greater than about 1 mol%, about 2mol%, about 4mol%, about 8mol%, about 20mol%, about 40mol%, about 50mol%, about 60mol%, about 80mol%, e.g., of the total lipid content of the LNP. In an embodiment, the LNP comprises an ionizable lipid at a concentration of greater than about 20mol%, about 40mol%, or about 50mol%. In an embodiment, the LNP comprises an ionizable lipid at a concentration between about 1mol% to about 95mol%, e.g., of the total lipid content of the LNP. In an embodiment, the LNP comprises an ionizable lipid at a concentration between about 2mol% to about 90mol%, about 4mol% to about 80mol%, about 63 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 10mol% to about 70mol%, about 20mol% to about 60mol%, about 40mol% to about 55mol%, e.g., of the total lipid content of the LNP. In an embodiment, the LNP comprises an ionizable lipid at a concentration between about 20mol% to about 60mol%. In an embodiment, the LNP comprises an ionizable lipid at a concentration between about 40 mol% to about 55 mol%. In an embodiment, the LNP comprises a phospholipid. A phospholipid is a lipid that comprises a phosphate group and at least one alkyl, alkenyl, or heteroalkyl chain. A phospholipid may be naturally occurring or non-naturally occurring (e.g., a synthetic phospholipid). A phospholipid may comprise an amine, amide, ester, carboxyl, choline, hydroxyl, acetal, ether, carbohydrate, sterol, or a glycerol. In some embodiments, a phospholipid may comprise a phosphocholine, phosphosphingolipid, or a plasmalogen. Exemplary phospholipids include 1,2- dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-distearoyl-sn-glycero-3- phosphocholine (DSPC), hydrogenated soy phosphatidylcholine (HSPC), 1,2-dilauroyl-sn- glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC), 1,2- distearoyl-sn-glycero-3-phosphoethanolamine (DSPE), 1-myristoyl-2-oleoyl-sn-glycero-3- phosphocholine (MOPC), 1,2-diarachidonoyl-sn-glycero-3-phosphocholine (DAPC), 1- palmitoyl-2-linoleoyl-sn-glycero-3-phosphatidylcholine (PLPC), 1-palmitoyl-2-oleoyl-glycero-3- phosphocholine (POPC), 1-stearoyl-2-myristoyl-sn-glycero-3-phosphocholine (SMPC), 1- palmitoyl-2-myristoyl-sn-glycero-3-phosphocholine (PMPC), bis(monoacylglycerol)phosphate (BMP), L-α-phosphatidylcholine, 1,2-Diheptadecanoyl-sn-glycero-3-phosphorylcholine (DHDPC), and 1-stearoyl-2-arachidonoyl-sn-glycero-3-phosphocholine (SAPC). Additional phospholipids that may be included in an LNP described herein are disclosed in Li, J. et al. (Asian J. Pharm. Sci.10:81-98 (2015)), which is incorporated herein by reference in its entirety. In some embodiments, the phospholipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC). In some embodiments, the phospholipid is 1,2-dioleoyl-sn-glycero-3- phosphocholine(DOPC). In some embodiments, the phospholipid is 1,2-dipalmitoyl-sn-glycero- 3-phosphocholine(DPPC). In some embodiments, the phospholipid is 1,2-dioleoyl-sn-glycero-3- phosphoethanolamine (DOPE). Incorporation of phosphatidylserine The LNP (e.g., as described herein) may comprise one or more of the following components: (i) Ionizable cationic lipid (ICL) containing a C16 alkyl or C16 alkenyl group or C18 64 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 alkyl or C18 alkenyl group at a concentration between about 1mol% to about 95mol% (or any value therebetween, e.g. about 20mol% to about 80mol%); (ii) A phospholipid at a concentration between 0.1mol% to about 20 mol% (or any value there between, e.g. between about 2.5 mol% to about 10 mol%) where the phospholipid also contains C16 or C18 alkyl or alkenyl groups; (iii) cholesterol at a concentration between about 1mol% to about 95mol% (or any value therebetween, e.g. about 20mol% to about 80mol%); (iv) a phosphatidylserine (PS) or phosphatidylglycerol (PG) added to the LNP lipid formulation at a concentration between about 0.5 mol% to about 20 mol%, about 2.5 mol% to about 10 mol%, about 4 mol% to about 8 mol%, or any value therebetween of the total lipid content of the LNP, and (v) a polyethyleneglycol (PEG)-2000-containing lipid (e.g., DPG-PEG2000, DPPE-PEG2000, DMPE-PEG2000, DMG-PEG2000) at a concentration between about 0.1mol% to about 5 mol% (or any value therebetween, e.g. between about 1 mol% to about 2.5 mol%). In an embodiment, the LNP comprises two of (i)-(v). In an embodiment, the LNP comprises three of (i)-(v). In an embodiment, the LNP comprises four of (i)-(v). In an embodiment, the LNP comprises each of (i)-(v). In some embodiments, the LNP comprises (i) and (ii). In some embodiments, the LNP comprises (i) and (iii). In some embodiments, the LNP comprises (i) and (v). In some embodiments, the LNP comprises (ii) and (iii). In some embodiments, the LNP comprises (ii) and (v). In some embodiments, the LNP comprises (iii) and (iv). In some embodiments, the LNP comprises (iii) and (v). In some embodiments, the LNP comprises (i), (ii), and (iii). In some embodiments, the LNP comprises (i), (ii), and (v). In some embodiments, the LNP comprises (ii), (iii), and (v). In some embodiments, the LNP comprises (ii), (iii), (iv) and (v). In an embodiment, the LNP consists or consists essentially of four of (i)-(v). In an embodiment, the LNP consists or consists essentially of each of (i)-(v). In some embodiments, the LNP consists or consists essentially of (i) and (ii). In some embodiments, the LNP consists or consists essentially of (i) and (iii). In some embodiments, the LNP consists or consists essentially of (i) and (v). In some embodiments, the LNP consists or consists essentially of (ii) and (iii). In some embodiments, the LNP comprises (ii) and (v). In some embodiments, the LNP consists or consists essentially of (iii) and (iv). In some embodiments, the LNP consists or consists essentially of (iii) and (v). In some embodiments, the LNP consists or consists essentially of (i), (ii), and (iii). In some embodiments, the LNP consists or consists essentially of (i), (ii), and (v). In some embodiments, the LNP comprises (ii), (iii), and (v). In some embodiments, the LNP consists or consists essentially of (ii), (iii), (iv) and (v). 65 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 An LNP may comprise a phospholipid at a concentration greater than about 0.1mol%, e.g., of the total lipid content of the LNP. In an embodiment, the LNP comprises a phospholipid at a concentration of greater than about 0.5mol%, about 1mol%, about 1.5mol%, about 2mol%, about 3mol%, about 4mol%, about 5mol%, about 6mol%, about 8mol%, about 10mol%, about 12mol%, about 15mol%, about 20mol%, about 50mol%, e.g., of the total lipid content of the LNP. In an embodiment, the LNP comprises a phospholipid at a concentration of greater than about 1mol%, about 5mol%, or about 10mol%. In an embodiment, the LNP comprises a phospholipid at a concentration between about 0.1mol% to about 50mol%, e.g., of the total lipid content of the LNP. In an embodiment, the LNP comprises a phospholipid at a concentration between about 0.5mol% to about 40mol%, about 1mol% to about 30mol%, about 5mol% to about 25mol%, about 10mol% to about 20mol%, about 10mol% to about 15mol%, or about 15mol% to about 20mol%, e.g., of the total lipid content of the LNP. In an embodiment, the LNP comprises a phospholipid at a concentration between about 5mol% to about 25mol%. In an embodiment, the LNP comprises a phospholipid at a concentration between about 10mol% to 20mol%. In an embodiment, the LNP comprises a sterol or ionizable sterol molecule. A sterol is a lipid that comprises a polycyclic structure and an optionally a hydroxyl or ether substituent, and may be naturally occurring or non-naturally occurring (e.g., a synthetic sterol). Sterols may comprise no double bonds, a single double bond, or multiple double bonds. Sterols may further comprise an alkyl, alkenyl, halo, ester, ketone, hydroxyl, amine, polyether, carbohydrate, or cyclic moiety. An exemplary listing of sterols includes cholesterol, dehydroergosterol, ergosterol, campesterol, β-sitosterol, stigmasterol, lanosterol, dihydrolanosterol, desmosterol, brassicasterol, lathosterol, zymosterol, 7-dehydrodesmosterol, avenasterol, campestanol, lupeol, and cycloartenol. In some embodiments, the sterol comprises cholesterol, dehydroergosterol, ergosterol, campesterol, β-sitosterol, or stigmasterol. Additional sterols that may be included in an LNP described herein are disclosed in Fahy, E. et al. (J. Lipid. Res.46:839-862 (2005). Ionizable sterols In some embodiments, an LNP comprises a sterol. In some embodiments, the sterol is cholesterol. In some embodiments, the sterol is dehydroergosterol. In some embodiments, the sterol is ergosterol. In some embodiments, the sterol is campesterol. In some embodiments, the sterol is β-sitosterol. In some embodiments, the sterol is stigmasterol. In some embodiments, the sterol is a corticosteroid. (e.g., corticosterone, hydrocortisone, cortisone, or aldosterone). 66 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 In some embodiments, the ionizable lipid can be a branched ionizable lipid selected from ALC-0315 and SM-102: HO O An LNP may comprise a sterol at a concentration greater than about 0.1mol%, e.g., of the total lipid content of the LNP. In an embodiment, the LNP comprises a sterol at a concentration greater than about 0.5mol%, about 1mol%, about 5mol%, about 10mol%, about 15mol%, about 20mol%, about 25mol%, about 35mol%, about 40mol%, about 45mol%, about 50mol%, about 55mol%, about 60mol%, about 65mol%, or about 70mol%, e.g., of the total lipid content of the LNP. In an embodiment, the LNP comprises a sterol at a concentration greater than about 10mol%, about 15mol%, about 20mol%, or about 25mol%. In an embodiment, the LNP comprises a sterol at a concentration between about 1mol% to about 95mol%, e.g., of the total lipid content of the LNP. In an embodiment, the LNP comprises a sterol at a concentration between about 5mol% to about 90mol%, about 10mol% to about 85mol%, about 20mol% to about 80mol%, about 20mol% to about 60mol%, about 20mol% to about 50mol%, or about 20mol% to 40mol%, e.g., of the total lipid content of the LNP. In an embodiment, the LNP comprises a sterol at a concentration between about 20mol% to about 50mol%. In an embodiment, the LNP comprises a sterol at a concentration between about 30mol% to about 60mol%. 67 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 In some embodiments, the LNP comprises an alkylene glycol-containing lipid. An alkylene glycol-containing lipid is a lipid that comprises at least one alkylene glycol moiety, for example, a methylene glycol or an ethylene glycol moiety. In some embodiments, the alkylene glycol-containing lipid comprises a polyethylene glycol (PEG). An alkylene glycol-containing lipid may be a PEG-containing lipid. Polymer-conjugated lipids may include poly(ethylene glycol)-conjugated (pegylated)phospholipids (PEG-lipids) such as PEG(Mol. weight 2,000) methoxy-poly(ethylene glycol)-1,2-distearoyl-sn-glycerol (PEG-DSG), PEG(Mol. weight 2,000) methoxy-poly(ethylene glycol)-1,2-palmitoyl-sn-glycerol (PEG-DPG), PEG(Mol. weight 2,000) 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (PEG-DSPE) or N-palmitoyl-sphingosine-1-{succinyl[methoxy(polyethylene glycol)2000]} (PEG-ceramide). The molecular weight of the PEG portion in the PEG-lipid component can also vary from 500-10,000 g / mol, from 1,500-6000 g / mol, but is preferably about 2,000 MW. Other polymers used for conjugation to lipid anchors may include poly(2-methyl-2-oxazoline) (PMOZ), poly(2-ethyl-2-oxazoline) (PEOZ), poly-N-vinylpyrrolidone (PVP), polyglycerol, poly(hydroxyethyl L-asparagine) (PHEA), and poly(hydroxyethyl L-glutamine) (PHEG). A PEG-containing lipid may further comprise an amine, amide, ester, carboxyl, phosphate, choline, hydroxyl, acetal, ether, heterocycle, or carbohydrate. PEG-containing lipids may comprise at least one alkyl or alkenyl group, e.g., greater than six carbon atoms in length (e.g., greater than about 8 carbons, 10 carbons, 12 carbons, 14 carbons, 16 carbons, 18 carbons, 20 carbons or more in length), e.g., in addition to a PEG moiety. In an embodiment, a PEG-containing lipid comprises a PEG moiety comprising at least 20 PEG monomers, e.g., at least 30 PEG monomers, 40 PEG monomers, 45 PEG monomers, 50 PEG monomers, 100 PEG monomers, 200 PEG monomers, 300 PEG monomers, 500 PEG monomers, 1000 PEG monomers, or 2000 PEG monomers. Exemplary PEG-containing lipids include PEG-DMG (e.g., DMG-PEG2k), PEG-c- DMG, PEG-DSG, PEG-DPG, PEG-DSPE, PEG-DMPE, PEG-DPPE, PEG-DOPE, and PEG- DLPE. In some embodiments, the PEG-lipids include PEG-DMG (e.g., DMG-PEG2k), PEG-c- DMG, PEG-DSG, and PEG-DPG. Additional PEG-lipids that may be included in an LNP described herein are disclosed in Fahy, E. et al. (J. Lipid. Res. 46:839-862 (2005) which is incorporated herein by reference in its entirety. In some embodiments, the PEG-lipid is PEG-DMG (e.g., DMG-PEG2k). In some embodiments, the PEG-lipid is α-(3’-{[1,2-di(myristyloxy)propanoxy] carbonylamino}propyl)-ω- 68 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 methoxy, polyoxyethylene (PEG-c-DMG). In some embodiments, the PEG-lipid is PEG-DSG. In some embodiments, the PEG-lipid is PEG-DPG. An LNP may comprise an alkylene glycol-containing lipid at a concentration greater than about 0.1mol%, e.g., of the total lipid content of the LNP. In an embodiment, the LNP comprises an alkylene glycol-containing lipid at a concentration of greater than about 0.5mol%, about 1mol%, about 1.5mol%, about 2mol%, about 3mol%, about 4mol%, about 5mol%, about 6mol%, about 8mol%, about 10mol%, about 12mol%, about 15mol%, about 20mol%, about 50mol%, e.g., of the total lipid content of the LNP. In an embodiment, the LNP comprises an alkylene glycol- containing lipid at a concentration of greater than about 1mol%, about 4mol%, or about 6mol%. In an embodiment, the LNP comprises an alkylene glycol-containing lipid at a concentration between about 0.1mol% to about 50mol%, e.g., of the total lipid content of the LNP. In an embodiment, the LNP comprises an alkylene glycol-containing lipid at a concentration between about 0.5mol% to about 40mol%, about 1mol% to about 35mol%, about 1.5mol% to about 30mol%, about 2mol% to about 25mol%, about 2.5mol% to about 20%, about 3mol% to about 15mol%, about 3.5mol% to about 10mol%, or about 4mol% to 9mol%, e.g., of the total lipid content of the LNP. In an embodiment, the LNP comprises an alkylene glycol-containing lipid at a concentration between about 3.5mol% to about 10mol%. In an embodiment, the LNP comprises an alkylene glycol-containing lipid at a concentration between about 4mol% to 9mol%. In some embodiments, the LNP comprises at least two types of lipids. In an embodiment, the LNP comprises two of an ionizable lipid, a phospholipid, a sterol, and an alkylene glycol- containing lipid. In some embodiments, the LNP comprises at least three types of lipids. In an embodiment, the LNP comprises three of an ionizable lipid, a phospholipid, a sterol, and an alkylene glycol-containing lipid. In some embodiments, the LNP comprises at least four types of lipids. In an embodiment, the LNP comprises each of an ionizable lipid, a phospholipid, a sterol, and an alkylene glycol-containing lipid. The LNP (e.g., as described herein) may comprise one or more of the following components: (i) an ionizable cationic lipid at a concentration between about 1mol% to about 95mol% (e.g. about 20mol% to about 80mol%); (ii) a phospholipid at a concentration between 0.1mol% to about 50mol% (e.g. between about 2.5mol% to about 20mol%); (iii) a sterol at a concentration between about 1mol% to about 95mol% (e.g. about 20mol% to about 80mol%); and (iv) a PEG-containing lipid at a concentration between about 0.1mol% to about 50mol% (e.g. 69 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 between about 2.5mol% to about 20mol%). In an embodiment, the LNP comprises one of (i)-(iv). In an embodiment, the LNP comprises two of (i)-(iv). In an embodiment, the LNP comprises three of (i)-(iv). In an embodiment, the LNP comprises each of (i)-(iv). In some embodiments, the LNP comprises (i) and (ii). In some embodiments, the LNP comprises (i) and (iii). In some embodiments, the LNP comprises (i) and (iv). In some embodiments, the LNP comprises (ii) and (iii). In some embodiments, the LNP comprises (ii) and (iv). In some embodiments, the LNP comprises (iii) and (iv). In some embodiments, the LNP comprises (i), (ii), and (iii). In some embodiments, the LNP comprises (i), (ii), and (iv). In some embodiments, the LNP comprises (ii), (iii), and (iv). The LNP (e.g., as described herein) may comprise one or more of the following components: (i) Ionizable cationic lipid (ICL) at a concentration between about 1mol% to about 95mol% (e.g. about 20mol% to about 80mol%); (ii) DSPC at a concentration between 0.1mol% to about 50mol% (e.g. between about 2.5mol% to about 20mol%); (iii) cholesterol at a concentration between about 1mol% to about 95mol% (e.g. about 20mol% to about 80mol%); and (iv) DMG-PEG2k at a concentration between about 0.1mol% to about 50mol% (e.g. between about 2.5mol% to about 20mol%). In an embodiment, the LNP comprises two of (i)-(iv). In an embodiment, the LNP comprises three of (i)-(iv). In an embodiment, the LNP comprises each of (i)-(iv). In some embodiments, the LNP comprises (i) and (ii). In some embodiments, the LNP comprises (i) and (iii). In some embodiments, the LNP comprises (i) and (iv). In some embodiments, the LNP comprises (ii) and (iii). In some embodiments, the LNP comprises (ii) and (iv). In some embodiments, the LNP comprises (iii) and (iv). In some embodiments, the LNP comprises (iii) and (iv). In some embodiments, the LNP comprises (i), (ii), and (iii). In some embodiments, the LNP comprises (i), (ii), and (iv). In some embodiments, the LNP comprises (ii), (iii), and (iv). In an embodiment, the LNP comprises a ratio of ionizable lipid to phospholipid of about 50:1 to about 1:1 (e.g., 40:1, 32:3, 6:1, 7:1, 5:1, 24:5, 26:5, 10:3, 15:2, 16:7, 18:1, 3:1, 3:2, or 1:1). In an embodiment, the LNP comprises a ratio of ionizable lipid to phospholipid of about 15:2. In an embodiment, the LNP comprises a ratio of ionizable lipid to phospholipid of about 5:1. In an embodiment, the LNP comprises a ratio of ionizable lipid to a sterol of about 10:1 to about 1:10 (e.g., 9:1, 8:1, 8:7, 7:1, 7:5, 7:3, 6:1, 6:5, 5:1, 5:3, 4:1, 4:3, 3:1, 2:1, 1:1, 1:2, 1:3, 3:4, 1:4, 3:5, 1:5, 4:5, 1:6, 5:6, 7:6, 7:8, or 8:9). In an embodiment, the LNP comprises a ratio of ionizable lipid to 70 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 an alkylene-containing lipid of about 1:10 to about 10:1 (e.g., 1:9, 1:8, 7:8, 7:1, 7:5, 7:3, 6:1, 6:5, 5:1, 5:3, 4:1, 4:3, 3:1, 2:1, 1:1, 1:2, 1:3, 3:4, 1:4, 3:5, 1:5, 4:5, 1:6, 5:6, 7:6, 7:8, or 8:9). In an embodiment, the LNP comprises a ratio of phospholipid to an alkylene-containing lipid of about 10:1 to about 1:10 (e.g., 9:1, 8:1, 8:7, 7:1, 7:5, 7:3, 6:1, 6:5, 5:1, 5:3, 4:1, 4:3, 3:1, 2:1, 1:1, 1:2, 1:3, 3:4, 1:4, 3:5, 1:5, 4:5, 1:6, 5:6, 7:6, 7:8, or 8:9). In an embodiment, the LNP comprises a ratio of a sterol to an alkylene-containing lipid of about 50:1 to about 1:1 (e.g., 40:1, 32:3, 6:1, 7:1, 5:1, 24:1, 22:1, 20:1, 22:5, 24:5, 26:5, 10:3, 15:2, 16:7, 18:1, 3:1, 3:2, or 1:1). In an embodiment, a LNP (e.g., described herein) comprises two of an ionizable lipid, a phospholipid, a sterol, and an alkylene glycol-containing lipid (e.g., PEG-containing lipid). In another embodiment, a LNP (e.g., described herein) comprises three of an ionizable lipid, a phospholipid, a sterol, and an alkylene glycol-containing lipid (e.g., PEG-containing lipid). In an embodiment LNP (e.g., described herein) comprises each of an ionizable lipid, a phospholipid, a sterol, and an alkylene glycol-containing lipid (e.g., PEG-containing lipid). In some embodiments, an LNP described herein has a diameter between 5 and 500 nm, e.g., between 10 and 400 nm, 20 and 350 nm, 25 and 325 nm, 30 and 300 nm, 50 and 250 nm, 60 and 200 nm, 75 and 190 nm, 80 and 180 nm, 100 and 200 nm, 200 and 300 nm, and 150 and 250 nm. The diameter of an LNP may be determined by any method known in the art, for example, dynamic light scattering, transmission electron microscopy (TEM) or scanning electron microscopy (SEM). In some embodiments, an LNP has a diameter between 50 and 100 nm, between 70 and 100 nm, and between 80 and 100 nm. In an embodiment, an LNP has a diameter of about 90 nm. In some embodiments, an LNP described herein has a diameter greater than about 30 nm. In some embodiments, an LNP has a diameter greater than about 35 nm, about 40 nm, about 45 nm, about 50 nm, about 60 nm, about 70 nm, about 80 nm, about 90 nm, about 100 nm, about 120 nm, about 140 nm, about 160 nm, about 180 nm, about 200 nm, about 225 nm, about 250 nm, about 275 nm or about 300 nm. In an embodiment, an LNP has a diameter greater than about 70 nm. In an embodiment, an LNP has a diameter greater than about 90 nm. In an embodiment, an LNP has a diameter greater than about 180 nm. In some embodiments, a plurality of LNPs described herein has an average diameter ranging from about 40 nm to about 180 nm. In some embodiments, a plurality of LNPs described herein has an average diameter from about 50 nm to about 150 nm. In some embodiments, a plurality of LNPs described herein has an average diameter from about 50 nm to about 120 nm. 71 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 In some embodiments, a plurality of LNPs described herein has an average diameter from about 60 nm to about 120 nm. In some embodiments, a plurality of LNPs has an average diameter of about 40 nm, about 45 nm, about 50 nm, about 60 nm, about 70 nm, about 80 nm, about 90 nm, about 100 nm, about 120 nm, about 140 nm, about 160 nm, about 180 nm. In some embodiments, a nanoparticle or plurality of nanoparticles described herein has an average neutral to negative surface charge of less than -100 mv, for example, less than -90 mv, - 80 mv, -70 mv, -60 mv, -50 mv, -40 mv, -30 mv, and -20 mv. In some embodiments, a nanoparticle or plurality of nanoparticles has a neutral to negative surface charge of between -100 mv and 100 mv, between -75 mv to 0, or between -50 mv and -10 mv. In some embodiments, at least 5% (e.g., at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%) of the nanoparticles of a plurality of nanoparticles have an average neutral to negative surface charge of less than -100 mv. In some embodiments, a nanoparticle or plurality of nanoparticles has an average surface charge of between -20 mv to +20, between -10 mv and +10 mv, or between -5 mv and +5 mv at pH 7.4. LNPs that are neutral in charge have improved pharmacokinetics and biological performance compared to cationic LNPs. Making Lipid Nanoparticles (LNPs) The method of making an LNP can comprise mixing a first solution with a second solution. Mixing can be achieved using standard liquid mixing techniques, such as propellor mixing, vortexing solutions or preferably through microfluidic mixing or high efficiency T-mixing. In some embodiments, the first solution comprises a lipid or a plurality of lipids and a nucleic acid, where all components are solubilized, in water / solvent system. The solvent may be any water miscible solvent (e.g., ethanol, methanol, isopropanol, acetonitrile, dimethylformamide, dimethylsulfoxide, dioxane or tetrahydrofuran). In some embodiments, the first solution comprises a small percentage of water or pH buffered water. The first solution may comprise up to at least 60% by volume of water, e.g., up to at least about 0.05%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%,45%, 50%, 55% or 60% by volume of water. In an embodiment, the first solution comprises between about 0.05% and 60% by volume of water, e.g., between about 0.05% and 50%, about 0.05% and 40%, or about 5% and 20% by volume of water. In some embodiments, the first solution comprises a single type of lipid, for example, an ionizable lipid, a phospholipid, a sterol, or a PEG-containing lipid. In some embodiments, the first 72 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 solution comprises a plurality of lipids. In some embodiments, the plurality comprises an ionizable lipid, a phospholipid, a sterol, or a PEG-containing lipid. In some embodiments, the plurality of lipids comprise cholesterol, 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC),1,2-dimyristoyl- rac-glycero-3-methylpolyoxyethylene2000 (DMG-PEG2k) or α-(3’-{[1,2- di(myristyloxy)propanoxy] carbonylamino}propyl)-ω-methoxy, polyoxyethylene (PEG2000- C- DMG), and an ionizable lipid. The plurality of lipids may exist in any ratio. In an embodiment, the plurality of lipids comprises an ionizable lipid or sterol, a phospholipid, a sterol, a PEG-containing lipid of the above lipids or a combination thereof in a particular ratio (e.g., a ratio described herein). In some embodiments, the second solution is water. In some embodiments, the second solution is an aqueous buffer with a pH between 3-6 (e.g., a pH of about 3, about 4, about 5, or about 6). The second solution may comprise a load component, e.g., a nucleic acid (e.g., mRNA). The second solution may comprise a small percentage of water-miscible organic solvent. The second solution may comprise up to at least 60% by volume of at least one water miscible organic solvent, e.g., up to at least about 0.05%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%,10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55% , 60% or any percent therebetween by volume of at least one organic solvent (e.g., a water miscible organic solvent). In an embodiment, the second solution comprises between about 0.05% and 60% by volume of organic solvent, e.g., between about 0.05% and 50%, about 0.05% and 40%, or about 5% and 20% by volume of organic solvent (e.g., a water miscible organic solvent). The aqueous buffer solution can be an aqueous solution of citrate buffer. In some embodiments, the aqueous buffer solution is a citrate buffer solution with a pH between 4-6 (e.g., a pH of about 4, about 5, or about 6). In an embodiment, the aqueous buffer solution is a citrate buffer solution with a pH of about 6. In some embodiments, the solution comprising a mixture of the first and second solutions comprising the LNP suspension can be diluted. In some embodiments, the pH of the solution comprising a mixture of the first and second solutions comprising the LNP suspension can be adjusted. Dilution or adjustment of the pH of the LNP suspension can be achieved with the addition of water, acid, base or aqueous buffer. In some embodiments, no dilution or adjustment of the pH of the LNP suspension is carried out. In some embodiments, both dilution and adjustment of the pH of the LNP suspension is carried out. In some embodiments, excess reagents, solvents, unencapsulated nucleic acid maybe removed from the LNP suspension by tangential flow filtration (TFF) (e.g., diafiltration). The 73 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 organic solvent (e.g., ethanol) and buffer may also be removed from the LNP suspension with TFF. In some embodiments, the LNP suspension is subjected to dialysis and not TFF. In some embodiments, the LNP suspension is subjected to TFF and not dialysis. In some embodiments, the LNP suspension is subjected to both dialysis and TFF. In one aspect, the present disclosure features a method comprising treating a sample of LNPs comprising nucleic acid, with a fluid comprising a detergent (e.g., Triton X-100, or anionic detergents (such as, but not limited to, sodium dodecyl sulfate (SDS), or non-ionic detergent, such as but not limited to β-octylglucoside, or Zwittergent 3-14) for a period of time suitable to degrade the lipid layer and thereby release the encapsulated and / or entrapped nucleic acid(s). In an embodiment, the method further comprises analyzing the sample for the presence, absence, and / or amount of the released nucleic acid(s). LNP comprising ligands Some aspects of the disclosure relate to LNP comprising a ligand (also referred herein as targeting ligand) having a binding specificity for a cell surface antigen, wherein the binding of the ligand to the antigen induces the internalization of the ligand. Some embodiments relate to compositions comprising LNP comprising a ligand as described herein. LNP targeting can also accomplished by adding lipids to the formulation. For example, phosphatidylserine is known to redistribute to the external surface of the plasma membrane during apoptosis and is a molecular cue for phagocytotic cell attraction (Fadok et al. Curr Biol.2003 Aug 19;13(16):R655-7). Phosphatidylserine (PS) and phosphatidylglycerol (PG) are recognized by dendritic cells and can induce uptake and activation of dendritic cells LNP targeting can also accomplished by adding certain anionic phospholipids to the formulation (Table 2A). For example, phosphatidylserine is known to redistribute to the external surface of the plasma membrane during apoptosis and is a molecular cue for phagocytotic cell attraction (Fadok et al. Curr Biol.2003 Aug 19;13(16):R655-7). Phosphatidylserine (PS) and phosphatidylglycerol (PG) are recognized by dendritic cells and can induce uptake and activation of dendritic cells (Caronni et al., Nat Comm. 2021 April 14; 12: 2237-2253; Ischihashi et al., PLOS One 2013). Although anionic phospholipids have been used previously in the context of liposomes, their inclusion in lipidic nanoparticles that include condensed nucleic acids is unexpected since anionic headgroups may compete for binding sites of the ionizable cationic lipids with the phosphate backbone of mRNA, may inhibit 74 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 intracellular escape by altering the surface charge, or may result in aggregation of LNPs during formation or storage. Table 2A. Anionic Phospholipid Targeting Moieties ACTIVE Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 Table 2B. Phosphatidylserine Targeting Moieties O O O 9 3 - – r) – – – In some embodiments, the anionic targeting ligands are selected from the group, phosphatidylserine (PS), phoshatidylglycerol (PG), N-glutaryl-phosphatidylethanolamine (N-glu- PE), or N-succinyl-phosphatidylethanolamine (N-Suc-PE). In some embodiments, the anionic phospholipid used is phosphatidylserine. In another embodiment, the phosphatidylserine contains the L-isomer of serine. In another embodiment, the acyl chains for the phosphatidylserine are fully saturated, such as the case for dimyristoylphosphatidyl-L-serine (DMPS), dipalmitoylphosphatidyl-L-serine (DPPS), or distearoylphosphatidyl-L-serine (DSPS). In a preferred embodiment, the PS used is the L-isomer of either DPPS or DSPS. The phosphatidylserine may also contain an asymmetric acyl chain composition, for example where one acyl chain is stearic acid and another is palmitic acid. 76 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 In some embodiments, the anionic phospholipid is selected from a group other than phosphatidylserine. In some embodiments, these non-PS anionic phospholipids include phosphatidylglycerol (PG), phosphatidic acid (PA), N-glutaryl-phosphatidylethanolamine (N- Glu-PE), N-succinyl-phosphatidylethanolamine (N-Suc-PE), and cardiolipin. In some embodiments, these anionic phospholipids include saturated acyl chains of 16 or 18 carbons such as distearoylphosphatidylglycerol (DSPG), dipalmitoyphosphatidylglycerol (DPPG), N-succinyl- distearoylphosphatidylethanolamine (N-Suc-DSPE), N-glutaryl-distearoylphosphatidylethanol- amine (N-Glu-DSPE), distearoylphosphatidic acid (DSPA), and cardiolipin. Table 2C. Nonphosphatidylserine anionic phospholipids O O 9 3 OH 1 O O P O OH DSPG 77 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 O O 9 3 1816 14 101O O P - OH embodiment, the acyl chains for the phosphatidylglycerol are fully saturated, such as the case for dimyristoylphosphatidylglycerol (DMPG), dipalmitoylphosphatidylglycerol (DPPG), or distearoylphosphatidylglycerol (DSPG). In a preferred embodiment, the PG used is either DPPG or DSPG. The phosphatidylglycerol may also contain an asymmetric acyl chain composition, for example where one acyl chain is stearic acid and another is palmitic acid. In some embodiments, the salt form of phosphatidylglycerol or phosphatidylserine is highly soluble in ethanol. In some embodiments, the salt form of phosphatidylserine is highly soluble in ethanol. In some embodiments it is soluble at greater than 0.5 mg / ml, greater than 1 mg / mL, greater than 5 mg / mL, greater than 10 mg / mL, or greater than 20 mg / mL. In some embodiments the salt form of phosphatidylglycerol or phosphatidylserine is soluble is at least 0.3 mM, at least 0.4 mM, at least 0.5 mM, at least 0.6 mM, or at least 0.8 mM, as determined by a shake flask method in 200 proof ethanol, at the temperature of 22ºC of less. In some embodiments, the salt is an ammonium salt. In some embodiments, the phosphatidylserine is added to the LNP lipids in the form of ammonium or a substituted ammonium salt. Substituted ammonium salt can be mono-, di-. tri-, or tetraalkylammonium having alkyl groups with one to six, one to four, one to three, one, two, or three carbon atoms each. One or more alkyl groups can be n-alkyl, or branched alkyl groups (such as, for example, isopropyl groups), or form a ring (such as for example, cyclohexyl group). An alkyl group and the nitrogen ammonium atom may form a heterocyclic ring. The substituted ammonium salt may be also formed by an alkylenediamine. 78 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 Tris(hydroxymethyl)aminomethane and triethanolamine can also be used as the amine bases to form PS salts. In some embodiments, the amine is chosen from ammonia, dimethylamine, diethylamine, triethylamine, trimethylamine, 2-(dimethyamino)ethanol, diethanolamine, 2- (diethyamino)ethanol, ethanolamine, ethylenediamine, N-methyl-glucamine, imidazole, histidine, lysine, arginine, 4-(2-hydroxyethyl)-morpholine, piperazine, 1-(2-hydroxyethyl)-pyrrolidine, triethanolamine, and tromethamine (tris(hydroxymethyl)aminomethane), In some embodiments, this targeting lipid is an ammonium salt of DPPS. Table 2D. Ammonium and sodium salt forms of dipalmitoyl- or distearoyl-phosphatidylserine. or any method known in the art may be used. In some embodiments, a sodium salt of phosphatidylserine (PS) is dissolved in a monophase system of chloroform, methanol, and water, containing a chloride salt of ammonium or substituted ammonium (a Bligh-Dyer monophase), and the system is brought 79 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 to the two-phase state by adding extra methanol and / or water containing the ammonium or substituted ammonium chloride. The chloroform-rich phase, containing the PS, is separated, and the process is repeated. Finally, the chloroform-rich phase is washed with water to remove excess chloride, and the ammonium (substituted ammonium) salt of PS is obtained by evaporation of the chloroform-rich phase. Optionally, the obtained ammonium or substituted ammonium salt of PS is vacuum dried or dissolved in cyclohexane and lyophilized. In another embodiment, the PS as a sodium or potassium salt is dissolved in a water-immiscible organic solvent, such as chloroform or a chloroform-methanol mixture, and washed with diluted aqueous solution of an acid, such as HCl, to obtain a free acid form of the PS, which is then neutralized with ammonium hydroxide or substituted amine in free base form. In yet another embodiment, the organic solution of PS as a sodium or potassium salt is treated with a cation-exchange resin in the ammonium of substituted ammonium form. In yet another embodiment, the PS is prepared in the form of a calcium or magnesium salt and treated with ammonium or substituted ammonium salt of a chelator, such as EDTA, or with ammonium or substituted ammonium phosphate, in the presence of an organic solvent, causing displacement of calcium or magnesium ion in the form of a chelate or a yet less soluble phosphate, which is separated, e.g., by filtration, while ammonium or substituted ammonium salt of PS is left in the organic (e.g., ethanol) solution. In some embodiments, PS or PG are added to the LNP lipid formulation at a concentration between about 0.1 mol% to about 20 mol%, about 0.1 mol% to about 10 mol%, about 0.1 mol% to about 5 mol%, about 0.5 mol% to about 20 mol%, about 0.5 mol% to about 10 mol%, about 0.5 mol% to about 5 mol%, about 1 mol% to about 20 mol%, about 1 mol% to about 10 mol%, or about 1 mol% to about 5 mol%, of the total lipid content of the LNP. In some embodiments, the PS is added to the LNP lipid formulation at a concentration between about 1 mol% to about 20 mol%, about 2.5 mol% to about 10 mol%, about 3 mol% to about 9 mol%, or about 4 mol% to about 8 mol%, of the total lipid content of the LNP. In some embodiments, the PS or PG lipid is included in the LNP composition comprising ionizable cationic lipids known in the art, including DODAP, AKG-OA-DM2, O-11769, DLin- MC3-DMA, DLin-KC2-DMA, DLin-KC3-DMA, ALC-0315, and SM-102. In another embodiment the PS lipid is included in the LNP composition comprising ICLs of Formula I, II, III, IV-B, V-A-1, combinations thereof or pharmaceutically salts thereof. In 80 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 another embodiment the PS lipid is included in the LNP composition using N / P ratios between 3 and 8, between 4 and 7, or between 5 and 6. In some aspects, a method of delivering a nucleic acid to a cell is provided, the method comprising: contacting the cell with a composition comprising an LNP comprising a ligand (also referred herein as targeting ligand) having a binding specificity for a cell surface antigen, wherein the binding of the ligand to the antigen induces the internalization of the ligand. In some embodiments, the targeting ligand can be, but is not limited to, an internalizing antibody, or a fragment thereof, a small molecule conjugates or gylcoconjugates. In some embodiments, the binding of the targeting ligand to a specific cell surface antigen induces the internalization of the LNP with the targeting ligand attached by a cell expressing at least 100,000 or at least 1,000,000 molecules of the antigen when contacted and incubated with the cell under internalizing conditions. Table 3A. Exemplary dialkyl and branched ionizable cationic lipids ACTIVE Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 Table Compositions In some embodiments, a lipidic nanoparticle composition comprises lipids and nucleic acids, the lipidic nanoparticles comprising a compound of Formula I, II, III, IV-B, V-A-1, combinations thereof or pharmaceutically acceptable salts thereof. Other aspects of the disclosure relate to the use of these ionizable lipids or lipidic nanoparticles compositions comprising ionizable lipids in vaccines for the prevention of infectious diseases. In 82 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 some embodiments, the compositions described herein can be used to prevent infections related to tuberculosis. In some embodiments, the vaccine is used for the prevention mycobacterium infections. Some embodiments relate to an injectable pharmaceutical vaccine composition comprising a composition of the present disclosure. In some embodiments, the vaccine can be used for the prevention of tuberculosis, nontuberculous mycobacteria (NTM), nontuberculosis lung disease, leprosy, mycobacterium avium-intracellulare, mycobacterium kansasii, mycobacterium marinum, mycobacterium ulcerans, mycobacterium chelonae, mycobacterium fortuitum, or mycobacterium abscessus. In some embodiments, the compounds and compositions described herein promote efficient uptake and transfection of target cells, including tissue macrophages and dendritic cells. The efficient delivery nucleic acids coding for antigen specific for infectious viruses or bacteria, and subsequent presentation of that antigen to elicit the desired immune response to protect against corresponding infections is a result. In some embodiments, the nucleic acid is a synthetic nucleic acid (e.g., engineered codon optimized mRNA) encoding an epitope of mycobacterium tuberculosis. In some embodiments, the epitopes are MHC class II epitopes included in larger open reading frames (ORFs), such as EsxV (Rv3619), EsxW (Rv3620c), EsxB / CFP10 (Rv3874), EsxA / ESAT-6 (Rv3875), ^Mtb39A (Rv1196), Ag85B (Rv1886c), or AsxH / TB10.4 (Rv0288). In some embodiments, the epitopes are shorter non-overlapping MHC II minimal 15-mer epitopes that were identified in individuals with latent tuberculosis infection (LTBI) (U.S. patent No. 10,703,784 which is incorporated herein by reference in its entirety, Arlehamn et al., (2013) PloS Pathog.9:e1003130, and Arlehamn et al., (2016) PloS Pathog.12:e1005760). Minimal MHC-II epitopes are defined as the 12-20 residue-long peptide containing the 9-residue core that is the primary determinant of binding strength to the class II molecule binding groove. Due to the open- ended class II binding groove, the flanking residues on either side of the core can vary. In some embodiments, these sequences are concatenated and encoded using a single mRNA. In some embodiments, the concatenated sequence is a combination of the larger open reading frames and the minimal 15-mer epitopes. In some embodiments, the combination of sequences included in a single concatenated sequence is selected to remove redundant protein sequences. In some embodiments the selection of minimal epitopes to be included in the single concatenated sequence is selected to provide optimum HLA donor coverage. In some embodiments the concatenated sequences are joined with nonimmunogenic linkers that reduce the potential for MHC Class II 83 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 neoepitopes. In some embodiments, the sequence of the peptide linker is comprised of GPGPG (SEQ ID NO: 228). In some embodiments, the nucleic acid is encoding MHC Class I epitopes. In some embodiments, the Class I epitopes are found in both tuberculosis mycobacterium and other nontuberculosis mycobacterium, or in the Bacillus Calmette-Guerin (BCG) vaccine. In some embodiments, the epitopes are found in tuberculosis mycobacterium. In some embodiments, the MHC Class I sequences are concatenated and encoded using a single mRNA. In some embodiments, the concatenated MHC Class I sequence is a combination of the larger open reading frames and the minimal 9-10-mer epitopes. In other embodiments, the mRNA cassette codes solely for a concatenated sequence of the minimal epitopes. In some embodiments, the combination of sequences included in a single concatenated sequence is selected to remove redundant protein sequences and in some embodiments the selection of minimal epitopes to be included in the single concatenated sequence is selected to provide optimum HLA donor coverage. In some embodiments, the vaccine candidate includes both an MHC-I and an MHC-II mRNA cassette. In some embodiments, both mRNAs are included in a single targeted LNP preparation. In some embodiments, the MHC-I and MHC-II mRNAs are combined in a 1:1 (wt:wt) ratio (MHC-I / MHC-II). In other embodiments, the mRNAs are included in ratios ranging from about 0.1-to-10 (wt:wt), from about 0.2-to-5 (wt:wt), and from about 0.5-to-2 (wt:wt). In some embodiments, a lipid nanoparticle (LNP) composition comprises an ionizable cationic lipid, sterol, one or more phospholipids comprising at least one anionic phospholipid, a conjugated lipid and one or more nucleic acid sequence encoding a T cell epitope from Mycobacterium tuberculosis (Mtb). In some embodiments, the nucleic acid sequence encodes a peptide that binds to MHC molecules and is recognized by a T cell receptor (generally 8-11 aa long for MHC class I / CD8 and 12+ for MHC class I / CD4). In some embodiments, a lipid nanoparticle (LNP) composition comprises an ionizable cationic lipid, sterol, one or more phospholipids comprising at least one anionic phospholipid, a conjugated lipid and one or more nucleic acid sequence encoding Mycobacterium tuberculosis antigens recognized by T cells. In some aspects, the nucleic acid sequence encodes a polypeptide that is recognized by T cells. Peptide fragments can be generated from an antigen that are recognized by T cell receptors. 84 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 In some embodiments, a lipid nanoparticle (LNP) composition comprises an ionizable cationic lipid, sterol, one or more phospholipids comprising at least one anionic phospholipid, a conjugated lipid and one or more nucleic acid sequences encoding a Mtb protein selected from the group consisting of: CFP10 / Rv3874, ESAT-6 / Rv3875, Mtb32A / Rv0125, Mtb39A / Rv1196 and Ag85B / Rv1886c. In some embodiments, a lipid nanoparticle (LNP) composition comprises an ionizable cationic lipid, sterol, one or more phospholipids comprising at least one anionic phospholipid, a conjugated lipid and one or more nucleic acid sequences selected from the group consisting of: SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7 and SEQ ID NO:220. In some embodiments, a lipid nanoparticle (LNP) composition comprises an ionizable cationic lipid, sterol, one or more phospholipids comprising at least one anionic phospholipid, a conjugated lipid and a nucleic acid sequence comprising one or more nucleic acid sequences selected from the group consisting of: SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7 and SEQ ID NO:220. In some embodiments, a lipid nanoparticle (LNP) composition comprises an ionizable cationic lipid, sterol, one or more phospholipids comprising at least one anionic phospholipid, a conjugated lipid and one or more nucleic acid sequences encodimg a Mtb protein selected from the group consisting of: EsxW / Rv3620c, EsxV / Rv3619c, PE13 / Rv1195, PPE30 / Rv1802, PPE40 / Rv2356c, and TB10.4 / Rv0288. In some embodiments, a lipid nanoparticle (LNP) composition comprises an ionizable cationic lipid, sterol, one or more phospholipids comprising at least one anionic phospholipid, a conjugated lipid and one or more nucleic acid sequences selected from the group consisting of: SEQ ID NO:1, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:31 SEQ ID NO:221 and SEQ ID NO:222. In some embodiments, a lipid nanoparticle (LNP) composition comprises an ionizable cationic lipid, sterol, one or more phospholipids comprising at least one anionic phospholipid, a conjugated lipid and a nucleic acid sequence comprising one or more nucleic acid sequences selected from the group consisting of: SEQ ID NO:1, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:31 SEQ ID NO:221 and SEQ ID NO:222. UTRs In some concatenated sequences, the untranslated regions (3’ and 5’ UTRs) are chosen to maximize mRNA stability and translation efficiency. UTRs may include those from viral proteins, or human proteins such as hemoglobin alpha (HBA) or hemoglobin beta (HBB) chains. 85 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 In some embodiments, chemically modified nucleic acids are incorporated in concatenated mRNA sequences. In some embodiments, the mRNA comprises a modified nucleoside. In some embodiments, the chemically modified residues incorporated are modifications on uridine. In some embodiments, the chemically modified nucleic acid incorporated is pseudouridine. In some embodiments, the chemically modified nucleic acid incorporated is N1-methylpseudouridine (also referred to as 1-methyl-pseudouridine). In some embodiments, the chemically modified nucleic acid incorporated is thiouridine. In some embodiments, the chemically modified nucleic acid incorporated is 5-methylcytidine. In some embodiments, the chemically modified nucleic acid incorporated is 5-methoxyuridine. In some embodiments, the chemically modified nucleic acid incorporated is 5-methylcytidine. In some embodiments, the chemically modified nucleic acid incorporated is N6-methyladenosine. In some embodiments, the chemically modified nucleic acid incorporated is 2’-O-methyluridine.2-thiouridine. In some embodiments, the mRNA sequence contains a polyA tail of between about 50-150 nucleotides in length, of between about 80-140 nucleotides in length, of between about 100-140 nucleotides in length. In some embodiments the polyA tail may be interrupted by a short sequence to improve stability. Compositions In some embodiments, the composition further comprises a pharmaceutical excipient. In some embodiments, the lipidic nanoparticles are in an aqueous medium. In some embodiments, the nucleic acid is entrapped in the lipidic nanoparticle with an ionizable cationic lipid compound provided herein or combinations thereof, wherein the nucleic acid is either RNA or DNA. In some embodiments, the nucleic acid is mRNA. In some embodiments, the nucleic acid is siRNA. In some embodiments, the nucleic acid is DNA. In some embodiments, the lipidic nanoparticle comprises a membrane comprising phosphatidylcholine and a sterol. In some embodiments, the sterol is cholesterol. In some embodiments, the lipidic nanoparticle comprises a membrane comprising phosphatidylcholine, ionizable cationic lipid (ICL). In some embodiments, the ICL have a structure of Formula I, and cholesterol, wherein the membrane separates the inside of the lipidic nanoparticles from the aqueous medium. In some embodiment, the ICL have a structure as shown in Table 1A. In some embodiments, the phosphatidylcholine is distearoylphosphatidylcholine (DSPC) or hydrogenated soy phosphatidylcholine (HSPC). In some embodiments, the ionizable cationic lipid to cholesterol 86 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 molar ratios is from about 65:35 to 40:60. In some embodiments, the ICL to cholesterol molar ratio is from about 60:40 to about 45:55. In some embodiments, the phosphatidylcholine to cholesterol molar ratio is from about 1:5 to about 1:2. In some embodiments, the membrane further comprises a polymer-conjugated lipid. In some embodiments, the lipidic nanoparticle comprises ICL, DSPC, cholesterol and polymer-conjugated lipid in a about 49.5:10.3:39.6:2.5 molar ratio. In some embodiments, the polymer-conjugated lipid is PEG(2000)-dimyristoylglycerol (PEG-DMG) or PEG(Mol. weight 2,000)-dimyristoylphosphatidylethanolamine (PEG-DMPE). The compositions of this disclosure may be administered by various routes, for example, to effect systemic delivery via intravenous, parenteral, intraperitoneal, or topical routes. The compositions may be administered intravenously, subcutaneously, or intraperitoneally to a subject. In some embodiments, the disclosure provides methods for in vivo delivery of nucleic acids to a subject. In some embodiments, the composition is a liquid pharmaceutical formulation for parenteral administration. In some embodiments, the composition is a liquid pharmaceutical formulation for subcutaneous, intramuscular, or intradermal administration. In some embodiments, the composition is in the form of a lyophilized powder, that is subsequently reconstituted with aqueous medium prior to administration. In some embodiments, a lipid nanoparticle (LNP) composition comprises an ionizable cationic lipid having the chemical structure of Formula (I): wherein , ACTIVE Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 wherein a is 0 or 1; b is 1, 2, 3 or 4, provided the sum a+b is 1, 2, 3 or 4; R2and R3are each independently (C1-C4) alkyl optionally substituted with hydroxyl; and n is an integer equal to 2, 3 or 4. wherein a and b of the two R1hydrocarbon chains are the same or different, or one of the two R1hydrocarbon chains is a saturated C12-C18alkyl. In some embodiments, ionizable cationic lipid compositions are provided. In some embodiments, a lipid nanoparticle (LNP) composition comprises an ionizable cationic lipid having the chemical structure of Formula (I-A): wherein , 2, 3 or 4; R2and R3are each independently (C1-C4) alkyl optionally substituted with hydroxyl; and n is an integer equal to 2, 3 or 4. In some embodiments, a and b of the two R1hydrocarbon chains are the same. In some embodiments, a and b of the two R1hydrocarbon chains are different. In some embodiments, one of the two R1hydrocarbon chains is a saturated C12-C18alkyl. In some embodiments, ionizable cationic lipid compositions are provided. In some embodiments, a lipid nanoparticle (LNP) composition comprises an ionizable cationic lipid having the chemical structure of Formula (I-A): wherein 88 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 , 2, 3 or 4; n is an integer equal to 3. In some embodiments, a and b of the two R1hydrocarbon chains are the same. In some embodiments, a and b of the two R1hydrocarbon chains are different. In some embodiments, one of the two R1hydrocarbon chains is a saturated C12-C18alkyl. In some embodiments, ionizable cationic lipid compositions are provided. In some embodiments, a lipid nanoparticle (LNP) composition comprises an ionizable cationic lipid having the chemical structure of Formula (I-A): wherein R1is a saturated C15-C18 hydrocarbon chain, R2and R3are each methyl; and n is an integer equal to 3. In some embodiments, a and b of the two R1hydrocarbon chains are the same. In some embodiments, a and b of the two R1hydrocarbon chains are different. In some embodiments, one of the two R1hydrocarbon chains is a saturated C12-C18alkyl. In some embodiments, the disclosure provides certain LNP compositions. In some aspects, the LNP compositions comprise: a nucleic acid; an ionizable cationic lipid at a N / P ratio of 3 to 8 relative to the nucleic acid in a total amount of 40-65 mol% of the total lipid content of the LNP composition; a sterol in a total amount of 0.5-50 mol% of the total lipid content of the LNP composition; one or more phospholipids in a total amount of phospholipids of 5-50 mol% of the total lipid content of the LNP composition; and a conjugated lipid in a total amount of 0.5-2.5 mol% of the total lipid content of the LNP composition. In some aspects, the LNP composition is further characterized in that: the nucleic acid is mRNA; the ionizable cationic lipid is present in 89 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 the LNP composition at a N / P ratio of 4 to 7 relative to the nucleic acid; the sterol is cholesterol; and the conjugated lipid is a PEG-containing conjugated lipid. In some aspects, the one or more phospholipids in the LNP comprise at least two phospholipids having mismatched acyl chain lengths. In some aspects, the one or more phospholipids in the LNP comprise a phosphatidylserine (PS) lipid in a total amount of 2.5-10 mol% of the total lipid content of the LNP composition. In some aspects, the phosphatidylserine (PS) lipid in the LNP consists of, consists essentially of or comprises dipalmitoylphosphatidyl-L-serine ((L-serine)DPPS). In some aspects, the one or more phospholipids in the LNP comprise a phospholipid selected from the group consisting of: distearoylphosphatidylcholine (DSPC) and hydrogenated soy phosphatidylcholine (HSPC). In some aspects, the one or more phospholipids in the LNP consist of distearoylphosphatidylcholine (DSPC) and dipalmitoylphosphatidyl-L-serine ((L-serine)DPPS). In some aspects, the PEG- containing conjugated lipid in the LNP is PEG(2000)-dimyristoylglycerol (PEG-DMG). In some aspects, the LNP composition has 5-50 mol% total phospholipid, including compositions with 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 mol% total phospholipid. In some embodiments, the LNP composition is further characterized by: the sterol in a total amount of 0.5- 45.5 mol% of the total lipid content of the LNP composition; and the one or more phospholipids in a total amount of phospholipids of 5-50 mol% of the total lipid content of the LNP composition. In some embodiments, the sterol in the LNP composition is cholesterol. In some embodiments, the ionizable cationic lipid is KC3-OA (Racemic). In some embodiments, the ionizable cationic lipid is KC3-OA(S). In some embodiments, the ionizable cationic lipid is KC3-OA(R). In some embodiments, the ionizable cationic lipid is KC4-OA (Racemic). In some embodiments, the ionizable cationic lipid is KC4-OA(S). In some embodiments, the ionizable cationic lipid is KC3- OA(R). In some embodiments, the ionizable cationic lipid is a mixture of KC3-OA and KC4-OA. In some embodiments, the LNP composition comprises a total of 48-54 mol% of the ionizable cationic lipid. In some embodiments, the one or more phospholipids comprise a phosphatidylserine (PS) lipid. In some embodiments, the PS lipid in the LNP composition is DPPS. In some embodiments, the PS lipid in the LNP composition is present in a total of 5 mol%. In some embodiments, the LNP composition comprises a DSPC phospholipid. In some embodiments, the LNP composition comprises 7.5-20 mol% of a DSPC phospholipid. 90 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 In some embodiments, the sterol in the LNP composition is cholesterol. In some embodiments, the LNP composition comprises 25-40 mol% cholesterol. In some embodiments, the sterol in the LNP composition is beta sitosterol. In some embodiments, the LNP composition comprises 33-35.5 mol% beta sitosterol. In some embodiments, the PEG-containing conjugated lipid in the LNP composition is PEG-DMG. In some embodiments, the LNP composition comprises 1.5-4.0 mol% PEG- containing conjugated lipid in the LNP composition is PEG-DMG. In some embodiments, the PEG-containing conjugated lipid in the LNP composition is PEG-DLG. In some embodiments, the LNP composition comprises 1.0-4.0 mol% PEG-containing conjugated lipid in the LNP composition is PEG-DLG. In some embodiments, a lipid nanoparticle (LNP) vaccine composition comprises: a nucleic acid; a KC3 ionizable cationic lipid at a N / P ratio of 3 to 7 relative to the nucleic acid in a total amount of 46-54 mol% of the total lipid content of the LNP composition; one or more phospholipids in a total amount of phospholipids of 5-20 mol% of the total lipid content of the LNP composition; a conjugated lipid in a total amount of 1.0-3.5 mol% of the total lipid content of the LNP composition; and cholesterol. In some embodiments, the one or more phospholipids in the LNP comprises an anionic phospholipid in a total of 2-8 mol% of the total lipid content of the LNP composition. In some aspects, the anionic phospholipid is a phosphatidylserine (PS). In some embodiments, the anionic phospholipid is an anionic phospholipid selected from the group consisting of: distearoylphosphatidylglycerol (DSPG) and dipalmitoyphosphatidylglycerol (DPPG). In some embodiments, the anionic phospholipid is an anionic phospholipid selected from the group consisting of: dipalmitoylphosphatidyl-L-serine (DPPS), or distearoylphosphatidyl-L- serine (DSPS). Methods of use Targeting of dendritic cells Dendritic cells (DCs) are specialized antigen-presenting cells that play a central role in initiating and regulating adaptive immunity. Owing to their potent antigen (Ag) presentation capacity and ability to generate distinct T-cell responses, efficient and specific delivery of Ags to DCs is the cornerstone for generating Ag-specific effector and memory cells against tumors or pathogens. 91 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 Dendritic cells can be generated from human blood monocytes by adding granulocyte- macrophage colony-stimulating factor (GM-CSF), IL-4, and IFN-gamma to differentiate monocyte-derived DC in vitro. Cells in culture exhibit both dendritic and veiled morphologies, the former being adherent, and the latter suspended. Phenotypically, they are CD1a- / dim, CD11a+, CD11b++, CD11c+, CD14dim / -, CD16a- / dim, CD18+, CD32dim / -, CD33+, CD40+, CD45R0+, CD50+, CD54+, CD64- / dim, CD68+, CD71+, CD80dim, CD86+ / ++, MHC class I++ / , HLA- DR++ / , HLA-DP+, and HLA-DQ (Geiseler et al. Dev Immunol.1998;6(1-2):25-39). Alternatively, human primary blood dendritic cell lines have been developed and are commercially available from Creative Biolabs. CD8+ T cells can produce IL2, IFN-γ, and TNF, cytokines that are known to have critical functions during mycobacterium tuberculosis infection. Importantly, CD8+ T cells have cytolytic functions to kill mycobacterium tuberculosis -infected cells via granule-mediated function (via perforin, granzymes, and granulysin) or Fas-Fas ligand interaction to induce apoptosis. In humans, CD8+ T cell can produce granulysin, which can kill mycobacterium tuberculosis directly. Therefore, it is anticipated that antigen generating mRNA LNPs delivered to DC will stimulate a CD8+ T cell response to fight against mycobacterium tuberculosis infection. CD8+ T cells are able to recognize M. tuberculosis specific antigens (as peptides) presented by classical and non-classical MHC molecules. Classically restricted CD8+ T cells have been identified that recognize antigens presented by antigen presenting cells in the context of classical MHC Ia (HLA-A, -B, -C) molecules. Non-classically restricted CD8+ T cells include those CD8+ T cells that are capable of recognizing Mg antigen in the context of HLA-E molecules (non-MHC 1a), glycolipids associated with group 1 CD1 molecules and MHC I-related molecules (MR1) such as mucosal associated invariant T cells (MAIT). Finally, γδ T cells represent a separate population of CD8 (and CD4) T cells that have both innate and adaptive functions in response to mycobacterium tuberculosis infection. CD8+ T cells have been shown to play direct functions in response to mycobacterium tuberculosis infection but they also play important roles in orchestrating many different functions in the overall host immune response (e.g., interaction to provide optimal CD4 T cell function) In some embodiments, LNPs are added to cultured human dendritic cells at an appropriate concentration, (e.g.1-5 µg / mL mRNA). After some time to allow for cellular uptake and antigen expression, human T cells (HemaCare) can be added, and the cell culture media is sampled at 92 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 various times for INF-γ by Elisa (R&D Systems, DIF50C). Alternatively, the cells can be analyzed by flow cytometry for CD8+ marker or intracellular INFγ production (PE anti-human IFN- γ antibody, Biolegend). In some embodiments, LNPs are administered into a subject at a dose of about 0.01 to about 5 mg / kg mRNA by any route of administration known in the art and / or outlined above. According to some embodiments, a proportion of LNPs are taken up DC cells, while most will accumulate in the liver and spleen. The DC cells can express the antigenic peptide, process it for MHC I presentation and travel to the lymph node for presentation to naïve T cells inducing an education of memory T-cells towards the antigen. In some embodiments, LNPs that have been modified with a targeting ligand such as phosphatidylserine are administered into a subject at a dose of about 1 µg to about 500 µg mRNA. In other embodiments, the targeting ligand is phosphatidylglycerol. In some embodiments the targeted LNPs are administered at a reduced dose of about 1 µg to about 100 ug mRNA. According to some embodiments, a higher proportion of LNPs can be taken up DC cells, allowing for increased production of antigenic peptide compared to non-targeted LNP and a more efficient vaccination against the pathogen. For example, assessing the CD8+ reactivity to the in vivo produced antigen could be accomplished by measuring INFγ plasma levels by species specific IFN-gamma Quantikine ELISA Kits from R&D Systems. Disclosed herein are methods for preventing mycobacteria infection, such as Mycobacterium tuberculosis. Additional mycobacteria include, but are not limited to, Mycobacterium avium complex, Mycobacterium leprae, Mycobacterium gordonae, Mycobacterium abscessus, Mycobacterium abscessus, Mycobacterium mucogenicum, and Mycobacterium. Administration of a vaccine for inducing a second immune response may provide MHC class II - presented epitopes that are capable of eliciting a CD4 + helper T cell response against cells expressing antigens from which the MHC presented epitopes are derived. Alternatively or additionally, administration of a vaccine for inducing a second immune response may provide MHC class I - presented epitopes that are capable of eliciting a CD8 + T cell response against cells expressing antigens from which the MHC presented epitopes are derived. Furthermore, administration of a vaccine for inducing a second immune response may provide one or more neo - epitopes (including known neo epitopes) as well as one or more epitopes not containing 93 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 cancer specific somatic mutations but being expressed by cancer cells and preferably inducing an immune response against cancer cells, preferably a cancer specific immune response. In some embodiments, administration of a vaccine for inducing a second immune response provides neo - epitopes that are MHC class Il - presented epitopes and / or are capable of eliciting a CD4 + helper T cell response against cells expressing antigens from which the MHC presented epitopes are derived as well as epitopes not containing cancer - specific somatic mutations that are MHC class I - presented epitopes and / or are capable of eliciting a CD8 + T cell response against cells expressing antigens from which the MHC presented epitopes are derived. In some embodiments, the epitopes do not contain cancer - specific somatic mutations. As used herein, "cellular immune response”, a "cellular response”, a “cellular response against an antigen” or a similar term are meant to include a cellular response directed to cells characterized by presentation of an antigen with class I or class II MHC . The cellular response relates to cells called T cells or T - lymphocytes which act as either “helper cells” or “killer cells”. The helper T cells (also termed CD4 + T cells ) play a central role by regulating the immune response and the killer cells (also termed cytotoxic T cells, cytolytic T cells, CD8 + T cells or CTLS ) kill diseased cells such as cancer cells, preventing the production of more diseased cells. In some embodiments, the present disclosure involves the stimulation of an anti-Mycobacterium tuberculosis CTL response against the mycobacterium expressing one or more expressed antigens and preferably presenting such expressed antigens with class I MHC. An “antigen” according to aspects of the disclosure covers any substance that will elicit an immune response. In particular, an “antigen” relates to any substance, preferably a peptide or protein, that reacts specifically with antibodies or T-lymphocytes (T cells). As used herein, the term “antigen” comprises any molecule which comprises at least one epitope. Preferably, an antigen in the context of the present disclosure is a molecule which, optionally after processing, induces an immune reaction, which is preferably specific for the antigen (including cells expressing the antigen). According to aspects of the present disclosure, any suitable antigen may be used, which is a candidate for an immune reaction, wherein the immune reaction is preferably a cellular immune reaction. In the context of the embodiments of the present disclosure, the antigen is presented by a cell, for example by an antigen presenting cell which includes a diseased cell, in particular a cancer cell, in the context of MHC molecules, which results in an immune reaction 94 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 against the antigen. An antigen can be a product which corresponds to or is derived from a naturally occurring antigen. Such naturally occurring antigens may include tumor antigens. As used herein, an " antigen peptide ” refers to a portion or fragment of an antigen which is capable of stimulating an immune response, preferably a cellular response against the antigen or cells characterized by expression of the antigen and preferably by presentation of the antigen such as diseased cells, in particular cancer cells. Preferably, an antigen peptide is capable of stimulating a cellular response against a cell characterized by presentation of an antigen with class I MHC and preferably is capable of stimulating an antigen - responsive cytotoxic T - lymphocyte (CTL). The antigen peptides according to embodiments are MHC class I and / or class II presented peptides or can be processed to produce MHC class I and / or class II presented peptides. In some embodiments, the antigen peptides comprise an amino acid sequence substantially corresponding to the amino acid sequence of a fragment of an antigen. In some embodiments, said fragment of an antigen is an MHC class I and / or class II presented peptide. In some embodiments, an antigen peptide comprises an amino acid sequence substantially corresponding to the amino acid sequence of such fragment and is processed to produce such fragment, i.e., an MHC class I and / or class II presented peptide derived from an antigen. According to some embodiments, if a peptide is to be presented directly, i.e., without processing, in particular without cleavage, the peptide has a length which is suitable for binding to an MHC molecule, in particular a class I MHC molecule. In some embodiments, the peptide has a length of 7-20 amino acids, 7-12 amino acids, 8-11 amino acids, for example 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 amino acids in length. The main types of professional antigen - presenting cells are dendritic cells, which have the broadest range of antigen presentation, and are probably the most important antigen - presenting cells, macrophages, B - cells, and certain activated epithelial cells. Dendritic cells (DCs) are leukocyte populations that present antigens captured in peripheral tissues to T cells via both MHC class II and I antigen presentation pathways. It is well known that dendritic cells are potent inducers of immune responses and the activation of these cells is a critical step for the induction of antitumoral immunity. Dendritic cells are conveniently categorized as “immature” and “mature” cells, which can be used as a simple way to discriminate between two well characterized phenotypes. However, this nomenclature should not be construed to exclude all possible intermediate stages of differentiation. Immature dendritic cells are characterized as antigen presenting cells 95 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 with a high capacity for antigen uptake and processing, which correlates with the high expression of Fcγ receptor and mannose receptor. The mature phenotype is typically characterized by a lower expression of these markers, but a high expression of cell surface molecules responsible for T cell activation such as class I and class II MHC, adhesion molecules (e.g. CD54 and CD11) and costimulatory molecules (e .g., CD40 , CD80 , CD86 and 4 - 1 BB). Dendritic cell maturation is referred to as the status of dendritic cell activation at which such antigen - presenting dendritic cells lead to T cell priming, while presentation by immature dendritic cells results in tolerance. Dendritic cell maturation is chiefly caused by biomolecules with microbial features detected by innate receptors (bacterial DNA, viral RNA, endotoxin, etc), pro-inflammatory cytokines (TNF, IL - 1, IFNs), ligation of CD40 on the dendritic cell surface by CD4OL, and substances released from cells undergoing stressful cell death. The dendritic cells can be derived by culturing bone marrow cells in vitro with cytokines, such as granulocyte - macrophage colony - stimulating factor (GM CSF) and tumor necrosis factor alpha. Non - professional antigen-presenting cells do not constitutively express the MHC class II proteins required for interaction with naive T cells; these are expressed only upon stimulation of the non - professional antigen-presenting cells by certain cytokines such as IFNγ. "Antigen presenting cells” can be loaded with MHC class I presented peptides by transducing the cells with nucleic acid, preferably mRNA, encoding a peptide or polypeptide comprising the peptide to be presented, e.g. a nucleic acid encoding the antigen. In some embodiments, a pharmaceutical composition comprising a gene delivery vehicle that targets a dendritic or other antigen presenting cell is administered to a patient, resulting in transfection that occurs in vivo. As used herein, a “nucleic acid” refers to a deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). In some embodiments, the nucleic acid is an RNA, for example an in vitro transcribed RNA (IVT RNA ) or synthetic RNA. Nucleic acids include according to aspects of the disclosure genomic DNA, cDNA, mRNA, recombinantly produced and chemically synthesized molecules. According to aspects of the disclosure, a nucleic acid may be present as a single - stranded or double - stranded and linear or covalently circularly closed molecule. A nucleic acid can, according to aspects of the disclosure , be isolated. In some embodiments, the nucleic acid (i) was amplified in vitro, for example via polymerase chain reaction (PCR), (ii) was produced recombinantly by cloning, (iii) was purified, for example, by cleavage and separation by gel electrophoresis, or (iv) was synthesized, for example, by chemical 96 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 synthesis. A nucleic can be employed for introduction into, i.e. transfection of cells , in particular, in the form of RNA which can be prepared by in vitro transcription from a DNA template. The RNA can moreover be modified before application by stabilizing sequences, capping, and polyadenylation. As used herein, the term “RNA” refers to a molecule which comprises ribonucleotide residues and preferably being entirely or substantially composed of ribonucleotide residues. As used herein, the term “ribonucleotide” refers to a nucleotide with a hydroxyl group at the 2'- position of a B-D- ribofuranosyl group. As used herein, the term “RNA” comprises double- stranded RNA, single-stranded RNA, isolated RNA such as partially or completely purified RNA, essentially pure RNA, synthetic RNA, and recombinantly generated RNA such as modified RNA which differs from naturally occurring RNA by addition, deletion, substitution and / or alteration of one or more nucleotides. Such alterations can include addition of non-nucleotide material, such as to the end(s) of a RNA or internally, for example at one or more nucleotides of the RNA. Nucleotides in RNA molecules can also comprise non - standard nucleotides, such as non-naturally occurring nucleotides or chemically synthesized nucleotides or deoxynucleotides. These altered RNAs can be referred to as analogs or analogs of naturally occurring RNA. In some embodiments, the RNA is a mRNA. As used herein, the term "mRNA” means "messenger RNA” and refers to a "transcript” which can be generated by using a DNA template and encodes a peptide or polypeptide. Typically, an mRNA comprises a 5'-UTR, a protein coding region, and a 3' -UTR . mRNA only possesses limited half-life in cells and in vitro. In the context of aspects of the present disclosure, mRNA may be generated by in vitro transcription from a DNA template. As used herein, the term “modification” in the context of the RNA used in aspects of the disclosure includes any modification of an RNA which is not naturally present in said RNA. According to some embodiments, the RNA does not have uncapped 5'- triphosphates. Removal of such uncapped 5'- triphosphates can be achieved by treating RNA with a phosphatase. The RNA according to aspects of the disclosure may have modified ribonucleotides in order to increase its stability and / or decrease cytotoxicity. For example, in some embodiment, 5-methylcytidine in the RNA is substituted partially or completely, for cytidine. In some embodiments, 5-methylcytidine in the RNA is substituted completely for cytidine. Alternatively or additionally, in some embodiments, pseudouridine in the RNA used is substituted partially or 97 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 completely, for uridine. In some embodiments, pseudouridine in the RNA used is substituted completely for uridine. In some embodiments, the RNA can be provided with a 5-cap or 5'- cap analog. The term “5 - cap” refers to a cap structure found on the 5'- end of an mRNA molecule and generally consists of a guanosine nucleotide connected to the mRNA via an unusual 5' to 5 triphosphate linkage. In some embodiments, this guanosine is methylated at the 7-position. The term "conventional 5' - cap” refers to a naturally occurring RNA 5 '-cap, for example to the 7 - methylguanosine cap (m'G). In some embodiments, the 5'-cap includes a 5'-cap analog that resembles the RNA cap structure and is modified to possess the ability to stabilize RNA and / or enhance translation of RNA if attached thereto, preferably in vivo and / or in a cell. According to aspects of the disclosure, the stability and translation efficiency of RNA may be modified as required. For example, RNA may be stabilized and its translation increased by one or more modifications having a stabilizing effects and / or increasing translation efficiency of RNA. Such modifications are described, for example, in PCT / EP2006 / 009448 incorporated herein by reference in its entirety. In order to increase expression of the RNA used according to aspects of the present disclosure, it may be modified within the coding region, i.e. the sequence encoding the expressed peptide or protein, preferably without altering the sequence of the expressed peptide or protein, so as to increase the GC content to increase mRNA stability and to perform a codon optimization and, thus, enhance translation in cells. Lipid nanoparticle (LNP) compositions are provided herein, and methods of making and using the same. In some embodiments, the LNP compositions comprise a nucleic acid such as messenger ribonucleic acid (mRNA). In some embodiments, the LNP compositions are vaccines, including LNP formulations comprising mRNA that encodes an immune system epitope, or an antigen recognized by the immune system. In some aspects, the LNP comprises nucleic acid containing a chemically modified mRNA, wherein the chemically modified mRNA comprises N1-methylpseudouridine. In some aspects, the LNP comprises nucleic acid comprising a 5’ untranslated region (UTR) and 3’ UTR, polyA tail of about 80 to about 140 nucleotides in length, and (i) a 5’ enzymatic or (ii) a 5’ clean cap. In some aspects, the LNP comprises a chemically modified mRNA, wherein the chemically modified mRNA comprises N1-methylpseudouridine 98 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 In some embodiments, the LNP composition comprises: (a) a nucleic acid; (b) an ionizable cationic lipid comprising a KC3 ionizable cationic lipid at a N / P ratio of 3 to 7 relative to the nucleic acid, the ionizable cationic lipid present in the LNP composition in a total amount of 46- 54 mol% of a total lipid content of the LNP composition; (c) one or more phospholipids in a total amount of 5-20 mol% of the total lipid content of the LNP composition; (d) one or more anionic phospholipids in a total amount of 2-8 mol% of the total lipid content of the LNP composition; (e) a conjugated lipid in a total amount of 1-3.5 mol% of the total lipid content of the LNP composition; and (f) a sterol such cholesterol (e.g., in an amount providing the remainder of the LNP composition). In some aspects, the one or more anionic phospholipids is a phosphatidylserine (PS) or phosphatidylglycerol (PG). In some aspects, the one or more anionic phospholipids is selected from the group consisting of: dipalmitoylphosphatidyl-L-serine (DPPS), or distearoylphosphatidyl-L-serine (DSPS), distearoylphosphatidylglycerol (DSPG), and dipalmitoyphosphatidylglycerol (DPPG). In some aspects, the one or more phospholipids comprises distearoylphosphatidylcholine (DSPC), hydrogenated soy phosphatidylcholine (HSPC), dipalmitoylphosphatidylcholine (DPPC) or a combination thereof. In some aspects, the conjugated lipid is PEG(2000)-dimyristoylglycerol (PEG-DMG). In some aspects, the sterol is cholesterol. In some aspects, the ionizable cationic lipid comprises 3-((S)-2,2-di((Z)-octadec-9- en-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylpropan-1-amine (KC3-OA). In some aspects, the ionizable cationic lipid further comprises a KC4 ionizable cationic lipid, such as 4-rac-2,2-di((Z)- octadec-9-en-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylbutan-1-amine (AKG-KC4-OA). In some aspects, the LNP composition consists of: 48 mol% KC3-OA; 5 mol% DPPS or DSPG; 5-10 mol% DSPC or HSPC; 1.5 mol% PEG-DMG; and cholesterol. In some aspects, the LNP composition consists of: 48 mol% KC3-OA; 5 mol% DPPS or DSPG; 5 mol% DSPC or HSPC; 1.5 mol% PEG- DMG; and 40.5 mol% cholesterol. In some aspects, the LNP composition consists of: 48 mol% KC3-OA; 5 mol% DPPS or DSPG; 10 mol% DSPC or HSPC; 1.5 mol% PEG-DMG; and 35.5 mol% cholesterol. In some embodiments, a method of eliciting a T cell response in a host is provided, comprising administering to the host a nucleic acid sequence disclosed herein or a nucleic acid having at least 90% sequence identity or complementarity to a sequence disclosed herein, and / or a sequence encoding a T cell epitope from Mycobacterium tuberculosis (Mtb), or a polynucleotide 99 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 sequence having at least 90% identity or complementarity to a sequence disclosed herein and / or a polynucleotide sequence of a Mtb antigen recognized by T cells. A lipid nanoparticle (LNP) composition consisting of: a messenger ribonucleic acid (mRNA) encoding one or more Mycobacterium tuberculosis (Mtb) proteins selected from the group consisting of CFP10 / Rv3874, ESAT-6 / Rv3875, Mtb32A / Rv0125, Mtb39A / Rv1196, Ag85B / Rv1886c, EsxW / Rv3620c, EsxV / Rv3619c, PE13 / Rv1195, PPE30 / Rv1802, PPE40 / Rv2356c and TB10.4 / Rv0288; an ionizable cationic lipid comprising a KC3 ionizable cationic lipid at a N / P ratio of 4 to 6 relative to the mRNA, the ionizable cationic lipid present in the LNP composition in a total amount of 46-54 mol% of a total lipid content of the LNP composition; one or more phospholipids selected from the group consisting of distearoylphosphatidylcholine (DSPC), hydrogenated soy phosphatidylcholine (HSPC), and dipalmitoylphosphatidylcholine (DPPC), in a total amount of 10-18 mol% of the total lipid content of the LNP composition; one or more anionic phospholipids selected from the group consisting of dipalmitoylphosphatidyl-L-serine (DPPS), or distearoylphosphatidyl-L-serine (DSPS), distearoylphosphatidylglycerol (DSPG), and dipalmitoyphosphatidylglycerol (DPPG) in a total amount of 2-8 mol% of the total lipid content of the LNP composition; PEG(2000)- dimyristoylglycerol (PEG-DMG) in a total amount of 1-3.5 mol% of the total lipid content of the LNP composition; and cholesterol (e.g., 35.5 – 40.5 mol% cholesterol). Aspects of the disclosure relate to a lipid nanoparticle (LNP) composition comprising a KC3 ionizable cationic lipid, cholesterol, one or more phospholipids comprising at least one anionic phospholipid, a conjugated lipid and one or more nucleic acid sequence encoding a T cell epitope from Mycobacterium tuberculosis (Mtb). In some embodiments, the LNP composition comprises 48 mol% of the KC3 ionizable cationic lipid, 40.5 mol% cholesterol, 5 mol% (L-Serine) DPPS lipid, 5 mol% DSPC or DPPC; and a total of 10 mol% phospholipid concentration, wherein each mol% refers to the mol% of the total lipid content of the LNP composition. In some embodiments, the LNP composition comprises 48 mol% of the KC3 ionizable cationic lipid, 40.5 mol% cholesterol, and 5 mol% (L-Serine) DPPS lipid, wherein each mol% refers to the mol% of the total lipid content of the LNP composition. In some embodiments, the LNP composition comprises 48 mol% of the KC3 ionizable cationic lipid, 38.5 mol% cholesterol, and 5 mol% (L-Serine) DPPS lipid, wherein each mol% refers to the mol% of the total lipid 100 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 content of the LNP composition. In some embodiments, the LNP composition comprises 45 mol% of the KC3 ionizable cationic lipid, 42.7 mol% cholesterol, and 5 mol% (L-Serine) DPPS lipid, wherein each mol% refers to the mol% of the total lipid content of the LNP composition. In some embodiments, the LNP composition comprises 50 mol% of the KC3 ionizable cationic lipid, 38.5 mol% cholesterol, 5 mol% (L-Serine) DPPS lipid, and a total of 10 mol% phospholipid concentration, wherein each mol% refers to the mol% of the total lipid content of the LNP composition. In some embodiments, the LNP composition comprises 48 mol% of the KC3 ionizable cationic lipid, 40.5 mol% cholesterol, 5 mol% (L-Serine) DPPS lipid, and a total of 10 mol% phospholipid concentration, wherein each mol% refers to the mol% of the total lipid content of the LNP composition. In some embodiments, the LNP composition comprises 48 mol% of the KC3 ionizable cationic lipid, 40.5 mol% cholesterol, 5 mol% (L-Serine) DPPS lipid, 5 mol% DSPC or DPPC; and a total of 10 mol% phospholipid concentration, wherein each mol% refers to the mol% of the total lipid content of the LNP composition. In some embodiments, the LNP composition comprises 46.5 mol% of the KC3 ionizable cationic lipid, 42 mol% cholesterol, 5 mol% (L-Serine) DPPS lipid, wherein each mol% refers to the mol% of the total lipid content of the LNP composition. In some embodiments, the LNP composition comprises 15 mol% total phospholipid and 35.5 mol% cholesterol. In some embodiments, the LNP composition comprises 10 mol% total phospholipid and 40.5 mol% cholesterol. In some embodiments, the LNP composition comprises 40.5 mol% cholesterol, 5% anionic lipid (DPPS) and 5% PC (DSPC or DPPC) and a total of 10 mol% phospholipid concentration. In some embodiments, the LNP composition comprises 48 mol% cationic ionizable lipid, 5 mol% PC (DPPC), 5 mol% anionic lipid (DPPS), 40.5 mol% cholesterol, 1.5 mol% conjugated lipid (PEG-DMG). In some aspects, the LNP comprises a nucleic acid sequence (e.g., mRNA) encoding a T cell epitope from Mycobacterium tuberculosis (Mtb), or a Mtb antigen recognized by T cells. In some aspects, the LNP comprises a nucleic acid sequence that is mRNA encoding a concatenated sequence of T-cell epitopes present in Mtb or a Mtb antigen recognized by T Cells. In some aspects, the LNP comprises a nucleic acid sequence that is mRNA encoding one or more Mtb proteins selected from the group consisting of CFP10 / Rv3874, ESAT-6 / Rv3875, Mtb32A / Rv0125, Mtb39A / Rv1196, and Ag85B / Rv1886c. In some aspects, the LNP comprises a nucleic acid sequence that is mRNA comprising one or more nucleic acid sequences selected from the group consisting of: SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, and SEQ ID 101 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 NO:220. In some aspects, the LNP comprises a nucleic acid sequence that is mRNA encoding one or more Mtb proteins selected from the group consisting of EsxW / Rv3620c, EsxV / Rv3619c, PE13 / Rv1195, PPE30 / Rv1802, PPE40 / Rv2356c and TB10.4 / Rv0288. In some aspects, the LNP comprises a nucleic acid sequence that is mRNA comprising one or more nucleic acid sequences selected from the group consisting of: SEQ ID NO:1, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:31, SEQ ID NO:221, and SEQ ID NO:222. In some aspects, the LNP comprises a nucleic acid sequence that comprises the concatenated nucleic acid-encoded sequence includes an N- terminal and C-terminal signal peptide selected from Sec / MITD, Lamp1, HLA-Dra, or tPA. In some aspects, the LNP comprises a nucleic acid sequence that is an mRNA having a sequence selected from SEQ ID NOs: 34, 36, 38, 40, 42, 44, 224 and 226. In some aspects, the LNP comprises nucleic acid that is an mRNA encoding an amino acid sequence selected from SEQ ID NOs: 33, 35, 37, 39, 41, 43, 86-105, 207-210, 223 and 225. In some embodiments, the one or more nucleic acids is a mRNA. In some embodiments, the mRNA encodes a concatenated sequence of T-cell epitopes present in Mtb. In some embodiments, the concatenated sequence of T-cell epitopes comprise an amino acid sequence set forth in SEQ ID NOs: 1-17, 106-137, 138-203. In some embodiments, the concatenated sequence of T-cell epitopes comprises an amino acid sequence with at least 90% sequence identity (e.g. 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more) with amino acid sequence set forth in SEQ ID NOs: 1-17, 45-85, 106-137, 138-203. In some embodiments, the concatenated nucleotide sequence comprises two or more sequences encoding for peptides or proteins that can elicit MHC class II-restricted CD4 T cell responses. In some embodiments, the two or more MHC class II epitopes selected from the group: EsxV (Rv3619), EsxW (Rv3620c), EsxB / CFP10 (Rv3874), EsxA / ESAT-6 (Rv3875), ^Mtb39A (Rv1196), Ag85B (Rv1886c), and EsxH / TB10.4 (Rv0288). In some embodiments, the two or more MHC class II epitopes comprises peptides or proteins from EsxV (Rv3619), EsxW (Rv3620c), EsxB / CFP10 (Rv3874), EsxA / ESAT-6 (Rv3875), ^Mtb39A (Rv1196), Ag85B (Rv1886c), and EsxH / TB10.4 (Rv0288) (SEQ ID NOs.1-7). In some embodiments, the concatenated nucleic acid-encoded sequence includes the seven proteins in and order N-terminal to C-terminal selected from: EsxB / CFP10 (Rv3874), EsxA / ESAT-6 (Rv3875), EsxH / TB10.4 (Rv0288), ^Ag85B (Rv1886c), ^Mtb39A (Rv1196), EsxW (Rv3620c), and EsxV (Rv3619), or EsxB / CFP10 (Rv3874), EsxA / ESAT-6 (Rv3875), 102 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 EsxW (Rv3620c), EsxV (Rv3619), EsxH / TB10.4 (Rv0288), ^Ag85B (Rv1886c), and ^Mtb39A (Rv1196), or EsxB / CFP10 (Rv3874), ^Mtb39A (Rv1196), EsxA / ESAT-6 (Rv3875), EsxW (Rv3620c), EsxH / TB10.4 (Rv0288), EsxV (Rv3619), and ^Ag85B (Rv1886c). (SEQ ID NOs.18, 19, and 20) In some embodiments, the composition comprises a nucleic acid encoding for 5 or more non-overlapping CD4 T cell epitopes in the form of peptides, wherein optionally the peptides are from 12 to 50 amino acids long. In some embodiments, the concatenated nucleic acid-encoded sequence optionally comprises 10 selected MHC-II epitopes comprising: AQIYQAVSAQAAAIH (SEQ ID NO. 9), PSPSMGRDIKVQFQS (SEQ ID NO. 10), GINTIPIAINEAEYV (SEQ ID NO. 11), AAFQGAHARFVAAAA (SEQ ID NO. 12), AGWLAFFRDLVARGL (SEQ ID NO. 13), ASIIRLVGAVLAEQH (SEQ ID NO. 14), MSFVTTQPEALAAAA (SEQ ID NO. 8), MHVSFVMAYPEMLAA (SEQ ID NO. 15), AYGSFVRTVSLPVGA (SEQ ID NO. 16), and LENDNQLLYNYPGAL (SEQ ID NO.17). In some embodiments, the concatenated nucleic acid-encoded sequence includes GPGPG (SEQ ID NO.228) linker sequences between each of the concatenated epitopes. In some embodiments, the one or more nucleic acid comprises a nucleic acid sequence set forth in SEQ ID NOs: 34, 36, 38, 40, 42, and 44. In some embodiments, the one or more nucleic acid comprises a nucleic acid sequence having at least 90% identity, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% with a nucleic acid sequence set forth in SEQ ID NOs: 34, 36, 38, 40, 42, and 44. In some embodiments, the concatenated nucleic acid-encoded sequence includes an N- terminal and C-terminal signal peptide selected from Sec / MITD, Lamp1, HLA-Drα, or tPA. In some embodiments, the one or more nucleic acid comprises a chemically modified mRNA, wherein the chemically modified mRNA comprises N1-methylpseudouridine. In some embodiments, the one or more nucleic acid comprises a 5’ untranslated region (UTR) and 3’ UTR, polyA tail of about 80 to about 140 nucleotides in length, and (i) a 5’ enzymatic or (ii) a 5’ clean cap. In some embodiments, the one or more nucleic acid is an mRNA having a sequence selected from SEQ ID NOs: 34, 36, 38, 40, 42, 44, 224 and 226. 103 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 In some embodiments, the one or more nucleic acid is an mRNA and wherein the amino acid sequence encoded by the mRNA is selected from SEQ ID NOs: 33, 35, 37, 39, 41, 43, 86- 105, 207-210, 223 and 225. In some embodiments, the nucleic acid-encoded concatenated sequence comprises two or more MHC class I epitopes selected from SEQ ID NOs: 106-137 and 138-203. In some embodiments, the nucleic acid-encoded concatenated sequence includes two or more MHC class I epitopes found in Mycobacterium tuberculosis, depleted of epitopes found in BCG, and selected from SEQ ID NOs: 86-95. In some embodiments, the nucleic acid-encoded concatenated sequence includes two or more MHC class I epitopes that are ordered to minimize junctional neoepitope generation, and selected from SEQ ID NOs: 86-105. In some embodiments, the nucleic acid sequence has at least 90% (e.g. at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%) identity to the nucleic acid sequences of the disclosure. In some embodiments, the polypeptide sequence at least 90% identity (e.g. at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%) to the polypeptide sequences of the disclosure. Aspects of the disclosure relate to a method of preventing a bacterial or viral infection, the method comprising administering to a subject in need thereof an effective amount of the composition provided herein to elicit an immune response. Aspects of the disclosure provide methods of vaccinating a subject comprising administering to the subject a single dosage of the compositions described herein comprising a nucleic acid (e.g. mRNA) encoding a polypeptide in an effective amount to vaccinate the subject. In some embodiments, the nucleic acid is formulated within a cationic lipidic nanoparticle. In some embodiments, the lipidic nanoparticle composition is administered as a single injection. In some embodiments, the bacterial infection is Mycobacterium tuberculosis infection. In some embodiments, the lipidic nanoparticle is administered parenterally. In general, administration to a patient is by intradermal injection is possible. However, injection may also be carried out intranodally into a lymph node (Maloy et al. (2001), Proc Natl Acad Sci USA 98:3299-3033). The resulting cells present the complex of interest and are recognized by autologous cytotoxic T lymphocytes which then propagate. 104 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 In some embodiments, the composition is administered by inhalation. In some embodiments, the composition is formulated as nasal spray, and / or aerosol. Actual dosage levels of the active agents in the pharmaceutical compositions disclosed herein may be varied so as to obtain an amount of the active agent which is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient. “Parenteral” as used herein in the context of administration means modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, epidural and intrasternal injection and infusion. The phrases “parenteral administration” and “administered parenterally” as used herein refer to modes of administration other than enteral (i.e., via the digestive tract) and topical administration, usually by injection or infusion, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, inhalation, subcapsular, subarachnoid, respiratory mucosal, intraspinal, epidural and intrasternal injection and infusion. Intravenous injection and infusion are often (but not exclusively) used for liposomal drug administration. Dosage regimens can be adjusted to provide the optimum desired response (e.g., a therapeutic response). For example, one or more doses may be administered over time or the dose may be proportionally reduced or increased as indicated by the exigencies of the therapeutic situation. In some embodiments, the dose comprises between 0.01 to 5 mg / kg of nucleic acid. In some embodiments, the dose comprises between 0.01 to 5 mg / kg of mRNA. In some embodiments, the dose comprises between 0.01 to 3 mg / kg of nucleic acid. In some embodiments, the dose comprises between 0.01 to 3 mg / kg of mRNA. In some embodiments, the dose comprises between 0.01 to 1 mg / kg of nucleic acid. In some embodiments, the dose comprises between 0.01 to 1 mg / kg of mRNA. In some embodiments, the dose comprises between 0.01 to 0.5 mg / kg of nucleic acid. In some embodiments, the dose comprises between 0.01 to 0.5 mg / kg of mRNA. In some embodiments, the dose comprises between 0.01 to 1 mg / kg of mRNA. In some embodiments, the 105 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 dose comprises between 0.01 to 0.1 mg / kg of nucleic acid. In some embodiments, the dose comprises between 0.01 to 0.05 mg / kg of mRNA. In some embodiments, the dose comprises between 0.01 to 0.1 mg / kg of nucleic acid. In some embodiments, the dose comprises between 0.01 to 0.05 mg / kg of mRNA. The dosage of the compounds and / or of their pharmaceutically acceptable salts or the LNPs comprising the compounds and / or of their pharmaceutically acceptable salts may vary within wide limits and should naturally be adjusted, in each particular case, to the individual conditions and to the pathogenic agent to be controlled. Additional embodiments The following additional embodiments are provided for illustrative purposes. Embodiment 1: A lipid nanoparticle (LNP) composition comprising a KC3 ionizable cationic lipid, cholesterol, one or more phospholipids comprising at least one anionic phospholipid, a conjugated lipid and one or more nucleic acid sequence encoding a T cell epitope from Mycobacterium tuberculosis (Mtb). Embodiment 2: The composition of embodiment 1, wherein the composition comprises: 48 mol% of the KC3 ionizable cationic lipid, 40.5 mol% cholesterol, 5 mol% (L-Serine) DPPS lipid, 5 mol% DSPC or DPPC; and a total of 10 mol% phospholipid concentration; wherein each mol% refers to the mol% of the total lipid content of the LNP composition. Embodiment 3: The composition of embodiment 1 or embodiment 2, wherein the one or more nucleic acids is a mRNA. Embodiment 4: The composition of embodiment 3, wherein the mRNA encodes a concatenated sequence of T-cell epitopes present in Mtb. Embodiment 5: The composition of embodiment 4, wherein the concatenated sequence of T-cell epitopes comprise an amino acid sequence set forth in SEQ ID NOs: 1-17, 106-137, 138- 203. Embodiment 6: The composition of embodiment 4, wherein the concatenated sequence of T-cell epitopes comprises an amino acid sequence with at least 90% sequence identity with amino acid sequence set forth in SEQ ID NOs: 1-17, 45-85, 106-137, 138-203. 106 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 Embodiment 7: The composition of embodiment 5 or embodiment 6, wherein the concatenated nucleotide sequence comprises two or more sequences encoding for peptides or proteins that can elicit MHC class II-restricted CD4 T cell responses. Embodiment 8: The composition of embodiment 7, wherein the two or more MHC class II epitopes selected from the group: EsxV (Rv3619), EsxW (Rv3620c), EsxB / CFP10 (Rv3874), EsxA / ESAT-6 (Rv3875), ^Mtb39A (Rv1196), Ag85B (Rv1886c), and EsxH / TB10.4 (Rv0288). Embodiment 9: The composition of embodiment 7, wherein the two or more MHC class II epitopes comprises peptides or proteins from EsxV (Rv3619), EsxW (Rv3620c), EsxB / CFP10 (Rv3874), EsxA / ESAT-6 (Rv3875), ^Mtb39A (Rv1196), Ag85B (Rv1886c), and EsxH / TB10.4 (Rv0288) (SEQ ID NOs.1-7). Embodiment 10: The composition of embodiment 5 or embodiment 6 wherein the concatenated nucleic acid-encoded sequence includes the seven proteins in and order N-terminal to C-terminal selected from: EsxB / CFP10 (Rv3874), EsxA / ESAT-6 (Rv3875), EsxH / TB10.4 (Rv0288), ^Ag85B (Rv1886c), ^Mtb39A (Rv1196), EsxW (Rv3620c), and EsxV (Rv3619), or EsxB / CFP10 (Rv3874), EsxA / ESAT-6 (Rv3875), EsxW (Rv3620c), EsxV (Rv3619), EsxH / TB10.4 (Rv0288), ^Ag85B (Rv1886c), and ^Mtb39A (Rv1196), or EsxB / CFP10 (Rv3874), ^Mtb39A (Rv1196), EsxA / ESAT-6 (Rv3875), EsxW (Rv3620c), EsxH / TB10.4 (Rv0288), EsxV (Rv3619), and ^Ag85B (Rv1886c). (SEQ ID NOs.18, 19, and 20) Embodiment 11: The composition of any one of embodiments 7-10, the composition comprising a nucleic acid encoding for 5 or more non-overlapping CD4 T cell epitopes in the form of peptides, wherein optionally the peptides are from 12 to 50 amino acids long. Embodiment 12: The composition of embodiment 5 or embodiment 6, wherein the concatenated nucleic acid-encoded sequence optionally comprises 10 selected MHC-II epitopes comprising: AQIYQAVSAQAAAIH (SEQ ID NO.9), PSPSMGRDIKVQFQS (SEQ ID NO.10), GINTIPIAINEAEYV (SEQ ID NO. 11), AAFQGAHARFVAAAA (SEQ ID NO. 12), AGWLAFFRDLVARGL (SEQ ID NO. 13), ASIIRLVGAVLAEQH (SEQ ID NO. 14), MSFVTTQPEALAAAA (SEQ ID NO. 8), MHVSFVMAYPEMLAA (SEQ ID NO. 15), AYGSFVRTVSLPVGA (SEQ ID NO.16), and LENDNQLLYNYPGAL (SEQ ID NO.17). 107 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 Embodiment 13: The composition of embodiment 7, wherein the concatenated nucleic acid-encoded sequence includes GPGPG (SEQ ID NO: 228) linker sequences between each of the concatenated epitopes. Embodiment 14: The composition of any one of embodiments 3-13, wherein the one or more nucleic acid comprises a nucleic acid sequence set forth in SEQ ID NOs: 34, 36, 38, 40, 42, and 44. Embodiment 15: The composition of any one of embodiments 3-13, wherein the one or more nucleic acid comprises a nucleic acid sequence having at least 90% identity, at least 95%, or at least 99% with a nucleic acid sequence set forth in SEQ ID NOs: 34, 36, 38, 40, 42, and 44. Embodiment 16: The composition of any one of embodiments 3-13, wherein the concatenated nucleic acid-encoded sequence includes an N-terminal and C-terminal signal peptide selected from Sec / MITD, Lamp1, HLA-Drα, or tPA. Embodiment 17: The composition of any one of embodiments 3-16, wherein the one or more nucleic acid comprises a chemically modified mRNA, wherein the chemically modified mRNA comprises N1-methylpseudouridine. Embodiment 18: The composition of any one of embodiments 3-16, wherein the one or more nucleic acid comprises a 5’ untranslated region (UTR) and 3’ UTR, polyA tail of about 80 to about 140 nucleotides in length, and (i) a 5’ enzymatic or (ii) a 5’ clean cap. Embodiment 19: The composition of any one of embodiments 3-16, wherein the one or more nucleic acid is an mRNA having a sequence selected from SEQ ID NOs: 34, 36, 38, 40, 42, and 44. Embodiment 20: The composition of any one of embodiments 3-16, wherein the one or more nucleic acid is an mRNA and wherein the amino acid sequence encoded by the mRNA is selected from SEQ ID NOs: 33, 35, 37, 39, 41, 43, 86-105, and 207-210. Embodiment 21: The composition of embodiment 5 or embodiment 6, wherein the nucleic acid- encoded concatenated sequence comprises two or more MHC class I epitopes selected from SEQ ID NOs: 106-137 and 138-203. Embodiment 22: The composition of embodiment 5 or embodiment 6, wherein the nucleic acid-encoded concatenated sequence includes two or more MHC class I epitopes found in mycobacterium tuberculosis, depleted of epitopes found in BCG, and selected from SEQ ID NOs: 86-95. 108 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 Embodiment 23: The composition of embodiment 5 or embodiment 6, wherein the nucleic acid-encoded concatenated sequence includes two or more MHC class I epitopes that are ordered to minimize junctional neoepitope generation, and selected from SEQ ID NOs: 86-105. Embodiment 24: The composition of any one of embodiments 1-23, wherein the cationic lipid is KC3-OA, KC3-PA, KC3-01, KC3-C17 (8:1), or KC3-C15 (C8:1). Embodiment 25: The composition of any one of embodiments 1-24, wherein the LNP comprises the conjugated lipid in a total amount of less than 2 mol% of the total lipid content of the LNP composition. Embodiment 26: The composition of any one of embodiments 1-24, wherein the ionizable cationic lipid in a total amount of 45-55 mol% of the total lipid content of the LNP composition; wherein cholesterol is in a total amount of 35-45 mol% of the total lipid content of the LNP composition; wherein the total amount of the one more phospholipid is 7-15 mol% of the total lipid content of the LNP composition; wherein the one or more phospholipids consist of DSPC and the PS lipid is one or more lipids selected from the group consisting of the L-serine configuration of DPPS and DSPS; and the total amount of the PS lipid is about 5 mol% of the total lipid content of the LNP composition. Embodiment 27: The composition of any one of embodiments 1-24, wherein the conjugated lipid is PEG-DMG; and wherein the PS lipid is selected from the group consisting of: DSPS (L-isomer) and DPPS. Embodiment 28: The composition of any one of embodiments 1-27, wherein the ionizable cationic lipid is KC3-OA. Embodiment 29: The composition of any one of embodiments 1-28, wherein the LNP composition has a N / P ratio of 4 to 7. Embodiment 30: The composition of any one of embodiments 1-28, wherein the LNP composition has a N / P ratio of 5 to 6. Embodiment 31: A nucleic acid lipid nanoparticle (LNP) composition comprising: a mRNA having at least 90% identity with a nucleic acid sequence set forth in SEQ ID NOs: 34, 36, 38, 40, 42, and 44, ionizable cationic lipid KC3-PA, and a (L-Serine) PS lipid in a total amount of 2.5-10 mol% of the total lipid content of the LNP composition. 109 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 Embodiment 32: The composition of embodiment 31, wherein the PS lipid is (L-Serine) DSPS, (L-Serine) DPPS, or a mixture thereof, and the LNP composition further comprises cholesterol and a second phospholipid selected from the group consisting of: DSPC, DOPC, DPPC, HSPC, and SM. Embodiment 33: A nucleic acid lipid nanoparticle (LNP) composition comprising: a mRNA having at least 90% identity with a nucleic acid sequence set forth in SEQ ID NOs: 34, 36, 38, 40, 42, and 44; a KC3 ionizable cationic lipid in a total amount of 40-65 mol% of the total lipid content of the LNP composition; cholesterol in a total amount of 23.5 - 43.5 mol% of the total lipid content of the LNP composition; a (L-Serine) PS lipid in a total amount of 2.5-10 mol% of the total lipid content of the LNP composition; DSPC or HSPC phospholipid in a total amount of 5-25 mol% of the total lipid content of the LNP composition; and a PEG-containing conjugated lipid in a total amount of 0.5 mol% to 2.5 mol% of the total lipid content of the LNP composition. Embodiment 34: The composition of embodiment 1 comprising an ionizable lipid having the chemical structure: , 2, 3 or 4; R2and R3are each independently methyl; and n is an integer equal to 2 or 3. Embodiment 35: The composition of embodiment 34, wherein n is 3. 110 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 Embodiment 36: The composition of any of the preceding embodiments, wherein the composition is a vaccine. Embodiment 37: A pharmaceutical composition comprising the lipid nanoparticle of any one of the precenting embodiments, and a pharmaceutically acceptable carrier. Embodiment 38: A nucleic acid encoding a concatenated amino acid sequence of T-cell epitopes present in mycobacterium tuberculosis, the nucleic acid having at least 90% identity with a nucleic acid sequence set forth in SEQ ID NOs: 34, 36, 38, 40, 42, and 44. EXAMPLES While this disclosure has been described in relation to certain embodiments, and many details have been set forth for purposes of illustration, it will be apparent to those skilled in the art that this disclosure includes additional embodiments, and that some of the details described herein may be varied considerably without departing from this disclosure. This disclosure includes such additional embodiments, modifications and equivalents. In particular, this disclosure includes any combination of the features, terms, or elements of the various illustrative components and examples. Unless explicitly indicated otherwise, the isomer form of the phosphatidylserine lipids used in the Examples is phosphatidyl-L-serine. Certain examples are provided below to illustrate various embodiments of the embodiments disclosed herein. One of ordinary skill in the art will recognize that the various embodiments disclosed herein are not limited to these specific illustrative examples. Example 1. Synthesis of Ionizable Lipids 1. 2-((S)-2,2-di((6Z,12Z)-octadeca-6,12-dien-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylethan-1- amine (AKG-KC2-01, O-12095) 2. 3-((S)-2,2-di((6Z,12Z)-octadeca-6,12-dien-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylpropan- 1-amine (AKG-KC3-01, O-12096) 3. 2-((S)-2,2-di((Z)-octadec-9-en-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylethan-1-amine (AKG-KC2-OA, O-11880) 4. 2-((S)-2,2-di((Z)-hexadec-9-en-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylethan-1-amine (AKG-KC2-PA, O-11879) 111 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 5. 3-((S)-2,2-di((Z)-octadec-9-en-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylpropan-1-amine (AKG-KC3-OA, O-11957) 6. 3-((S)-2,2-di((Z)-hexadec-9-en-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylpropan-1-amine (AKG-KC3-PA, O-12418) 7. 3-((S)-2,2-di((Z)-heptadec-8-en-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylpropan-1-amine (AKG-KC3-C17(C8:1)) 8. (S)-3-(2,2-diheptadecyl-1,3-dioxolan-4-yl)-N,N-dimethylpropan-1-amine (AKG-KC3- C17) Synthesis of 2-((S)-2,2-di((6Z,12Z)-octadeca-6,12-dien-1-yl)-1,3-dioxolan-4-yl)-N,N- dimethylethan-1-amine (AKG-KC2-01, O-12095) 3-((S)-2,2-di((6Z,12Z)-octadeca-6,12-dien-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylpropan-1- amine (AKG-KC3-01, O-12096) FIG.32 is a scheme showing the synthesis of AKG-KC2-01 and AKG-KC3-01. Experimental Procedure Synthesis of (6Z,12Z)-1-bromooctadeca-6,12-diene, 2 Br To a solution of (6Z,12Z)-octadeca-6,12-dien-1-ol, 1 (3.6 g, 13.7mmol) in dichloromethane (50 mL) at 0 ºC was added methane sulfonyl chloride (1.26 mL, 16.4mmol) and triethylamine (3.6 mL, 20.5 mmol). The resulting solution was warmed to room temperature and stirred for 2 hours. The mixture was quenched with water and extracted with dichloromethane (2X100 mL). The combined organics were washed with brine then dried over magnesium sulfate then filtered. The filtrate was concentrated under vacuum to give a crude oil. The resulting oil was dissolved in diethyl ether (50 mL), added to a stirring slurry of magnesium bromide ethyl etherate (7 g, 27.4 mmol) in diethyl ether (50 mL) at 0C. The mixture was warmed to room temperature and stirred for 2 hours. The reaction mixture was quenched with water and extracted with ethyl acetate (2X100 mL). The combined organics were washed with brine then dried over magnesium sulfate then filtered. The filtrate was concentrated under vacuum to give a crude oil. The crude oil was purified 112 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 by chromatography on silica using 5-10% ethyl acetate in n-hexane as eluant to give (6Z,12Z)-1- bromooctadeca-6,12-diene, 3 (2.9 g, 8.89 mmol, 65%) as a yellow oil.1H NMR (300 MHz, CDCl3): 5.36-5.33 (m, 4H), 3.42-3.37 (t, J = 7.5 Hz, 2H), 2.04-1.97 (m, 8H), 1.83-1.83 (m, 2H), 1.37-1.28 (m, 14H), 0.90-0.86 (t, J = 6.6 Hz, 3H). Synthesis of (6Z,12Z,25Z,31Z)-heptatriaconta-6,12,25,31-tetraen-19-ol, 3 OH 17 15 13 12 10 8 5 3 A solution of (6Z,12Z)-1-bromooctadeca-6,12-diene, 2 (2 g, 6.08 mmol) in ether (10 mL) was added to a mixture of magnesium turnings (162 mg, 6.69 mmol) and iodine in ether (2 mL) under argon at room temperature. The mixture stirred at room temperature for 90 minutes (magnesium turnings consumed) whereupon ethyl formate (0.24 mL, 3.04 mmol) was added. After stirring for one hour at room temperature, the reaction was quenched with 1N HCl solution. The mixture was extracted with ethyl acetate (2X100 mL) and the combined organics washed with water then brine. The organics were dried under magnesium sulfate, filtered, and the filtrate concentrated under vacuum to give a crude oil. The resulting oil was dissolved in ethanol (10 mL) and added to a solution of potassium hydroxide (260 mg) in water (3 mL). After stirring for 12 hours, the mixture pH was adjusted 4 with 2N HCl. The aqueous solution was extracted with dichloromethane (2X) and combined. The organics were washed with brine then dried under magnesium sulfate and filtered. The filtrate was concentrated under vacuum to give a crude oil. Purification of the crude oil on silica using 10-30% ethyl acetate in n-hexane as eluant to give (6Z,12Z,25Z,31Z)- heptatriaconta-6,12,25,31-tetraen-19-ol, 3 (0.29 g, 0.55 mmol, 18%) as a clear oil.1H NMR (300 MHz, CDCl3): 5.36-5.32 (m, 8H), 3.57 (bs, 1H), 3.33-3.32, (m, 2H), 2.13-1.97 (m, 16H), 1.36-1.29 (m, 34H), 0.90-0.86 (t, J = 6.6 Hz, 6H). Synthesis of (6Z,12Z,25Z,31Z)-heptatriaconta-6,12,25,31-tetraen-19-one, 4 113 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 O 17 15 13 12 10 8 5 3 1 To a mixture of (6Z,12Z,25Z,31Z)-heptatriaconta-6,12,25,31-tetraen-19-ol, 3 (0.29 g, 0.55 mmol) and sodium carbonate (3 mg, 0.03 mmol) in dichloromethane was added pyridinium chlorochromate (236 mg, 1.1 mmol) at 0 °C. The mixture was warmed to room temperature and stirred for one hour. After one hour, silica gel (1 g) was added to reaction and the mixture filtered. The filtrate was concentrated, and the resulted oil purified on silica using 10-20% ethyl acetate in n-hexane as eluant to give (6Z,12Z,25Z,31Z)-heptatriaconta-6,12,25,31-tetraen-19-one, 4 (0.12 g, 0.23 mmol, 42%) as a clear oil.1H NMR (300 MHz, CDCl3): 5.36-5.32 (m, 8H), 3.36-3.32, (m, 1H), 2.40-2.35 (t, J = 6.6 Hz, 3H), 2.14-2.00 (m, 16H), 1.58-1.54 (m, 4H), 1.34-1.29 (m, 28H), 0.90-0.86 (t, J = 6.6 Hz, 6H). Synthesis of 2-((S)-2,2-di((9Z,12Z)-octadeca-9,12-dien-1-yl)-1,3-dioxolan-4-yl) ethan-1-ol, 7 OH (S) O A mixture of 4 (0.12 g, 0.23 mmol), (4S)-(+)-4-(2-hydroxyethyl)-2,2-dimethyl-1,3-dioxolane 5 (0.20 g, 1.38 mmol), and pyridinium p- toluene sulfonate (9 mg) in toluene (10 mL) was heated at reflux under nitrogen positive pressure. After 12 hours, the mixture was concentrated under vacuum to give a crude oil. The resulting crude oil was purified by chromatography on silica using 20-40% ethyl acetate in n-hexane as eluant to give 2-((S)-2,2-di((9Z,12Z)-octadeca-9,12-dien-1-yl)-1,3-dioxolan-4-yl) ethan-1-ol, 7 (0.11 g, 0.17 mmol, 77%) as a clear oil. 114 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 20231H NMR (300 MHz, CDCl3): 5.36-5.32 (m, 8H), 4.25-4.20 (m, 1H), 4.10-4.06 (m, 1H), 3.82-3.77 (m, 1H), 3.54-3.49 (m, 1H), 2.23-2.19 (t, J = 6.6 Hz, 3H), 2.14-2.00 (m, 16H), 1.84-1.78 (m, 2H), 1.62-1.51 (m, 6H), 1.34-1.29 (m, 28H), 0.90-0.86 (t, J = 6.6 Hz, 6H). Synthesis of 3-((S)-2,2-di((9Z,12Z)-octadeca-9,12-dien-1-yl)-1,3-dioxolan-4-yl)propan-1-ol, 8 OH (S) O A mixture of g, 0.95 mmol), (S)-(3)-(2,2-Dimethyl-1,3-dioxolane-4-yl)propanol 6 (0.76 g, 4.75 mmol), and pyridinium p- toluene sulfonate (36 mg) in toluene (10 mL) was heated at reflux under nitrogen positive pressure. After 12 hours, the mixture was concentrated under vacuum to give a crude oil. The resulting crude oil was purified by chromatography on silica using 20-40% ethyl acetate in n-hexane as eluant to3- ((S)-2,2-di((9Z,12Z)-octadeca-9,12-dien-1-yl)-1,3-dioxolan-4-yl)propan-1-ol, 8 (0.48 g, 0.76 mmol, 80%) as a clear oil.1H NMR (300 MHz, CDCl3): 5.34-5.29 (m, 8H), 4.06-4.02 (m, 2H), 3.67-3.47 (m, 2H), 3.45-3.43 (m, 1H), 2.12-2.01 (m, 16H), 1.65-1.62 (m, 8H), 1.34-1.29 (m, 32H), 0.89-0.85 (t, J = 6.6 Hz, 6H). Synthesis of 2-((S)-2,2-di((9Z,12Z)-octadeca-9,12-dien-1-yl)-1,3-dioxolan-4-yl)-N,N- dimethylethan-1-amine, (AKG-KC2-01, O-12095) N To a solution of - - - 4-yl) ethan-1-ol, 7 (0.49 g, 0.79 mmol) in dichloromethane (10 mL) at 0 ºC was added methanesulfonyl chloride (73 µL, 0.95 mmol) and triethylamine (0.26 mL, 1.2 mmol). The solution was warmed to room 115 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 temperature and stirred for an addition hour. The reaction was quenched with water and extracted with dichloromethane (2X100 mL). The organics were washed with brine then dried over magnesium sulfate and filtered. The filtrate was concentrated under vacuum to give a crude oil. A solution of 2M dimethylamine (10 mL) was added to the resulting crude oil and allowed to stir for 24 hours. The mixture was then quenched with water and extracted with dichloromethane (2X100 mL). The combined organics were washed with brine then dried over magnesium sulfate then filtered. The filtrate was concentrated under vacuum to give a crude oil. The crude oil was purified by chromatography on silica using 5-100% ethyl acetate in n-hexane as eluant to give 2-((S)-2,2- di((9Z,12Z)-octadeca-9,12-dien-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylethan-1-amine, (AKG- KC2-01, O-12095), (206 mg, 0.32 mmol, 41%) as a clear oil.1H NMR (300 MHz, CDCl3): 5.35-5.32 (m, 8H), 4.08-4.03 (m, 2H), 3.47 (t, J = 6.8 Hz, 1H), 2.36- 2.27 (m, 2H), 2.21 (s, 6H), 2.01-1.99 (m, 16H), 1.88-1.77 (m, 2H), 1.68-1.53 (m, 6H), 1.42-1.19 (m, 34H), 0.96-0.86 (t, J = 3.7 Hz, 6H). MS(APCI) for C43H79NO2: 642.6 Synthesis of 3-((S)-2,2-di((6Z, 12Z)-octadeca-6-12-dien-4-yl)-1,3-dioxolan-4-yl)-N,N- dimethylpropan-1-amine, AKG-KC3-01, O-12096) N (S) The procedure was previously described. 3-((S)-2,2-di((6Z, 12Z)-octadeca-6-12-dien-4-yl)-1,3-dioxolan-4-yl)-N,N-dimethylpropan-1- amine, (AKG-KC3-01, O-12096), (255 mg, 0.39 mmol, 51%) as a clear oil.1H NMR (300 MHz, CDCl3): 5.39-5.32 (m, 8H), 4.06-4.02 (m, 2H), 3.48-3.44 (m, 1H), 2.35-2.30 (m, 2H), 2.25 (s, 6H), 2.01-1.98 (m, 16H), 1.70-1.51 (m, 12H), 1.35-1.25 (m, 32H), 0.90-0.85 (t, J = 6.6 Hz, 6H). MS(APCI) for C44H81NO2: 656.6 116 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 Synthesis of 2-((S)-2,2-di((Z)-octadec-9-en-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylethan-1- amine (AKG-KC2-OA, O-11880) 2-((S)-2,2-di((Z)-hexadec-9-en-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylethan-1-amine (AKG- KC2-PA, O-11879) 3-((S)-2,2-di((Z)-octadec-9-en-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylpropan-1-amine (AKG- KC3-OA, O-11957) 3-((S)-2,2-di((Z)-hexadec-9-en-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylpropan-1-amine, (AKG-KC3-PA, O-12418 FIG.33 is a scheme showing the synthesis of AKG-KC2-OA, AKG-KC2-PA, AKG-KC3-OA, and AKG-KC3-PA Experimental Procedure (Refer to previously described synthesis of AKG-KC2-01) Synthesis of (Z)-1-bromooctadec-9-ene 3 Br 3 The procedure was (Z)-1-bromooctadec-9-ene, (6.4 g, 19.33 mmol) as a clear oil.1H NMR (300 MHz, CDCl3): 5.36-5.32 (m, 2H), 3.41 (t, J = 7.5 Hz, 2H), 2.01-1.99 (m, 4H), 1.87-1.82 (m, 2H), 1.44-1.26 (m, 22H), 0.87 (t, J = 6.6 Hz, 3H). (Z)-16-bromohexadec-7-ene 4 Br1H NMR (300 MHz, 2H), 2.01-1.99 (m, 4H), 1.87-1.82 (m, 2H), 1.44-1.26 (m, 18H), 0.89 (t, J = 6.6 Hz, 3H). Synthesis of (9Z,28Z)-heptatriaconta-9,28-dien-19-ol 5 117 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 OH The procedure was (9Z,28Z)-heptatriaconta-9,28-dien-19-ol (1.2 g, 2.25 mmol, 47%) as a solid.1H NMR (300 MHz, CDCl3): 5.36-5.29 (m, 4H), 3.57 (bs, 1H), 2.01-1.97 (m, 8H), 1.42-1.26 (m, 53H), 0.89 (t, J = 6.6 Hz, 6H). (7Z,26Z)-tritriaconta-7,26-dien-17-ol 6 OH1H NMR (300 MHz, (m, 8H), 1.42-1.26 (m, 45H), 0.89 (t, J = 6.6 Hz, 6H). Synthesis of (9Z,28Z)-heptatriaconta-9,28-dien-19-one 7 O The procedure was previously described. (9Z,28Z)-heptatriaconta-9,28-dien-19-one (0.89 g, 1.67 mmol, 74%) as a clear oil.1H NMR (300 MHz, CDCl3): 5.36-5.29 (m, 4H), 2.03-1.98 (m, 8H), 1.42-1.26 (m, 52H), 0.90- 0.89 (t, J = 6.6 Hz, 6H). 118 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 (7Z,26Z)-tritriaconta-7,26-dien-17-one 8 O1H NMR (300 MHz, 1.42-1.26 (m, 44H), 0.90- 0.89 (t, J = 6.6 Hz, 6H). Synthesis of 2-((S)-2,2-di((Z)-octadec-9-en-1-yl)-1,3-dioxolan-4-yl) ethan-1-ol 9 OH (S) O The procedure 2-((S)-2,2-di((Z)-octadec-9-en-1-yl)-1,3-dioxolan-4-yl) ethan-1-ol (0.39 g, 0.63 mmol, 74%) as a clear oil.1H NMR (300 MHz, CDCl3): 5.36-5.28 (m, 4H), 4.22-4.10 (m, 1H), 4.08-4.05 (m, 1H), 3.82- 3.79 (m, 2H), 3.48 (t, J = 6.8 Hz, 1H), 2.24-2.21 (m, 1H), 2.01-1.99 (m, 8H), 1.81-1.80 (m, 2H), 1.59-1.54 (m, 6H), 1.34-1.26 (m, 45H), 0.87 (t, J = 6.3 Hz, 6H). Synthesis of 2-((S)-2,2-di((Z)-hexadec-9-en-1-yl)-1,3-dioxolan-4-yl)ethan-1-ol, 10 OH The procedure was previously described. 119 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 2-((S)-2,2-di((Z)-hexadec-9-en-1-yl)-1,3-dioxolan-4-yl)ethan-1-ol (1.02 g, 1.65 mmol, 51%) as a clear oil.1H NMR (300 MHz, CDCl3): 5.36-5.29 (m, 4H), 4.23-4.10 (m, 1H), 4.07-4.05 (m, 1H), 3.82- 3.79 (m, 2H), 3.48 (t, J = 6.6 Hz, 1H), 2.24-2.12 (m, 1H), 2.01-1.97 (m, 8H), 1.84-1.78 (m, 2H), 1.57-1.55 (m, 8H), 1.34-1.29 (m, 35H), 0.87 (t, J = 6.3 Hz, 6H). Synthesis of 3-((S)-2,2-di((Z)-octadec-9-en-1-yl)-1,3-dioxolan-4-yl)propan-1-ol, 11 OH (S) O The procedure 3-((S)-2,2-di((Z)-octadec-9-en-1-yl)-1,3-dioxolan-4-yl) propan-1-ol (0.41 g, 0.65 mmol, 76%) as a clear oil1H NMR (300 MHz, CDCl3): 5.39-5.32 (m, 4H), 4.06-4.03 (m, 2H), 3.71-3.67 (m, 2H), 3.47- 3.46 (m, 1H), 2.01-1.99 (m, 10H), 1.66-1.59 (m, 4H), 1.56-1.54 (m, 6H), 1.34-1.26 (m, 44H), 0.87 (t, J = 6.3 Hz, 6H). Synthesis of 3-((S)-2,2-di((Z)-hexadec-9-en-1-yl)-1,3-dioxolan-4-yl)propan-1-ol OH (S) The procedure 3-((S)-2,2-di((Z)-hexadec-9-en-1-yl)-1,3-dioxolan-4-yl)propan-1-ol, (0.9 g, 1.56 mmol, 80%) as a clear oil. 120 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 20231H NMR (300 MHz, CDCl3): 5.39-5.28 (m, 4H), 4.06-4.01 (m, 2H), 3.71-3.67 (m, 2H), 3.47- 3.46 (m, 1H), 2.01-1.99 (m, 10H), 1.66-1.59 (m, 4H), 1.56-1.54 (m, 6H), 1.34-1.26 (m, 37H), 0.87 (t, J = 6.3 Hz, 6H). Synthesis of 2-((S)-2,2-di((Z)-octadec-9-en-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylethan-1- amine, (AKG-KC2-OA, O-11880) The procedure was previously described. 2-((S)-2,2-di((Z)-hexadec-9-en-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylethan-1-amine, (AKG- KC2-OA, O-11880), (200 mg, 0.31 mmol, 49%) as a clear oil.1H NMR (300 MHz, CDCl3): 5.38-5.28 (m, 4H), 4.08-4.01 (m, 2H), 3.48 (t, J = 6.8 Hz, 1H), 2.39- 2.24 (m, 2H), 2.21 (s, 6H), 2.01-1.97 (m, 8H), 1.82-1.77 (m, 2H), 1.68-1.52 (m, 6H), 1.34-1.26 (m, 46H), 0.87 (t, J = 6.3 Hz, 6H). MS(APCI) for C43H83NO2: 646.7 Synthesis of 2-((S)-2,2-di((Z)-hexadec-9-en-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylethan-1- amine, (AKG-KC2-PA, O-11879) N The procedure was previously described. 121 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 2-((S)-2,2-di((Z)-hexadec-9-en-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylethan-1-amine, (AKG- KC2-PA, O-11879), (195 mg, 0.33 mmol, 18%) as a clear oil.1H NMR (300 MHz, CDCl3): 5.35-5.28 (m, 4H), 4.08-4.02 (m, 2H), 3.48 (t, J = 6.6 Hz, 1H), 2.38- 2.27 (m, 2H), 2.20 (s, 6H), 2.01-1.99 (m, 8H), 1.97-1.80 (m, 2H), 1.77-1.52 (m, 6H), 1.34-1.29 (m, 38H), 0.87 (t, J = 6.3 Hz, 6H). MS(APCI) for C39H75NO2: 590.6 Synthesis of 3-((S)-2,2-di((Z)-octadec-9-en-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylpropan-1- amine, (AKG-KC3-OA, O-11957) N (S) The procedure was previously described. 3-((S)-2,2-di((Z)-octadec-9-en-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylpropan-1-amine, (AKG- KC3-OA, O-11957), (160 mg, 0.24 mmol, 37%) as a clear oil.1H NMR (300 MHz, CDCl3): 5.39-5.28 (m, 4H), 4.06-4.01 (m, 2H), 3.44 (t, J = 6.8 Hz, 1H), 2.26 (t, J = 6.8 Hz, 2H), 2.20 (s, 6H), 2.01-1.97 (m, 8H), 1.82-1.77 (m, 2H), 1.60-1.43 (m, 8H), 1.34-1.26 (m, 46H), 0.87 (t, J = 6.3 Hz, 6H). MS(APCI) for C44H85NO2: 660.6 Synthesis of 3-((S)-2,2-di((Z)-hexadec-9-en-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylpropan-1- amine, (AKG-KC3-PA, O-12418) 122 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 N (S) O The procedure was 3-((S)-2,2-di((Z)-hexadec-9-en-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylpropan-1-amine, (AKG- KC3-PA, O-12418) (300 mg, 0.49 mmol, 32%) as a clear oil.1H NMR (300 MHz, CDCl3): 5.39-5.28 (m, 4H), 4.06-4.01 (m, 2H), 3.47-3.42 (m, 1H), 2.43- 2.41 (m, 2H), 2.31 (s, 6H), 2.01-1.97 (m, 8H), 1.70-1.52 (m, 6H), 1.27-1.18 (m, 42H), 0.87 (t, J = 6.6 Hz, 6H). MS(APCI) for C44H85NO2: 604.6 Synthesis of 3-((S)-2,2-di((Z)-heptadec-8-en-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylpropan-1- amine, AKG-KC3-C17(C8:1) Synthesis of (S)-3-(2,2-diheptadecyl-1,3-dioxolan-4-yl)-N,N-dimethylpropan-1-amine, AKG-KC3-C17 FIG.34 is a scheme showing the synthesis of AKG-KC3-C17(C8:1) and AKG-KC3-C17. Experimental Procedure Synthesis of (9Z,26Z)-pentatriaconta-9,26-dien-18-one, 2 O To a stirring solution of oleoyl chloride (10 g, 33.3 mmol) in toluene (50 mL) at 0 ºC was added triethylamine (5.8 mL, 33.3 mmol). A heavy precipitate formed, and the mixture was allowed to stir at room temperature for 8 hours. The mixture was quenched with 2% sulfuric acid solution 123 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 and then extracted with ethyl acetate. The organics were washed with brine then dried over magnesium sulfate and filtered. The filtrate was concentrated under vacuum to give a crude oil. The resulting oil was diluted with ethanol (20 mL) and [2N NaOH] (30 mL) was added. The mixture was heated at 100 °C for 12 hours then cooled. The mixture was diluted with 2N HCl solution until a pH 4 was obtained. The mixture was extracted with ethyl acetate. The combined organics were washed with brine then dried over magnesium sulfate and filtered. The filtrate was concentrated under vacuum to give a crude oil. Purification of the oil on silica using 10-20% ethyl acetate in n-hexane as eluant gave (9Z,26Z)-pentatriaconta-9,26-dien-18-one, 2 (3.8 g, 44%) as a yellow oil.1H NMR (300 MHz, CDCl3): δ ppm 5.35-5.31 (m, 4H), 2.39-2.34 (m, 4H), 2.0-1.85 (m, 8H), 1.57-1.52 (m, 4H), 1.27-1.25 (m, 40H), 0.88 (t, J = 6.6 Hz, 3H). Synthesis of 3-((S)-2,2-di((Z)-heptadec-8-en-1-yl)-1,3-dioxolan-4-yl)propan-1-ol, 3 OH (S) O Procedure previously described synthesis of AKG-KC2-01 3-((S)-2,2-di((Z)-heptadec-8-en-1-yl)-1,3-dioxolan-4-yl) propan-1-ol, 3 (0.7 g, 1.15 mmol, 65%) as a clear oil.1H NMR (300 MHz, CDCl3): δ ppm 5.38-5.31 (m, 4H), 4.08-4.02 (m, 2H), 3.67-3.66 (m, 2H), 3.48-3.43 (m, 1H), 2.15-2.13 (m, 1H), 2.00-1.98 (m, 8H), 1.65-1.56 (m, 8H), 1.27-1.25 (m, 44H), 0.88 (t, J = 6.6 Hz, 6H). Synthesis of (S)-3-(2,2-diheptadecyl-1,3-dioxolan-4-yl)propan-1-ol, 4 124 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 OH (S) O A solution of 3- 1-ol (1.3 g, 2.15 mmol) in methanol / ethyl acetate (20 mL, 1:1 / v:v) was hydrogenated at 1 atm (hydrogen balloon) over 10% palladium on carbon (100 mg) for 2 hours. The mixture was evacuated of hydrogen and flowed with nitrogen. The mixture was filtered over celite, and the filtrate concentrated under vacuum to give (S)-3-(2,2-diheptadecyl-1,3-dioxolan-4-yl) propan-1-ol, 4 (1.3 g, quant.) as a clear oil.1H NMR (300 MHz, CDCl3): δ ppm 4.10-4.01 (m, 2H), 3.71-3.64 (m, 1H), 3.47-3.43 (m, 2H), 2.05-2.01 (m, 1H), 1.63-1.51 (m, 8H), 1.42-1.22 (m, 58H), 0.87 (t, J = 6.6 Hz, 6H). Synthesis of 3-((S)-2,2-di((Z)-heptadec-8-en-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylpropan-1- amine, AKG-KC3-C17(C8:1)(O-12620) N (S) Procedure previously described synthesis of AKG-KC2-01 3-((S)-2,2-di((Z)-heptadec-8-en-1-yl)-1,3-dioxolan-4-yl)-N, N-dimethylpropan-1-amine, (AKG- KC3-C17 (C8:1), O-12620), (290 mg, 0.46 mmol, 40%) a clear oil. MS (APCI+) for C42H81NO2: 632.61H NMR (300 MHz, CDCl3): δ ppm 5.38-5.28 (m, 4H), 4.09-3.99 (m, 2H), 3.48-3.41 (m, 1H), 2.77-2.71 (m, 1H), 2.55 (s, 6H), 2.01-1.95 (m, 8H), 1.88-1.78 (m, 2H), 1.62-1.50 (m, 6H), 1.27- 1.24 (m, 44H), 0.88 (t, J = 6.8 Hz, 6H). 125 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 Synthesis of (S)-3-(2,2-diheptadecyl-1,3-dioxolan-4-yl)-N,N-dimethylpropan-1-amine, AKG-KC3-C17 (O-12637) N (S) O Procedure (S)-3-(2,2-diheptadecyl-1,3-dioxolan-4-yl)-N, N-dimethylpropan-1-amine, (AKG-KC3-C17, O- 12637), (275 mg, 0.43 mmol, 22%) as a solid. MS (APCI+) for C42H85NO2: 636.61H NMR (300 MHz, CDCl3): δ ppm 4.06-4.00 (m, 2H), 3.47-3.43 (m, 1H), 2.29-2.25 (m, 2H), (s, 6H), 1.60-1.48 (m, 8H), 1.29-1.24 (m, 60H), 0.87 (t, J = 6.6 Hz, 6H). Example 2. Preparation of lipidic nanoparticles (LNPs). mRNA modified with 5-methoxyuridine (5moU) and coding for mCherry (Cat#L-7203) was obtained from Trilink Biotechnologies (San Diego, CA). All uridine nucleosides were substituted with N1-methyl-pseudouridine. To produce the mRNA, a synthetic gene encoding the mRNA sequence was cloned into a DNA plasmid. The synthetic gene was comprised of an RNA promoter, a 5’ untranslated region, mCherry protein coding sequence, a 3’ untranslated region, and a poly(A) tail region of approximately 120 As. The open reading frame sequence for the mCherry mRNA from TriLink (Cat#L-7203) corresponds to SEQ ID NO: 227: AUGGUGAGCAAGGGCGAGGAGGACAACAUGGCCAUCAUCAAGGAGUUCAUGCGG UUCAAGGUGCACAUGGAGGGCAGCGUGAACGGCCACGAGUUCGAGAUCGAGGGC GAGGGCGAGGGCCGGCCCUACGAGGGCACCCAGACCGCCAAGCUGAAGGUGACCA AGGGCGGCCCCCUGCCCUUCGCCUGGGACAUCCUGAGCCCCCAGUUCAUGUACGG CAGCAAGGCCUACGUGAAGCACCCCGCCGACAUCCCCGACUACCUGAAGCUGAGC UUCCCCGAGGGCUUCAAGUGGGAGCGGGUGAUGAACUUCGAGGACGGCGGCGUG GUGACCGUGACCCAGGACAGCAGCCUGCAGGACGGCGAGUUCAUCUACAAGGUGA AGCUGCGGGGCACCAACUUCCCCAGCGACGGCCCCGUGAUGCAGAAGAAGACCAU GGGCUGGGAGGCCAGCAGCGAGCGGAUGUACCCCGAGGACGGCGCCCUGAAGGGC GAGAUCAAGCAGCGGCUGAAGCUGAAGGACGGCGGCCACUACGACGCCGAGGUGA AGACCACCUACAAGGCCAAGAAGCCCGUGCAGCUGCCCGGCGCCUACAACGUGAA 126 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 CAUCAAGCUGGACAUCACCAGCCACAACGAGGACUACACCAUCGUGGAGCAGUAC GAGCGGGCCGAGGGCCGGCACAGCACCGGCGGCAUGGACGAGCUGUACAAGAGCG GCAACUGA Stock solutions of each lipid were prepared. Ionizable lipids were weighed out in 4 mL glass vials (Thermo B7999-2) and dissolved in ethanol (Sigma-Aldrich 200 proof, RNase free) to a final concentration of 10 mM. Other lipids such as DSPC, DPPC-NH4, Cholesterol and PEG- DMG were weighed out and dissolved in ethanol to a concentration of 1 mM. DSPS-Na was dissolved in methanol (Sulpelco, Omnisolve) at a concentration of 1 mM and briefly heated to 70 °C to complete its dissolution. Lipid mixtures for each individual LNP were prepared by adding the desired volume of each lipid stock solution to a new vial, adding ethanol if needed to achieve a final volume of 1.2 mL. For example, an LNP formulation of AKG-UO-1 / DSPC / DSPS / Chol / PEG-DMG (50 / 2.5 / 7.5 / 38.5 / 1.5 mol%), with an N / P of 5 contained 1500 nmol AKG-UO-1, 75 nmol DSPC, 225 nmol DSPS, 1155 nmol Chol and 45 nmol PEG-DMG for every 100 μg of mRNA used. mRNA solutions were prepared by thawing frozen mRNA (mCherry mRNA, Trilink) vials and diluting mRNA in 6.25 mM sodium acetate (pH 5.0) to a final concentration of 0.033 mg / mL. To prepare LNPs, a NanoAssemblr Benchtop microfluidic device (from Precision Nanosystems) was used. If LNPs contained the sodium or ammonium salts of DSPS, or sodium salt of DPPS the heating block accessory set to 70 °C was used, otherwise LNPs were mixed at room temperature. 3 mL of mRNA solution was loaded into a 3 mL disposable syringe (BD 309656) and 1 ml of lipid mixture in a 1 ml syringe (BD309659) and placed in the NanoAssemblr heating block for 4 min prior to mixing. LNP formation was achieved by pumping the liquid streams through a disposable microfluidics cassette at 3:1 aqueous: alcohol volume ratio at 6 mL / min mixing speed. After mixing, 3.6 mL of LNP mixture was collected, while the initial mixed volume of 0.35 mL and last 0.05 mL of mix was discarded. Ethanol was removed by buffer exchange using SpectraPor dialysis tubing (12-14k MWCO) in PBS (Cytivia, SH30256.01) or by sequential concentration and dilution using Amicon Ultra-4 centrifugal concentrators (10k MWCO, at 500 g). LNPs were typically exchanged into PBS, pH 7.4 and then 15 mM Tris, pH 7.4, 20% sucrose, concentrated to 20-50 ug / mL mRNA using an Amicon-Ultra 4 (100,000 MWCO) spin column, sterile filtered (Thermo Nalgene 0.2 um #720-1320) prior to freezing by immersion in liquid nitrogen for 5 min and long-term storage at – 80 °C. 127 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 Example 3. LNP Characterization A. mRNA concentration and relative encapsulation efficiency determination by fluorescent binding dye Materials: Ribogreen reagent (Thermo #11491), 3 x 96-well plates with lids, PBS, dissociation buffer (PBS with 10% DMSO and 1% (wt / wt) Zwittergent 3-14 (Sigma-Aldrich #693017), mRNA, general pipette tips & repeater pipette tips. 1. 5 mL of 2 μg / mL mRNA stock were prepared in DPBS or PBS 2. Diluted standards were prepared as follows in single wells in a 96-well plate (Plate A); Final [mRNA] ng / mL Vol. stock 2 µg / mL (µL) Vol. PBS (µL) 2 4 3. Using different wells in Plate A, sample mRNA concentration was estimated and were diluted to be within the standard curve. For example, if the approximate mRNA concentration should be ~ 30 ug / mL in the sample, a 20X dilution was performed (Dilution Factor). (20 uL sample added to 380 µL PBS in a well). No lid was used on plate A. Samples were mixed by gentle pipetting up & down. Example of Plate A A 0 500 1000 1500 2000 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 4. Two more plates, plates B & C were used. Using a multichannel pipettor, 60 µL of each standard 2 were pipetted into wells each (duplicate), and sample into 3 wells each (triplicate) Example of Plate B and C A 0 500 1000 1500 2000 B 0 500 1000 1500 2000 5. e number o we s used on eac p ate was counted and was added to t s number. For plate B, PBS was prepared with Ribogreen diluted 1:100. For example, for 40 wells, 44 was used as the number.44 X 60 µL = 2.64 mL Ribogreen solution needed, so that would be 2.61 mL PBS with 26.4 µL Ribogreen. 6. For plate C, 2.61 mL Dissociation buffer and 26.4 uL Ribogreen was pipetted. 7. Using a repeater pipette set for 60 µL, PBS+RiboGreen was added to each well on plate B and 60 µL Dissociation Buffer+Ribogreen to plate C. Both plates B and C were mixed on an orbital mixer (120 rpm) for 1 min. Plate B was placed in the dark for 15 min. Plate C was incubated at 37 °C in the dark for 10 min, followed by 5 min at RT. 8. Both plates were read one after the other, using Ex.465, Em.530nm 9. Using the standard curve, the slope and intercept were calculated and by extrapolation the mRNA concentrations of the samples on plate B & C were calculated (average and std.dev) 10. Percent encapsulation efficiency (% EE) by [mRNA] plate B / [mRNA] plate C X 100 was calculated 11. Total [mRNA] by taking [mRNA] plate C X dilution factor was calculated. B. LNP Particle size 129 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 1. 30 µL of LNP was mixed with 1.5 mL PBS in a polystyrene cuvette (Sarstedt, #67.754) and analyzed for size using a ZetaSizer Pro (Malvern) using ZS Xplorer software, version number 1.4.0.105. The Z-average size and polydispersity index value were recorded. Typically, size measurements of LNPs were taken post LNP mixing, post buffer exchange and post sterile filtering. C. LNP Zeta Potential 1. 30 µL of LNP was mixed with 1.5 mL PBS and injected into a disposable folded capillary cell (Malvern Nanoseries DTS1070) and zeta potential measured on a ZetaSizer Pro at 25 °C. Example 4. Determination of transfection efficiency in murine dendritic cells of LNPs using mCherry mRNA. A. Cell Propagation, Transfection, Harvesting and Staining Protocol 1. MutuDC1940 cells (Applied Biological Materials, T0528) were grown according to supplier’s instructions in T75 flasks. They were plated at 180,000 cells / well into 24-well plate one day prior to transfection. 2. LNPs were added in triplicate to each well at the desired mRNA concentration (e.g.1 µg / mL) in 1 mL media and after 24h the cells were washed once with DPBS (VWR 02- 0119-1000). 3. 0.2 mL of DPBS (plus 5 mM EDTA, pH 7.4) was then added to facilitate detachment. 4. The cells were placed at 37 °C for 3 min, until detached. 5. 0.5 ml DPBS added to each well and the liquid transferred to a flow cytometry tube (Falcon 5 mL #352054). 6. The tube was centrifuged at 1100 rpm for 3-5 min and the liquid poured off. 7. 100 µL of Zombie Violet (Biolegend) (diluted 1:500 in PBS) was added to each tube. 8. The tubes were gently tapped to resuspend cells and placed in the dark for 15 min at RT. 9. To the cells 0.5 mL of (paraformaldehyde 4% in PBS:DPBS 1:1) was added and the cells flicked gently to resuspend and put on ice for 30 min. Another 2 ml PBS was added. 10. The cells were pelleted as above and resuspended in 0.5 mL DPBS with 5% BSA and placed in the fridge until needed. 130 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 B. Cell Analysis Cells suspensions were analyzed by an Attune NxT flow cytometer using the VL1 and YL2 for live / dead and mCherry fluorescence signals respectively. Gating analysis was performed on FloJo software. Example 5. Impact of DSPS on transfection efficiency of dendritic cells using LNPs with KC2 as ionizable cationic lipid. The aim of this study was to explore the effect of phosphatidylserine targeting using DSPS on transfection efficiency in murine dendritic cells. LNPs were prepared as described in Example 9, characterized for particle size and zeta potential as described in Example 4, and evaluated for transfection efficiency in murine dendritic cells as described in Example 5. The LNPs all had DLin-KC2-DMA constant at an N / P ratio of 5 and 50 mol % of total lipid, the PS lipid was varied initially from 0 - 2.5 mol % and the DSPC phospholipid varied from 0 - 7.5 mol % (Total mol % of DSPC and DSPS was constant at 10 mol %), and the cholesterol constant at 38.5 mol % (all mol % of total lipid). The particle size, Polydispersity Index (PDI), and entrapment efficiency for all formulations is shown below in Tables 4 and 5. Table 4. Physicochemical properties of KC2-containing LNPs used in Example 6 varying from 0-2.5 mol % used in Example 6 and FIG.1A. Mol % DSPS Particle Size (nm) PDI % Encapsulation ± SD 4 2 Table 5. Physicochemical properties of KC2-containing LNPs varying from 0-7.5 mol % used in Example 6 and FIG.1B, FIG.1C, and FIG.1D. Mol % DSPS Particle Size (nm) PDI % Encapsulation ± SD 131 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 An initial set of LNPs containing DLin-KC2-DMA and varying phosphatidylserine in the form of DSPS from 0-2.5 mol %, showed little transfection at 0 or 0.5 mol % DSPS, but increase by 18-fold when DSPS was incorporated at 2.5 mol % (FIG. 1A). A second series of LNPs prepared with DSPS from 0-7.5 mol % was evaluated at 0.1, 0.3, and 1 µg / mL mRNA concentrations (FIG. 1B, FIG. 1C and FIG. 1D). The transfection efficiency increased as the mol % of DSPS was increased above 2.5 mol %, with a maximum at 7.5 mol % at 1 µg / mL mRNA, and 5 mol % at both 0.1 and 0.3 µg / mL mRNA. These data demonstrate that the inclusion of phosphatidyl-L-serine can dramatically increase the transfection efficiency of mRNA-containing LNPs, and that maximal uptake occurs between 5-7.5 mol % of DSPS (as % of total lipid). Example 6. Impact of ICL and anionic phospholipid targeting ligand on mRNA transfection of dendritic cells. The aim of this study was to see if other anionic phospholipids could also enhance the transfection efficiency of LNPs and how LNPs prepared with varying ICLs and PS targeting would transfect dendritic cells. LNPs were prepared as described in Example 2, characterized for particle size and zeta potential as described in Example 3, and evaluated for transfection efficiency in murine dendritic cells as described in Example 4. The LNPs had various ICLs (DLin-KC2-DMA, KC2-OA, KC3-OA, or SM-102) constant at an N / P ratio of 5 and 50 mol % of total lipid, the PS lipid was kept constant at 5 mol % and the DSPC at 5 mol %, and the cholesterol constant at 38.5 mol % (all mol % of total lipid). The particle size, PDI, and entrapment efficiency for all formulations is shown below in Table 6. Table 6. Physicochemical properties of LNPs varying in ICL used and with anionic phospholipid at 5 mol %. Ionizable Cationic Anionic lipid Particle Size PDI % Encapsulation 132 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 The transfection results are shown in FIG. 2 show high transfection rates with three different KC-series ICLs (KC2, KC2-OA, and KC3-OA), and also with LNPs prepared with the branched ICL, SM-102. The encapsulation efficiency was high and the particle size below 100 nm for all formulations, including those prepared with alternate anionic phospholipids (Suc-DSPE or Glu-DSPE). The data demonstrate that DSPS (L-serine) can not be substituted with either N- glutaryl-distearoylphosphatidylethanolamine (Glu-DSPE) or N-succinyl- distearoylphosphatidylethanolamine (Suc-DSPE) and provide the same high level of mRNA transfection despite both phospholipids also containing two negative charges and both containing the same distearoyl (C18:0) fully saturated acyl chains. These studies also clearly show that the addition of DSPS can give rise to high transfection efficiencies for other ionizable cationic lipids, including those with a single unsaturated acyl gain (KC2-OA or KC3-OA) and those including a branched ICL, like SM-102. The addition of DSPS to SM-102 containing LNPs gave rise to a 22- fold increase in mCherry expression, for example. Example 7. Dependence of PS targeting on ICL and PS structure. The aim of this study was to compare PS-targeted LNPs with KC2 and KC3 series ionizable cationic lipids of varying acyl chain composition. KC2 series lipids having a structure of dimethylaminoethyl headgroup structure were compared to the KC3 series containing a dimethylaminopropyl-derivatized head group. The LNPs contained various ICLs (KC2, KC2-01, KC2-OA, KC2-PA, KC3-OA, and KC3-01) as the ICL at an N / P ratio of 5 and 50 mol % ICL, and a constant 1.5 mol % PEG-DMG. The cholesterol content was held constant at 38.5 mol % and the DSPC content varied inversely with the mol % of DSPS at either 0 or 5 mol % (all lipid concentrations were used as mol % of total lipid). Transfection efficiency was evaluated in murine dendritic cells as described in Example 4. Table 7. Physicochemical properties of LNPs varying in ICL used and with anionic phospholipid at 5 mol %. Ionizable Cationic PS content Particle Size PDI % Encapsulation 133 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 KC2-OA 5 % DSPS 85.9 0.10 92.4 ± 4.5 KC2-PA None / 10 % DPPC 92.3 0.11 92.4 ± 4.4 . PS targeting on multiple KC-series ICLs. Here, the data show that ICLs containing both unsaturated C16 and C18 ICLs could be targeted with phosphatidyl-L-serine and give rise to high transfection rates for dendritic cells. The highest rate of transfection came when the PS and PC contained a mismatched acylchain composition, with 5 mol % DPPC and 5 mol % DSPS, and combined with a C16 ICL (KC2-PA). Example 8. Impact of PEG on transfection efficiency of AKG-UO-1 containing LNPs. The aim of this study was to explore the impact of PEG-lipid density on transfection efficiency of nontargeted and phosphatidyl-L-serine targeted LNPs. LNPs were prepared as described in Example 2. The LNPs contained AKG-UO-1 as the ICL at an N / P ratio of 5 with either 0 or 5 mol % DSPS and between 0.5-4.5 mol % PEG-DMG. The cholesterol content was held constant at 38.5 mol % and the DSPC content was 10 mol % for the formulations with no DSPS and 5 mol % for those with 5 mol % DSPS. At PEG-DMG content above 1.5 mol%, the total cholesterol content was reduced by the amount of PEG-DMG added, for example with a PEG- DMG content of 3.5 mol%, the cholesterol content was reduced to 36.5 mol% from 38.5 mol%. The particles with 0.5 % PEG-DMG showed a negative zeta potential at pH 7.4, and a significant shift to a positive zeta potential at pH 5. The LNPs with 1.5-3.5 mol % PEG-DMG were essentially neutral at pH 7. Table 8. Physicochemical properties of LNPs used in Example 8 and containing AKG-UO-1, 0 or 5 mol% DSPS % DSPS % PEG-DMG Particle Size (nm) Zeta Potential at Zeta Potential at ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 0 3.5 81.0 -0.30 6.34 0 4.5 143 -1.47 14.51 Ps containing the AKG-UO-1 ICL is shown in FIG. 4. The formulation with 0.5 % PEG-DMG showed a transfection efficiency in the presence of 5 % DSPS that was between 6-7 fold higher than observed at 1.5-2.5 % PEG-DMG. Transfection at 1.5 and 2.5 % PEG-DMG was similar, but decreased dramatically at 3.5 and 4.5 mol % PEG-DMG. The ratio of targeted to nontargeted transfection at each PEG-density varied, and was 12-fold at 0.5 % PEG, 7-fold at 1.5 % PEG, 37- fold at 2.5 % PEG, and below 5-fold at 3.5 and 4.5 % PEG, likely because of high PEG-shielding of the PS targeting moiety. The combination of these data show that the optimum range of PEG- densities is between 0.5-2.5 % PEG-DMG, with the lower end of the range being optimum for overall transfection efficiency, while the 2.5 % being optimal for target specificity. Example 9. Impact of N / P ratio on transfection efficiency of mCherry mRNA containing LNPs. The aim of this study was to explore the effect of different N / P ratios on transfection efficiency in dendritic cells. LNPs were prepared as described in Example 2, characterized for particle size and zeta potential as described in Example 3, and evaluated for transfection efficiency in murine dendritic cells as described in Example 4. The LNPs all used KC2-01 as the ICL but varied the cationic lipid-to-mRNA phosphate (N / P) ratio from 4-7, the PS lipid was constant at 5 mol % and the DSPC phospholipid constant at 5 mol %, and the cholesterol constant at 38.5 mol %. The entrapment efficiency for all formulations was between 84 and 90 %, indicating high efficiency mRNA entrapment in the LNP. Transfection efficiency was evaluated in murine dendritic cells as described in Example 4. Table 9. Physicochemical properties of LNPs used in Example 9 % DSPS N / P Particle Size (nm) Zeta Potential at Zeta Potential at ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 0 5 84.9 -6.9 20.9 0 6 81.1 -7.0 21.6 NP formulations at both 1 ug / ml (FIG.5A) and 0.33 ug / ml (FIG.5B). These data show high DSPS- mediated transfection efficiency for KC2-01 containing LNPs over a broad range of N / P ratios with the greatest transfection efficiency being observed at an N / P of 7. Example 10. Measuring the effect of adding 10 and 25 mol% DOPS on LNP particle formation and activity in MutuDC1940 dendritic cell line. The aim of this study was to explore the impact of including DOPS into mRNA LNP formulations at compositions at or below the mol % previously shown in the literature (Gaitonde et al. (2011) Clin Immunol 138, 135-145; Rodriquez-Fernandez (2018) Front Immunol 9, 253) to enhance liposome (with) uptake into dendritic cells. LNPs were prepared as described in Example 2 at 25 °C and analyzed as in Example 3. The LNPs contained KC2 as the ICL at an N / P ratio of 5 with between 0, 10 and 25 mol % DOPS and a constant 1.5 mol % PEG-DMG. The cholesterol content was held constant at 38.5 mol % for the 0% and 10% DOPS formulations and the DSPC content varied inversely with the mol % of DOPS between 0-10 mol % (all lipid concentrations were used as mol % of total lipid). In the 25 mol % DOPS formulation, there was no DSPC and the cholesterol content decreased in the total by 15 mol % (from 38.5 to 23.5 mol %). Transfection efficiency was evaluated in murine dendritic cells as described in Example 4. Table 10. Physicochemical properties of DOPS containing LNP formulations LNP Formulation Particle Size (nm) PDI Encapsulation 136 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 KC2 / DSPC / DOPS / Chol / PEG- 80.8 0.163 90.9 ± 3.5 DMG (50 / 0 / 10 / 38.5 / 1.5) ted in FIG.6. This study shows that including 10 mol% DOPS in a KC2-based LNP formulation had a positive effect on mCherry expression levels in MutuDC1940 cells, while not adversely affecting either particle size or encapsulation of mRNA. However, when the DOPS content was increased to 25 mol% the expression of mCherry was lower than the formulation that had no DOPS and the size distribution widened as demonstrated by an increase in the PDI and gave rise to a distribution that contained particles > 400 nm. Taken together, 25 mol% may have been shown in the literature to enhance liposome uptake into dendritic cells, while in an LNP formulation with mRNA it had a deleterious effect on both particle size and transfection activity. Importantly, the DOPS used here and in the literature contained unsaturated acyl chains, in this case oleic acid. This is similar to what is typical in many cells, where the phosphatidylserine acyl chains are often unsaturated in the sn-2 position, in many instances with multiple olefins (2-4). Although there is a small enhancement with a lower concentration of DOPS, this enhancement was shown to be significantly higher when the PS was comprised of saturated acyl chains, most preferably dipalmitoyl (C16) or distearoyl (C18). Example 11. Impact of pegylation and phosphatidylserine targeting on immunogenicity of SARS-CoV-2 spike protein mRNA vaccine constructs. Mice and study design. The in vivo study was carried out. Female BALB / c mice were purchased from Jackson Labs, allowed to acclimate in the vivarium for at least 7 days, and were 6-8 weeks at the start of the study. On study day 0 mice were injected intramuscularly in the right quadricep with 1 ug of vaccine candidate (quantity refers to mRNA) in a volume of 50 µL. Study groups consisted of 5 mice and included vehicle control, comparator vaccines, and experimental vaccine candidates. Mice were given a second injection of the same vaccine candidate 21 days later. Blood was collected and serum was isolated from 5 randomly selected control mice at the start of the study and from all mice on study day 21 and 34. Serum was stored at -80°C until analysis for antibody titers. On study day 34, mice were euthanized and spleens were harvested. 137 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 Design and preparation of mRNA. mRNA encoding the SARS-CoV-2 full length spike protein and flanked with the same UTRs used in the BNT162b2 (Comirnaty) vaccine was purchased from Vernal Biosciences. All uridine nucleosides were substituted with N1-methyl- pseudouridine. To produce the mRNA, a synthetic gene encoding the mRNA sequence (VRN029; SEQ ID NO: 211) was cloned into a DNA plasmid: GGGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGCCACCATGTTCGTGT TCCTGGTGCTGCTGCCTCTGGTGTCCAGCCAGTGTGTGAACCTGACCACCAGAACACAGCTGCC TCCAGCCTACACCAACAGCTTTACCAGAGGCGTGTACTACCCCGACAAGGTGTTCAGATCCAGC GTGCTGCACTCTACCCAGGACCTGTTCCTGCCTTTCTTCAGCAACGTGACCTGGTTCCACGCCA TCCACGTGTCCGGCACCAATGGCACCAAGAGATTCGACAACCCCGTGCTGCCCTTCAACGACGG GGTGTACTTTGCCAGCACCGAGAAGTCCAACATCATCAGAGGCTGGATCTTCGGCACCACACTG GACAGCAAGACCCAGAGCCTGCTGATCGTGAACAACGCCACCAACGTGGTCATCAAAGTGTGCG AGTTCCAGTTCTGCAACGACCCCTTCCTGGGCGTCTACTACCACAAGAACAACAAGAGCTGGAT GGAAAGCGAGTTCCGGGTGTACAGCAGCGCCAACAACTGCACCTTCGAGTACGTGTCCCAGCCT TTCCTGATGGACCTGGAAGGCAAGCAGGGCAACTTCAAGAACCTGCGCGAGTTCGTGTTTAAGA ACATCGACGGCTACTTCAAGATCTACAGCAAGCACACCCCTATCAACCTCGTGCGGGATCTGCC TCAGGGCTTCTCTGCTCTGGAACCCCTGGTGGATCTGCCCATCGGCATCAACATCACCCGGTTT CAGACACTGCTGGCCCTGCACAGAAGCTACCTGACACCTGGCGATAGCAGCAGCGGATGGACAG CTGGTGCCGCCGCTTACTATGTGGGCTACCTGCAGCCTAGAACCTTCCTGCTGAAGTACAACGA GAACGGCACCATCACCGACGCCGTGGATTGTGCTCTGGATCCTCTGAGCGAGACAAAGTGCACC CTGAAGTCCTTCACCGTGGAAAAGGGCATCTACCAGACCAGCAACTTCCGGGTGCAGCCCACCG AATCCATCGTGCGGTTCCCCAATATCACCAATCTGTGCCCCTTCGGCGAGGTGTTCAATGCCAC CAGATTCGCCTCTGTGTACGCCTGGAACCGGAAGCGGATCAGCAATTGCGTGGCCGACTACTCC GTGCTGTACAACTCCGCCAGCTTCAGCACCTTCAAGTGCTACGGCGTGTCCCCTACCAAGCTGA ACGACCTGTGCTTCACAAACGTGTACGCCGACAGCTTCGTGATCCGGGGAGATGAAGTGCGGCA GATTGCCCCTGGACAGACAGGCAAGATCGCCGACTACAACTACAAGCTGCCCGACGACTTCACC GGCTGTGTGATTGCCTGGAACAGCAACAACCTGGACTCCAAAGTCGGCGGCAACTACAATTACC TGTACCGGCTGTTCCGGAAGTCCAATCTGAAGCCCTTCGAGCGGGACATCTCCACCGAGATCTA TCAGGCCGGCAGCACCCCTTGTAACGGCGTGGAAGGCTTCAACTGCTACTTCCCACTGCAGTCC TACGGCTTTCAGCCCACAAATGGCGTGGGCTATCAGCCCTACAGAGTGGTGGTGCTGAGCTTCG AACTGCTGCATGCCCCTGCCACAGTGTGCGGCCCTAAGAAAAGCACCAATCTCGTGAAGAACAA ATGCGTGAACTTCAACTTCAACGGCCTGACCGGCACCGGCGTGCTGACAGAGAGCAACAAGAAG TTCCTGCCATTCCAGCAGTTTGGCCGGGATATCGCCGATACCACAGACGCCGTTAGAGATCCCC AGACACTGGAAATCCTGGACATCACCCCTTGCAGCTTCGGCGGAGTGTCTGTGATCACCCCTGG CACCAACACCAGCAATCAGGTGGCAGTGCTGTACCAGGACGTGAACTGTACCGAAGTGCCCGTG GCCATTCACGCCGATCAGCTGACACCTACATGGCGGGTGTACTCCACCGGCAGCAATGTGTTTC AGACCAGAGCCGGCTGTCTGATCGGAGCCGAGCACGTGAACAATAGCTACGAGTGCGACATCCC CATCGGCGCTGGAATCTGCGCCAGCTACCAGACACAGACAAACAGCCCTCGGAGAGCCAGAAGC GTGGCCAGCCAGAGCATCATTGCCTACACAATGTCTCTGGGCGCCGAGAACAGCGTGGCCTACT CCAACAACTCTATCGCTATCCCCACCAACTTCACCATCAGCGTGACCACAGAGATCCTGCCTGT GTCCATGACCAAGACCAGCGTGGACTGCACCATGTACATCTGCGGCGATTCCACCGAGTGCTCC AACCTGCTGCTGCAGTACGGCAGCTTCTGCACCCAGCTGAATAGAGCCCTGACAGGGATCGCCG TGGAACAGGACAAGAACACCCAAGAGGTGTTCGCCCAAGTGAAGCAGATCTACAAGACCCCTCC TATCAAGGACTTCGGCGGCTTCAATTTCAGCCAGATTCTGCCCGATCCTAGCAAGCCCAGCAAG 138 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 CGGAGCTTCATCGAGGACCTGCTGTTCAACAAAGTGACACTGGCCGACGCCGGCTTCATCAAGC AGTATGGCGATTGTCTGGGCGACATTGCCGCCAGGGATCTGATTTGCGCCCAGAAGTTTAACGG ACTGACAGTGCTGCCTCCTCTGCTGACCGATGAGATGATCGCCCAGTACACATCTGCCCTGCTG GCCGGCACAATCACAAGCGGCTGGACATTTGGAGCAGGCGCCGCTCTGCAGATCCCCTTTGCTA TGCAGATGGCCTACCGGTTCAACGGCATCGGAGTGACCCAGAATGTGCTGTACGAGAACCAGAA GCTGATCGCCAACCAGTTCAACAGCGCCATCGGCAAGATCCAGGACAGCCTGAGCAGCACAGCA AGCGCCCTGGGAAAGCTGCAGGACGTGGTCAACCAGAATGCCCAGGCACTGAACACCCTGGTCA AGCAGCTGTCCTCCAACTTCGGCGCCATCAGCTCTGTGCTGAACGATATCCTGAGCAGACTGGA CCCTCCTGAGGCCGAGGTGCAGATCGACAGACTGATCACAGGCAGACTGCAGAGCCTCCAGACA TACGTGACCCAGCAGCTGATCAGAGCCGCCGAGATTAGAGCCTCTGCCAATCTGGCCGCCACCA AGATGTCTGAGTGTGTGCTGGGCCAGAGCAAGAGAGTGGACTTTTGCGGCAAGGGCTACCACCT GATGAGCTTCCCTCAGTCTGCCCCTCACGGCGTGGTGTTTCTGCACGTGACATATGTGCCCGCT CAAGAGAAGAATTTCACCACCGCTCCAGCCATCTGCCACGACGGCAAAGCCCACTTTCCTAGAG AAGGCGTGTTCGTGTCCAACGGCACCCATTGGTTCGTGACACAGCGGAACTTCTACGAGCCCCA GATCATCACCACCGACAACACCTTCGTGTCTGGCAACTGCGACGTCGTGATCGGCATTGTGAAC AATACCGTGTACGACCCTCTGCAGCCCGAGCTGGACAGCTTCAAAGAGGAACTGGACAAGTACT TTAAGAACCACACAAGCCCCGACGTGGACCTGGGCGATATCAGCGGAATCAATGCCAGCGTCGT GAACATCCAGAAAGAGATCGACCGGCTGAACGAGGTGGCCAAGAATCTGAACGAGAGCCTGATC GACCTGCAAGAACTGGGGAAGTACGAGCAGTACATCAAGTGGCCCTGGTACATCTGGCTGGGCT TTATCGCCGGACTGATTGCCATCGTGATGGTCACAATCATGCTGTGTTGCATGACCAGCTGCTG TAGCTGCCTGAAGGGCTGTTGTAGCTGTGGCAGCTGCTGCAAGTTCGACGAGGACGATTCTGAG CCCGTGCTGAAGGGCGTGAAACTGCACTACACATGATGACTCGAGCTGGTACTGCATGCACGCA ATGCTAGCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTAT GCTCCCACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCCCAAGCACGCAG CAATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTA GCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCAC ACCCTGGAGCTAGCAGCGGCCGCGGCCGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA The synthetic gene was comprised of an RNA promoter, a 5’ untranslated region, the SARS-COV2 Spike protein receptor binding domain, a 3’ untranslated region, and a poly(A) tail region of approximately 120 As. The plasmid was propagated and expanded in a culture of E. coli and then isolated from the clarified E. coli lysate via anion exchange chromatography. The purified plasmid was linearized using a type IIs restriction enzyme that cut at a site at the end of the poly(A) tail encoding region. That plasmid was then incubated in a buffer with nucleotide triphosphates, RNA polymerase, and RNase inhibitor. To stop the reaction, DNase I was added to digest the linear plasmid template. The uncapped RNA was then purified using chromatography and then incubated in another buffer with GTP, S-adenosylmethionine, a guanalyltransferase, 2’-O- methyltransferase, and RNase inhibitor. The capped mRNA was then purified using chromatography, buffer exchanged into water, and filled into vials. 139 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 Generation of lipid nanoparticles (LNP) containing mRNA. Stock solutions of each lipid were prepared. Ionizable lipids were weighed out in 4 mL glass vials (Thermo B7999-2) and dissolved in ethanol (Sigma-Aldrich 200 proof, RNase free) to a final concentration of 10 mM. Other lipids such as DSPC (Avanti Polar Lipids), Cholesterol (Dishman) and PEG-DMG (NOF) were weighed out and dissolved in ethanol to a concentration of 1 mM. DSPS-Na (NOF) was dissolved in methanol (Sulpelco, Omnisolve) at a concentration of 1 mM and briefly heated to 70 °C to complete its dissolution. Lipid mixtures for each individual LNP were prepared by adding the desired volume of each lipid stock solution to a new vial, adding ethanol if needed to achieve a final volume of 1.2 mL. For example, a LNP formulation of AKG-UO-1 / DSPC / DSPS / Chol / PEG-DMG (50 / 2.5 / 7.5 / 38.5 / 1.5 mol%), with an N / P of 5 contained 1500 nmol AKG-UO-1, 75 nmol DSPC, 225 nmol DSPS, 1155 nmol Chol and 45 nmol PEG-DMG for every 100 μg of mRNA used. mRNA solutions were prepared by thawing frozen mRNA (SARS-CoV-2 spike mRNA, Vernal) vials and diluting mRNA in 6.25 mM sodium acetate (pH 5.0) to a final concentration of 0.033 mg / mL, where the concentration is confirmed by absorbance on a Nanodrop. To prepare LNPs, a NanoAssemblr Benchtop microfluidic device (from Precision Nanosystems) was used. If LNPs contained DSPS, the heating block accessory set to 70 °C was used, otherwise LNPs were mixed at room temperature.3 mL of mRNA solution was loaded into a 3 mL disposable syringe (BD 309656) and 1 ml of lipid mixture in a 1 ml syringe (BD309659) and placed in the NanoAssemblr heating block for 4 min prior to mixing. LNP formation was achieved by pumping the liquid streams through a disposable microfluidics cassette at 3:1 aqueous: alcohol volume ratio at 6 mL / min mixing speed. After mixing, 3.6 mL of LNP mixture was collected, while the initial mixed volume of 0.35 mL and last 0.05 mL of mix was discarded. Ethanol was removed by buffer exchange using SpectraPor dialysis tubing (12-14k MWCO) in PBS (Cytivia, SH30256.01). LNPs were typically exchanged into PBS, pH 7.4 and then 15 mM Tris, pH 7.4, 20% sucrose, concentrated to 20-50 ug / mL mRNA, sterile filtered (Thermo Nalgene 0.2 um #720-1320) prior to freezing by immersion in liquid nitrogen for 5 min and long-term storage at –20°C. For this study, samples were concentrated to >40 µg / mL mRNA, and diluted with varying volumes of 15 mM Tris, 20% Sucrose, pH 7.4 to a target concentration of 40 µg mRNA and then frozen on LN2. Characterization of LNPs was undertaken after an aliquot of the LNPs were thawed and diluted 1:1 (vol:vol) with 15 mM Tris, pH 7.4 such that the final 140 ACTIVE 692381558v1 Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 concentration was 20 µg / mL mRNA in 15 mM Tris, 10% sucrose, pH 7.4. This simulated the conditions of sample preparation that were performed prior to dosing the animals with an injection of 1 µg mRNA in 50 µL volume via IM injection into a hind limb. LNP Characterization. mRNA encapsulation and mRNA concentration within the LNPs was measured using a Ribogreen assay. Nanoparticle size and zeta potential were measured by a zetasizer (Malvern). SARS-CoV-2 anti-spike antibody titers. A standard indirect ELISA was performed to analyze serum samples for total IgG binding antibodies to the SARS-CoV-2 spike protein. For this assay, Nunc MaxiSorp 96-well plates were coated with 100 µL of SARS-CoV-2 spike protein (Sino Biological, cat. no. 40589-V08B1) diluted to 2 µg / mL in 1x PBS, pH 7.4. Plates were incubated statically for 12 hrs at 37oC. Unbound coating antigen was removed by washing plates 3x with 100 µL PBS + 0.05% Tween-20. Plates were then blocked in PBS + 5% skim milk for 1 hr at 37oC. Test and positive control samples were diluted in assay diluent (PBS, Tween-20, 1% skim milk) to starting point dilution 1:20 followed by four-fold serial dilutions using U-bottom dilution plates. Once blocking was completed, blocking buffer was removed by inversion and each sample was plated in duplicates. Plates were statically incubated for 2 hr at 37oC, followed by washing 3x with 100 µL of PBS + 0.05% Tween-20 to remove unbound sera.100 µL of secondary detection antibody (goat anti-mouse-HRP IgG, Abcam) was added to each well at a dilution of 1:10,000. Plates were incubated statically for 30 min at RT, and unbound...

Claims

Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 CLAIMS 1. A lipid nanoparticle (LNP) composition consisting of: a. a messenger ribonucleic acid (mRNA) encoding one or more Mycobacterium tuberculosis (Mtb) proteins selected from the group consisting of CFP10 / Rv3874, ESAT-6 / Rv3875, Mtb32A / Rv0125, Mtb39A / Rv1196, Ag85B / Rv1886c, EsxW / Rv3620c, EsxV / Rv3619c, PE13 / Rv1195, PPE30 / Rv1802, PPE40 / Rv2356c and TB10.4 / Rv0288; b. an ionizable cationic lipid comprising a KC3 ionizable cationic lipid at a N / P ratio of 4 to 6 relative to the mRNA, the ionizable cationic lipid present in the LNP composition in a total amount of 46-54 mol% of a total lipid content of the LNP composition; c. one or more phospholipids selected from the group consisting of distearoylphosphatidylcholine (DSPC), hydrogenated soy phosphatidylcholine (HSPC), and dipalmitoylphosphatidylcholine (DPPC), in a total amount of 10-18 mol% of the total lipid content of the LNP composition; d. one or more anionic phospholipids selected from the group consisting of dipalmitoylphosphatidyl-L-serine (DPPS), or distearoylphosphatidyl-L-serine (DSPS), distearoylphosphatidylglycerol (DSPG), and dipalmitoyphosphatidylglycerol (DPPG) in a total amount of 2-8 mol% of the total lipid content of the LNP composition; e. PEG(2000)-dimyristoylglycerol (PEG-DMG) in a total amount of 1-3.5 mol% of the total lipid content of the LNP composition; and f. cholesterol.

2. A lipid nanoparticle (LNP) composition comprising: a. a nucleic acid comprising a nucleic acid sequence encoding a T cell epitope from Mycobacterium tuberculosis (Mtb), or a Mtb antigen recognized by T cells; b. an ionizable cationic lipid comprising a KC3 ionizable cationic lipid at a N / P ratio of 3 to 7 relative to the nucleic acid, the ionizable cationic lipid present in the LNP 277 ACTIVE 692381558v1Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 composition in a total amount of 46-54 mol% of a total lipid content of the LNP composition; c. one or more phospholipids in a total amount of 5-20 mol% of the total lipid content of the LNP composition; d. one or more anionic phospholipids in a total amount of 2-8 mol% of the total lipid content of the LNP composition; e. a conjugated lipid in a total amount of 1-3.5 mol% of the total lipid content of the LNP composition; and f. a sterol.

3. The composition of claim 2, wherein the one or more anionic phospholipids is a phosphatidylserine (PS) or phosphatidylglycerol (PG).

4. The composition of claim 3, wherein the one or more anionic phospholipids is selected from the group consisting of: dipalmitoylphosphatidyl-L-serine (DPPS), or distearoylphosphatidyl-L-serine (DSPS), distearoylphosphatidylglycerol (DSPG), and dipalmitoyphosphatidylglycerol (DPPG).

5. The composition of claim 2, wherein the one or more phospholipids comprises distearoylphosphatidylcholine (DSPC), hydrogenated soy phosphatidylcholine (HSPC), dipalmitoylphosphatidylcholine (DPPC) or a combination thereof.

6. The composition of claim 5, wherein the conjugated lipid is PEG(2000)- dimyristoylglycerol (PEG-DMG).

7. The composition of claim 6, wherein the sterol is cholesterol.

8. The composition of claim 7, wherein the ionizable cationic lipid comprises 3-((S)-2,2- di((Z)-octadec-9-en-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylpropan-1-amine (KC3-OA). 278 ACTIVE 692381558v1Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 9. The composition of claim 8, wherein the ionizable cationic lipid further comprises a KC4 ionizable cationic lipid.

10. The composition of claim 9, wherein the ionizable cationic lipid is 4-rac-2,2-di((Z)- octadec-9-en-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylbutan-1-amine (AKG-KC4-OA).

11. The composition of claim 7, wherein the composition consists of: a. 48 mol% KC3-OA; b. 5 mol% DPPS or DSPG; c. 5-10 mol% DSPC or HSPC; d. 1.5 mol% PEG-DMG; and e. 35.5-40.5 mol% cholesterol.

12. The composition of any one of claims 2-11, wherein the nucleic acid sequence is mRNA encoding a concatenated sequence of T-cell epitopes present in Mtb or a Mtb antigen recognized by T Cells.

13. The composition of claim 12, wherein the mRNA encodes one or more Mtb proteins selected from the group consisting of CFP10 / Rv3874, ESAT-6 / Rv3875, Mtb32A / Rv0125, Mtb39A / Rv1196, and Ag85B / Rv1886c.

14. The composition of claim 12, wherein the mRNA comprises one or more nucleic acid sequences selected from the group consisting of: SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, and SEQ ID NO:

220.

15. The composition of claim 12, wherein the mRNA encodes one or more Mtb proteins selected from the group consisting of EsxW / Rv3620c, EsxV / Rv3619c, PE13 / Rv1195, PPE30 / Rv1802, PPE40 / Rv2356c and TB10.4 / Rv0288. 279 ACTIVE 692381558v1Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 16. The composition of claim 12, wherein the mRNA comprises one or more nucleic acid sequences selected from the group consisting of: SEQ ID NO: 1, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 31, SEQ ID NO: 221, and SEQ ID NO:

222.

17. The composition of any one of claims 2-11, wherein the nucleic acid sequence encodes a concatenated sequence, wherein the concatenated nucleic acid-encoded sequence includes an N-terminal and C-terminal signal peptide selected from Sec / MITD, Lamp1, HLA-Drα, or tPA.

18. The composition of any one of claims 2-11, wherein the nucleic acid comprises a chemically modified mRNA, wherein the chemically modified mRNA comprises N1- methylpseudouridine.

19. The composition of any one of claims 2-11, wherein nucleic acid comprises a 5’ untranslated region (UTR) and 3’ UTR, polyA tail of about 80 to about 140 nucleotides in length, and (i) a 5’ enzymatic or (ii) a 5’ clean cap.

20. The composition of any one of claims 2-11, wherein the nucleic acid is an mRNA having a sequence selected from SEQ ID NOs: 34, 36, 38, 40, 42, 44, 224 and 226.

21. The composition of claim 20, wherein the nucleic acid comprises a chemically modified mRNA, wherein the chemically modified mRNA comprises N1-methylpseudouridine.

22. The composition of any one of claims 2-11, wherein the nucleic acid is an mRNA encoding an amino acid sequence selected from SEQ ID NOs: 33, 35, 37, 39, 41, 43, 86-105, 207- 210, 223 and 225.

23. The composition of any one of claims 2-11, wherein the nucleic acid sequence encodes a concatenated sequence, wherein the nucleic acid-encoded concatenated sequence comprises two or more MHC class I epitopes selected from SEQ ID NOs: 106-137 and 138-203. 280 ACTIVE 692381558v1Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 24. The composition of any one of claims 2-11, wherein the nucleic acid sequence encodes a concatenated sequence, wherein the nucleic acid-encoded concatenated sequence includes two or more MHC class I epitopes found in mycobacterium tuberculosis, depleted of epitopes found in BCG, and selected from SEQ ID NOs: 86-95.

25. The composition of any one of claims 2-11, wherein the nucleic acid sequence encodes a concatenated sequence, wherein the nucleic acid-encoded concatenated sequence includes two or more MHC class I epitopes that are ordered to minimize junctional neoepitope generation, and selected from SEQ ID NOs: 86-105.

26. The composition of any one of claims 2-7, wherein the ionizable cationic lipid is KC3-OA, KC3-PA, KC3-01, KC3-C17 (8:1), or KC3-C15 (C8:1).

27. A lipid nanoparticle (LNP) composition comprising: a. a nucleic acid comprising a nucleic acid sequence encoding a polypeptide that is a T cell epitope from Mycobacterium tuberculosis (Mtb), or a Mtb antigen recognized by T cells and having at least 90% sequence identity to a nucleic acid sequence disclosed herein; b. an ionizable cationic lipid comprising a KC3 ionizable cationic lipid at a N / P ratio of 3 to 7 relative to the nucleic acid, the ionizable cationic lipid present in the LNP composition in a total amount of 46-54 mol% of a total lipid content of the LNP composition; c. one or more phospholipids in a total amount of 5-20 mol% of the total lipid content of the LNP composition; d. one or more anionic phospholipids in a total amount of 2-8 mol% of the total lipid content of the LNP composition; e. a conjugated lipid in a total amount of 1-3.5 mol% of the total lipid content of the LNP composition; and f. a sterol. 281 ACTIVE 692381558v1Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 28. The composition of claim 27, wherein the nucleic acid is a messenger ribonucleic acid (mRNA) comprising a polynucleotide sequence encoding a polypeptide that is a T cell epitope from Mycobacterium tuberculosis (Mtb), or a Mtb antigen recognized by T cells, wherein the mRNA polynucleotide sequence has at least 90% identity to a polynucleotide sequence selected from the group consisting of: SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, and SEQ ID NO: 220, or has at least 90% identity to a polynucleotide sequence selected from the group consisting of: SEQ ID NO: 1, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 31, SEQ ID NO: 221, and SEQ ID NO:

222.

29. The composition of claim 1 or any one of claims 7-10, wherein the composition comprises cholesterol in a total amount of 35.5-42.7 mol% of total lipid in the LNP composition.

30. The composition of claim 1 or any one of claims 7-10, wherein the composition comprises 48 mol% of the KC3 ionizable cationic lipid, 40.5 mol% cholesterol, and 5 mol% (L- Serine) DPPS lipid, wherein each mol% refers to the mol% of the total lipid content of the LNP composition.

31. The composition of claim 1 or any one of claims 7-10, wherein the composition comprises 48 mol% of the KC3 ionizable cationic lipid, 38.5 mol% cholesterol, and 5 mol% (L- Serine) DPPS lipid, wherein each mol% refers to the mol% of the total lipid content of the LNP composition.

32. The composition of claim 1 or any one of claims 7-10, wherein the composition comprises 45 mol% of the KC3 ionizable cationic lipid, 42.7 mol% cholesterol, and 5 mol% (L- Serine) DPPS lipid, wherein each mol% refers to the mol% of the total lipid content of the LNP composition.

33. The composition of claim 1 or any one of claims 7-10, wherein the composition comprises 50 mol% of the KC3 ionizable cationic lipid, 38.5 mol% cholesterol, 5 mol% (L-Serine) DPPS lipid, and a total of 10 mol% phospholipid concentration, wherein each mol% refers to the mol% of the total lipid content of the LNP composition. 282 ACTIVE 692381558v1Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 34. The composition of claim 1 or any one of claims 7-10, wherein the composition comprises 48 mol% of the KC3 ionizable cationic lipid, 40.5 mol% cholesterol, 5 mol% (L-Serine) DPPS lipid, and a total of 10 mol% phospholipid concentration, wherein each mol% refers to the mol% of the total lipid content of the LNP composition.

35. The composition of claim 1 or any one of claims 7-10, wherein the composition comprises 48 mol% of the KC3 ionizable cationic lipid, 40.5 mol% cholesterol, 5 mol% (L-Serine) DPPS lipid, 5 mol% DSPC or DPPC; and a total of 10 mol% phospholipid concentration, wherein each mol% refers to the mol% of the total lipid content of the LNP composition.

36. The composition of claim 1 or any one of claims 7-10, wherein the composition comprises 46.5 mol% of the KC3 ionizable cationic lipid, 42 mol% cholesterol, 5 mol% (L-Serine) DPPS lipid, wherein each mol% refers to the mol% of the total lipid content of the LNP composition.

37. The composition of claim 1 or any one of claims 7-10, wherein the composition comprises 15 mol% total phospholipid and 35.5 mol% cholesterol.

38. The composition of claim 1 or any one of claims 7-10, wherein the composition comprises 10 mol% total phospholipid and 40.5 mol% cholesterol.

39. The composition of claim 1 or any one of claims 7-10, wherein the composition comprises 40.5 mol% cholesterol, 5% anionic lipid (DPPS) and 5% PC (DSPC or DPPC) and a total of 10 mol% phospholipid concentration.

40. The composition of claim 1 or any one of claims 7-10, wherein the composition comprises 48 mol% cationic ionizable lipid, 5 mol% PC (DPPC), 5 mol% anionic lipid (DPPS), 40.5 mol% cholesterol, 1.5 mol% conjugated lipid (PEG-DMG).

41. The composition of any one of claims 1-40, wherein the composition is a vaccine. 283 ACTIVE 692381558v1Attorney Docket No.191016-010702 / PCT Electronically Filed: December 22, 2023 42. A pharmaceutical composition comprising the LNP composition of any one of claims 1- 40, and a pharmaceutically acceptable carrier.

43. A method comprising administering to a subject in need thereof the composition of claim 41 or claim 42 in an amount effective to induce in the subject an immune response against mycobacterium tuberculosis infection. 284 ACTIVE 692381558v1