Genomic editing with site-specific retrotransposons

EP4698660A1Pending Publication Date: 2026-02-25MASSACHUSETTS INST OF TECH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
EP2024725680
Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-04-17
Filing Date
2024-04-16
Publication Date
2026-02-25

AI Technical Summary

Technical Problem

Current genome editing systems, such as CRISPR/Cas9, TALEN, and zinc finger proteins, are limited by size, cargo capacity, and targeting ability, particularly in achieving directed insertion of large nucleic acids into specific genomic loci without relying on endogenous cellular repair pathways.

Method used

A genome editing system utilizing a modified R2 element enzyme with a reverse transcriptase and nickase domain, combined with a payload RNA containing an insertion template and homology regions, allows for targeted insertion of large nucleic acids into specific genomic loci, including those other than the 28S rRNA locus, using a mechanism independent of endogenous cellular repair pathways.

Benefits of technology

Enables precise and efficient insertion of large nucleic acids into targeted genomic locations, overcoming the limitations of existing systems by providing enhanced targeting capability and cargo capacity, and functioning in post-mitotic cells independently of intrinsic nucleic acid repair systems.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000029_0001
    Figure IMGF000029_0001
  • Figure IMGF000029_0002
    Figure IMGF000029_0002
  • Figure IMGF000048_0001
    Figure IMGF000048_0001
Patent Text Reader

Abstract

Genome editing tools for use in systems designed to deliver large genetic elements are disclosed herein. A genome editing system is described, which includes i) an R2 element enzyme or other non-LTR site specific retrotransposon element and ii) a payload RNA, wherein the payload RNA comprises an insertion region and optionally one or more of a 5' homology region, a 3' homology region, and a protein binding element, wherein the insertion region comprises a template for a small or large nucleic acid insertion into the genome, and wherein the R2 element enzyme or other non-LTR site specific retrotransposon element comprises a targeting domain, a reverse transcriptase domain, and a nickase domain. Also disclosed are cells edited using such a genome editing system, methods for editing a genome, and compositions comprising cells edited with this genomic editing system.
Need to check novelty before this filing date? Find Prior Art

Description

GENOMIC EDITING WITH SITE-SPECIFIC RETROTRANSPOSONSRELATED APPLICATION

[0001] . This application claims the benefit of U.S. Patent Application Serial No.18 / 301,732, filed April 17, 2023, which is a continuation-in-part of U S Patent Application No. 18 / 047,685, filed October 19,2022, which claims the benefit of U.S. Provisional Patent Application Serial Nos. 63 / 262,714 and 63 / 371,246, respectively filed on October 19, 2021, and August 12, 2022, and the entire disclosure of each is incorporated herein by reference.STATEMENT AS TO FEDERALLY FUNDED RESEARCH

[0002] . This invention was made with Government support under Grant No. R21 AI149694 awarded by the National Institutes of Health (NIH) and under Grant No. R01 EB031957. The Government has certain rights in this invention.SEQUENCE LISTING

[0003] . The instant application contains a Sequence Listing which has been submitted electronically in XML file format and is hereby incorporated by reference in its entirety. Said XML copy, created on October 18, 2022, is named 733339_083474-024_SL.xml and is 66,696,250 bytes in size.BACKGROUND

[0004] . Genome editing systems have developed as a promising technology for the development of therapeutic tools. Systems such as CRISPR / Cas9, TALEN, and zinc finger proteins have been used to alter the genomes of organisms. However, these systems are limited by a number of factors, including size, cargo capacity, and targeting ability.

[0005] . Retrotransposons are mobile elements that insert themselves into the genome of a host through an RNA intermediate. This is in contrast to the mechanism of most DNA transposons, which directly insert themselves into a host genome. Retrotransposons are categorized as long terminal repeat (LTR) retrotransposons and non-LTR retrotransposons.1SUBSTITUTE SHEET (RULE 26)

[0006] . Non-LTR retrotransposons are among the most frequently occurring transposable elements in the eukaryotic genome. They can be either randomly inserting or sitespecific. Site-specific non-LTR retrotransposons are generally characterized by the presence of specific activity - reverse transcriptase activity, DNA nicking activity, and nucleic acid binding activity. The genetic loci for these activities are found in either a single open reading frame (ORF) or split between two ORFs. The DNA nicking activity of single-ORF systems is found with restriction-like endonuclease (RLE) domains. Multiple non-LTR retrotransposon families, such as the R2, R4, R5, R8, R9, Dong and Cre families, are categorized as RLE containing non-LTR retrotransposons.

[0007] . Of the known non-LTR retrotransposons, the most well studied is the R2 element. The R2 element is comprised of R2 RNA and the R2 protein. The R2 element contains a single open reading frame (ORF), which encodes a reverse transcriptase, an endonuclease, and includes DNA binding regions and zinc finger motifs. R2 element. R2 inserts itself into a host genome through a mechanism known as Target Primed Reverse Transcription (TPRT), which is a stepwise reaction including a first nick of host DNA, reverse transcription of the R2 RNA into the first strand, a second nick of host DNA, and synthesis of a second strand.

[0008] . The mechanism by which the R2 element inserts into a host genome, being independent of endogenous cellular repair pathways, as well as the capacity to carry an RNA molecule of varying sizes to a host genome, makes the R2 element a potentially powerful genome editing system. However, the R2 element specifically inserts itself into either the 28S or 18S ribosomal RNA locus. Therefore, it lacks the ability to target insertions to a particular locus, which is a critical aspect for viable genome editing systems. Other site-specific retrotransposons are similarly limited to particular loci. There remains an unmet need for a genome editing system that is capable of directed insertion of large nucleic acids into a host genome.BRIEF SUMMARY

[0009] . The present disclosure is directed to a genome editing system comprising: i) an R2 element enzyme; and ii) a payload RNA, wherein the payload RNA comprises an insertion template and optionally one or more of a 5’ homology region, a 3’ homology region, and a protein binding element, wherein the insertion template comprises a sequence for a nucleic2SUBSTITUTE SHEET (RULE 26)acid insertion into the genome, and wherein the R2 element enzyme comprises a reverse transcriptase domain, and a nickase domain.

[0010] . In some embodiments the R2 element enzyme further comprises a targeting domain. In some embodiments the targeting domain is a natural targeting domain or an engineered targeting domain. In some embodiments, the nucleic acid insertion into the genome is a DNA or RNA insertion template. In some embodiments, the R2 element enzyme is a modified R2 element enzyme. In some embodiments, the coding sequence of the R2 element enzyme is modified. In some embodiments, wherein the modified R2 element enzyme is modified by an N-terminal or C-terminal truncation of the R2 element enzyme sequence. In some embodiments, the modified R2 element enzyme comprises a linker. In some embodiments the linker is an XTEN linker.

[0011] . In some embodiments, the genome editing system targets a genomic locus. In some embodiments, the genome editing system targets a genomic locus other than the 28 S rRNA locus. In some embodiments, an N-terminal zinc finger domain of the R2 element enzyme is modified to target a genomic locus other than the 28S rRNA locus. In some embodiments, a non-naturally occurring targeting region is fused to the N-terminus of the R2 element enzyme or inserted into the R2 element enzyme.

[0012] . In some embodiments, the modified R2 element enzyme is a fusion protein. In some embodiments, the modified R2 element is fused to a Cas9 protein that is fully active, catalytically dead (H840A / D10A for SpCas9), or functioning as a nickase (H840A or D10A for SpCas9). In some embodiments, the modified R2 element is fused to a Casl2 protein that is fully active, catalytically dead, or functioning as a nickase. In some embodiments, the modified R2 element is fused to a TALEN protein, zinc finger protein, argonaute, or meganuclease protein.

[0013] . In some embodiments, the genome editing system further comprises a guide RNA. In some embodiments, the 5’ homology region of the payload RNA is engineered to target a genomic locus other than the 28S rRNA locus. In some embodiments, the 5’ homology region, the 3’ homology region, or both the 5’ and 3’ homology region target an exogenously introduced landing sequence.3SUBSTITUTE SHEET (RULE 26)

[0014] . In some embodiments, the insertion region is introduced into the genome of a specific cell type. In some embodiments, the specific cell type is a post-mitotic cell. In some embodiments, the genome editing system functions in post-mitotic cells. In some embodiments, the genome editing system functions independently from intrinsic nucleic acid repair systems.

[0015] . In some embodiments, the payload RNA template further comprises a 5’ untranslated region (UTR), a 3’ UTR, or both a 5’ UTR and a 3’ UTR. In some embodiments, the 5’ homology region and the 3’ homology region are located between the 5’ UTR and 3’ UTR. In some embodiments, the 5’ homology region and the 3’ homology region are located outside the 5’ UTR and 3’ UTR. In some embodiments, the payload RNA further comprises a 5’ untranslated region (UTR), a 3’ UTR, or both a 5’ and a 3’ UTR, wherein the UTRs are truncated. In some embodiments, the payload RNA does not comprise a 5’ UTR. In some embodiments, the payload RNA does not comprise a 3’ UTR.

[0016] . In some embodiments, the payload RNA further comprises a nuclear retention element. In some embodiments, the payload RNA further comprises a Cas9 or Casl2 guide RNA, wherein the Cas9 or Casl2 guide RNA comprises an extension with a 5’ homology sequence, a 3’ homology sequence, a 5’ untranslated region (UTR), a 3’ UTR, an insertion template, or any combination thereof. In some embodiments the nucleic acid insertion template is a sequence of greater than 1000 base pairs.

[0017] . In some embodiments, the R2 element enzyme comprises a nuclear localization signal (NLS).

[0018] . In some embodiments, the insertion region comprises a template for a reporter gene, a transcription factor gene, a transgene, an enzyme gene, or a therapeutic gene.

[0019] . The present disclosure is also directed to a method of inserting a large nucleic acid into a genome within a cell using a Cas9 or Casl2 fusion protein, wherein the method comprises supplying a Cas9 or Casl2 fusion protein to a cell, wherein the Cas9 or Casl2 fusion protein is supplied with a payload RNA template, wherein the RNA template is reverse transcribed by the Cas9 or Casl2 fusion protein prior to being inserted into the genome of the cell; and wherein the large nucleic acid is inserted into the genome of the cell.4SUBSTITUTE SHEET (RULE 26)

[0020] . In some embodiments, the Cas9 fusion protein comprises a Cas9 portion and an R2 element portion. In some embodiments, the Cas9 fusion protein comprises a targeting domain, a reverse transcriptase domain, and a nickase domain. In some embodiments, the Cast 2 fusion protein comprises a Cast 2 portion and an R2 element portion.

[0021] . The disclosure is also directed to a method of inserting an exogenous nucleic acid into the genome of a post-mitotic cell, wherein the method comprises subjecting the genome of the post-mitotic cell to a modified Cas9 protein that inserts the exogenous nucleic acid into the genome of the post-mitotic cell. In some embodiments, the modified Cas9 protein is fused to an R2 element enzyme. In some embodiments, the modified Cas9 fusion protein targets an endogenous landing site. In some embodiments, the Cas9 fusion protein targets an exogenously introduced landing site in the genome of the post-mitotic cell.

[0022] . The disclosure is also directed to a method of editing a genome comprising subjecting the cell to the genome editing systems described above.

[0023] . The disclosure is also directed to a composition comprising a cell edited by the genome editing systems or methods of editing genomes described above.

[0024] . The disclosure is also directed to a genome editing system comprising: i) a payload RNA, wherein the payload RNA comprises an insertion template and optionally one or more of a 5’ homology region, a 3’ homology region, and a protein binding element, wherein the insertion template comprises a sequence for a nucleic acid insertion into the genome; ii) a non-LTR site specific retrotransposon element enzyme; wherein the non-LTR site specific retrotransposon element enzyme comprises a reverse transcriptase domain and, optionally, a nuclease or nickase domain, and wherein if the non-LTR-site specific retrotransposon element enzyme does not comprise the optional nuclease or nickase domain, the genome editing system further comprises iii) a nuclease or nickase enzyme. In some embodiments, the nuclease or nickase enzyme is a programmable nuclease or nickase. In some embodiments, the non-LTR site specific retrotransposon element enzyme further comprises a targeting domain. In some embodiments, the targeting domain is a natural targeting domain or an engineered targeting domain.

[0025] . The disclosure is also directed to a genome editing system where the non-LTR site specific retrotransposon comes from the Rl, R2, R4, R5, R6, R7, R8, R9, CRE, NeSL,5SUBSTITUTE SHEET (RULE 26)HERO, or Utopia families, or from the 9 family classifications established for RLE domain containing nLTR retrotransposons (FIG. 24C).

[0026] . In some embodiments, the nucleic acid insertion into the genome is a DNA or RNA insertion template.

[0027] . In some embodiments, the non-LTR site specific retrotransposon element enzyme is a modified non-LTR site specific retrotransposon element enzyme. In some embodiments, the coding sequence of the non-LTR site specific retrotransposon element enzyme is modified. In some embodiments, the modified non-LTR site specific retrotransposon element enzyme is modified by an N-terminal or C-terminal truncation of the non-LTR site specific retrotransposon element enzyme sequence.

[0028] . In some embodiments, the modified non-LTR site specific retrotransposon element enzyme comprises a linker. In some embodiments, the linker is an XTEN linker.

[0029] . The genome editing system of the disclosure targets a genomic locus. In some embodiments, the genome editing system targets a genomic locus other than the 28 S rRNA locus. In some embodiments, an N-terminal zinc finger domain of the non-LTR site specific retrotransposon element enzyme is modified to target a genomic locus other than the 28S rRNA locus. In some embodiments, a non-naturally occurring targeting region is fused to the N-terminus of the non-LTR site specific retrotransposon element enzyme or inserted into the non-LTR site specific retrotransposon element enzyme.

[0030] . In some embodiments, the modified non-LTR site specific retrotransposon element enzyme is a fusion protein. In some embodiments, the modified non-LTR site specific retrotransposon element is fused to a Cas9 protein that is fully active, catalytically dead (H840A / D10A for SpCas9), or functioning as a nickase (H840A or D10A for SpCas9). In some embodiments, the modified non-LTR site specific retrotransposon element is codelivered with a Cas9 protein that is fully active, catalytically dead (H840A / D10A for SpCas9), or functioning as a nickase (H840A or D10A for SpCas9). In some embodiments, the modified non-LTR site specific retrotransposon element is fused to a Casl2, IscB, IsrB, or TnpB protein that is fully active, catalytically dead, or functioning as a nickase. In some embodiments, the modified non-LTR site specific retrotransposon element is delivered in trans with a Casl2, IscB, IsrB, or TnpB protein that is fully active, catalytically dead, or functioning6SUBSTITUTE SHEET (RULE 26)as a nickase. In some embodiments, the modified non-LTR site specific retrotransposon element is fused to a TALEN protein, zinc finger protein, argonaute, or meganuclease protein.

[0031] . In some embodiments, the disclosure further comprises a guide RNA. In some embodiments, the disclosure further comprises multiple guide RNA.

[0032] . In some embodiments, the genome editing system of the disclosure comprises a payload wherein the 5’ homology region, the 3’ homology region, or both the 5’ and 3’ homology region of the payload RNA is engineered to target a genomic locus other than the 28S rRNA locus. In some embodiments, the 5’ homology region, the 3’ homology region, or both the 5’ and 3’ homology region target an exogenously introduced landing sequence.

[0033] . In some embodiments, the insertion region is introduced into the genome of a specific cell type. In some embodiments, the specific cell type is a post-mitotic cell, a nondividing cell, or a quiescent cell. In some embodiments, the genome editing system functions in post-mitotic cells, non-dividing cells, or quiescent cells. In some embodiments, the genome editing system functions independently from intrinsic nucleic acid repair systems.

[0034] . In some embodiments, the payload RNA template further comprises a 5’ untranslated region (UTR), a 3’ UTR, or both a 5’ UTR and a 3’ UTR. In some embodiments, the 5’ homology region and the 3’ homology region are located between the 5’ UTR and 3’ UTR. In some embodiments, the 5’ homology region and the 3’ homology region are located outside the 5’ UTR and 3’ UTR. In some embodiments, the payload RNA further comprises a 5’ untranslated region (UTR), a 3’ UTR, or both a 5’ and a 3’ UTR, wherein the UTRs are truncated. In some embodiments, the payload RNA does not comprise a 5’ UTR. In some embodiments, the payload RNA does not comprise a 3’ UTR. In some embodiments, the payload RNA further comprises a nuclear retention element. In some embodiments, the payload RNA further comprises a Cas9 or Casl2 guide RNA, and wherein the Cas9 or Casl2 guide RNA comprises an extension with a 5’ homology sequence, a 3’ homology sequence, a 5’ untranslated region (UTR), a 3’ UTR, an insertion template, or any combination thereof.

[0035] . In some embodiments, the nucleic acid insertion template is a sequence of greater than 1000 base pairs.

[0036] . In some embodiments, the genome editing system targets a genome for a deletion. In some embodiments, the deletions are between 1 and 150 bases.7SUBSTITUTE SHEET (RULE 26)

[0037] . In some embodiments, the non-LTR site specific retrotransposon element enzyme comprises a nuclear localization signal (NLS).

[0038] . In some embodiments, the insertion region comprises a template for a reporter gene, a transcription factor gene, a transgene, an enzyme gene, or a therapeutic gene.

[0039] . The disclosure is also directed to a method of inserting a large nucleic acid into a genome within a cell using a Cas9 or Casl2 fusion protein, wherein the method comprises supplying a Cas9 or Casl2 fusion protein to a cell, wherein the Cas9 or Casl2 fusion protein is supplied with a payload RNA template, wherein the RNA template is reverse transcribed by the Cas9 or Casl2 fusion protein prior to being inserted into the genome of the cell; and wherein the large nucleic acid is inserted into the genome of the cell In some embodiments, the Cas9 fusion protein comprises a Cas9 portion and a non-LTR site specific retrotransposon element portion. In some embodiments, the Cas9 fusion protein comprises a targeting domain, a reverse transcriptase domain, and a nickase domain In some embodiments, the Casl2 fusion protein comprises a Casl2 portion and a non-LTR site specific retrotransposon element portion.

[0040] . The disclosure is also directed to a method of inserting an exogenous nucleic acid into the genome of a post-mitotic cell, wherein the method comprises subjecting the genome of the post-mitotic cell to a modified Cas9 protein that inserts the exogenous nucleic acid into the genome of the post-mitotic cell. In some embodiments, the modified Cas9 protein is fused to a non-LTR site specific retrotransposon element enzyme. In some embodiments, the modified Cas9 fusion protein targets an endogenous landing site. In some embodiments, the Cas9 fusion protein targets an exogenously introduced landing site in the genome of the postmitotic cell.

[0041] . The disclosure is also directed to a method of editing a genome comprising subjecting the cell to the genome editing system as described herein. The disclosure is also directed to a composition comprising the cell edited by the genome editing methods described herein.

[0042] . The disclosure is also directed to a method of correcting a genetic mutation related to disease or human pathology, wherein the method comprises making small nucleotide8SUBSTITUTE SHEET (RULE 26)changes or small nucleotide insertions (1-100 bp) in a human genome using the genome editing system of claim 1 or claim 47.

[0043] . In some embodiments, the genome editing system is delivered via single or multi vector AAV, adenovirus, lentivirus, herpes simplex virus, PEG10 viral like particles, PNMA viral like particles, gag-like viral like particles, nanoblades, gesicles, or Friend murine leukemia virus (FMLV) viral like proteins.

[0044] . In some embodiments, the components of the genome editing system are delivered as all RNA in lipid nanoparticles or another RNA delivery reagent. In some embodiments, wherein the non-LTR site specific retrotransposon is delivered as mRNA. In some embodiments, the guide RNAs are delivered as synthetic RNA. In some embodiments, the payload is delivered as mRNA.

[0045] . The disclosure is also directed to a genome editing system targets and edits the genome at more than one site.BRIEF DESCRIPTION OF THE DRAWINGS

[0046] . Fig. l is a visual depiction of PCR products isolated on an agarose gel following amplification from isolated DNA from HEK293FT cells which were transfected with two plasmids, showing insertion of R2 into the human genome. Lane 1 displays a molecular weight marker. Lane 2 displays PCR products from cells transfected with an R2 plasmid, encoding an R2 derived from the zebra finch (Taeniopygia guttata) R2 element (R2Tg) with an eGFP payload. Lane 3 displays the PCR products from cells transfected with R2Tg alone. Lane 4 displays the PCR products from cells transfected with eGFP payload alone. Lanes 5 and 6 display the PCR products from cells transfected with R2 orthologs from Geospiza fortis (Gfo) and a long Gfo payload (Lane 5) or short Gfo payload (Lane 6) Lane 7 displays PCR product from cells transfected with an R2 ortholog from Geospiza fortis alone. Lane 8 displays PCR product from cells transfected with only long Gfo payload. Lane 9 displays PCR product from cells transfected with only short Gfo payload.

[0047] . Fig. 2 is a graphical depiction of luminescence readout from HEK293FT cells transfected with 3 separate plasmids: the first containing an R2 protein encoding region, the second containing an inactive luciferase reporter region (containing the promoter region and a first of two artificial and inactive luciferase exons followed by a chimeric intron) with R29SUBSTITUTE SHEET (RULE 26)landing sites (the landing site is placed in an intronic region that is spliced out after insertion of the payload carrying the second of two artificial exons) of variable length, and the third containing a luciferase portion of a payload, 5’ and 3’ UTRs as well as regions homologous to the landing sites. The x-axis labels represent variable landing sites, named according to the number of base pairs (bp) present on the landing site on either side of the insertion; 38 / 10 therefore, represents 38 bp upstream of the insertion site and 10 bp downstream of the insertion site. Columns 11 and 12 display the luminescence readout of two negative controls, AAVS1 _target (non-target) and CFTR_target (non-target).

[0048] . Figs. 3A is a graphical depictions of the tolerability of mutations of the landing sites with respect to R2 integration in HEK293FT cells. HEK293FT cells were transfected with 3 separate plasmids: the first containing an R2 protein encoding region, the second containing a luciferase reporter region with mutated or wild type R2 (28S) landing sites in the intronic region that follows the first of two luciferase exons, and the third (payload) plasmid containing the second exon necessary for luciferase signal after insertion and splicing of the reporter plasmid. Additionally to a small intronic sequence upstream of the second of two artificial luciferase exons (minimal cargo necessary for luciferase signal), the payload plasmid has 5’ and 3’ UTR sequences as well as 5’ and 3’ homologies (lOObp homology to the 28S locus on either side). Fig. 3A displays the location of certain mutations within the region flanking the insertion on the insertion region plasmid. Figure discloses SEQ ID NOS 33523-33534, respectively, in order of appearance. Fig. 3B is a readout of luminescence from HEK293FT cells transfected as above. The y-axis represents the specific plasmids containing altered landing sites introduced into the specific cell, with each name representing the number of base pairs (bp) present on the landing site on either side of the insertion; 37 / 23 therefore, represents 37 bp upstream of the insertion site and 23 bp downstream of the insertion site. A 115 / 115 negative control (transfected cell with no plasmid expressing R2).

[0049] . Figs. 4A is a graphical depictions of the tolerability of mutations of landing sites with respect to R2 integration in HEK293FT cells. HEK293FT cells were transfected with 3 separate plasmids: the first containing an R2 protein encoding region, the second containing a luciferase reporter region with mutated or wild type R2 landing sites and the third (payload) plasmid containing the second exon necessary for luciferase signal after insertion and splicing of the reporter plasmid. Additionally to a small intronic sequence upstream of the second of two artificial luciferase exons (minimal cargo necessary for luciferase signal), the payload10SUBSTITUTE SHEET (RULE 26)plasmid has 5’ and 3’ UTR sequences as well as 5’ and 3’ homologies (lOObp homology to the 28S locus on either side). Fig. 4A displays the location of certain mutations within the region flanking the insertion on the insertion region plasmid. Figure discloses SEQ ID NOS 33535- 33546, respectively, in order of appearance. Fig. 4B is a readout of luminescence from HEK293FT cells transfected as above. Target_37_23_mut_10 (red box) has full mutations of all three, predicted zinc finger binding sites.

[0050] . Fig. 5 is a graphical depiction of the effect of aphidicolin on the integration of a luciferase payload into a target region. HEK293FT cells were transfected with 3 separate plasmids: the first containing an R2 protein encoding region, the second containing a luciferase reporter region with R2 landing sites, and the third (payload) plasmid containing the second exon necessary for luciferase signal after insertion and splicing of the reporter plasmid. Additionally to a small intronic sequence upstream of the second of two artificial luciferase exons (minimal cargo necessary for luciferase signal), the payload plasmid has 5’ and 3’ UTR sequences as well as 5’ and 3’ homologies (lOObp homology to the 28S locus on either side)Cells were then treated] with either Dimethyl Sulfoxide (DMSO) or aphidicolin at a concentration of 1 pm, 5 pm, or 25 pm. Homologous sequences in the insertion region were either 60 bp or 40 bp long. Columns 9-12 are cells treated with either DMSO or aphidicolin and transfected with negative control plasmids.

[0051] . Fig. 6 is a graphical depiction of the effect of aphidicolin on the integration of a luciferase payload into a target region. HEK293FT cells were transfected with 3 separate plasmids: the first containing an R2 protein encoding region, the second containing a luciferase reporter region with R2 landing sites, and the third (payload) plasmid containing the second exon necessary for luciferase signal after insertion and splicing of the reporter plasmid. Additionally to a small intronic sequence upstream of the second of two artificial luciferase exons (minimal cargo necessary for luciferase signal), the payload plasmid has 5’ and 3’ UTR sequences as well as 5’ and 3’ homologies (lOObp homology to the 28S locus on either side. Cells were then treated with either Dimethyl Sulfoxide (DMSO) or aphidicolin at a concentration of 1 pm, 5 pm, or 25 pm. The insertion regions of the plasmids are flanked by either 300 bp, 200 bp, or 100 bp. Columns 13-16 contain a 300 bp flanking sequence in the insertion region and were simultaneously transfected with a plasmid without an active R2 enzyme. Columns 17-20 were solely transfected with a Cas9 plasmid.11SUBSTITUTE SHEET (RULE 26)

[0052] . Fig. 7 is a visual depiction of a heatmap showing the luminescence readout of HEK293FT cells transfected with 3 separate plasmids. The first plasmid contained an R2 protein encoding region, the second plasmid contained a luciferase reporter precursor region with R2 landing sites, and the third (payload) plasmid containing the second exon necessary for luciferase signal after insertion and splicing of the reporter plasmid. Additionally to a small intronic sequence upstream of the second of two artificial luciferase exons (minimal cargo necessary for luciferase signal), the payload plasmid has 5’ and 3’ UTR sequences as well as 5’ and 3’ homologies of different length (from 0 to lOObp homology in steps of 20bp).

[0053] . Fig. 8 is a graphical depiction of the effect of modification of UTRs on the luminescence readout of transfected HEK392FT cells. HEK293FT cells were transfected with 3 separate plasmids. The first plasmid contained an R2 protein encoding region, the second plasmid contained a splice luciferase reporter region with R2 landing sites 26 / 22 bp, and the third (payload) plasmid containing the second exon necessary for luciferase signal after insertion and splicing of the reporter plasmid. Additionally to a small intronic sequence upstream of the second of two artificial luciferase exons (minimal cargo necessary for luciferase signal), the payload plasmid has 5’ and 3’ UTR sequences that are truncated in different ways as well as 5’ and 3’ homologies. Column 1 represents a positive control. Column 2 represents a negative control. Columns 3-8 represent truncations from the left of the 5’UTR. Columns 9-15 represent truncations from the right of the 5’ UTR. Columns 16-22 represent truncations from the left of the 3’ UTR. Columns 23-29 represent truncations from the right of the 3 ’UTR.

[0054] . Fig. 9A is a graphical depiction exhibiting the effect that altered homology regions have on integration. HEK293FT cells were transfected with 3 separate plasmids: the first containing an R2 protein encoding region, the second containing a luciferase reporter region with 26 / 22bp R2 landing sites and the third (payload) plasmid containing the second exon necessary for luciferase signal after insertion and splicing of the reporter plasmid. Additionally to a small intronic sequence upstream of the second of two artificial luciferase exons (minimal cargo necessary for luciferase signal), the payload plasmid has 5’ and 3’ UTR sequences as well as 5’ and 3’ homologies. Here, the 3’ homologies have different lengths: PBS13 (13bp) and 3’ homology (lOObp). HDV is an HDV ribozyme, which cleaves the insertion region directly after the 3’ UTR and mHDV is a mutated HDV ribozyme that is nonfunctional. Fig. 9B is a visual representation of each 3’ modification.12SUBSTITUTE SHEET (RULE 26)

[0055] . Fig. 10 is a graphical depiction of the effect of linker insertion site on integration efficiency of the R2 protein. Linkers were inserted into various domains at specific insertion sites of an R2 derived from the zebra finch (Taeniopygia guttata) R2 element (R2Tg) with an eGFP or msfGFP payload. Positions for linkers were identified using Emboss gamier to identify potential linker regions, of which 12 were chosen. Linkers for eGFP, for example, were GSGGGSGS (SEQ ID NO: 33377)-EGFP-GSGGGGSG (SEQ ID NO: 33378). Columns 1 and 2 are wild-type R2Tg without a linker region.

[0056] . Fig. 11 is a graphical depiction of editing efficiency in the short 28 S landing site in an exogenous plasmid. HEK293FT cells were transfected with 3 separate plasmids: the first either containing an R2 protein encoding region or no R2 protein encoding region, the second containing a luciferase reporter region with 26 / 22 (26 upstream / 22 downstream) R2 landing sites and the third (payload) plasmid containing the second exon necessary for luciferase signal after insertion and splicing of the reporter plasmid. Additionally, to a small intronic sequence upstream of the second of two artificial luciferase exons (minimal cargo necessary for luciferase signal), the payload plasmid has 5’ and 3’ UTR sequences and lOObp 5’ and 3’ homologies to the 28S target site. Percent editing is measured by digital droplet PCR (ddPCR) using primers that recognize the payload.

[0057] . Fig. 12 is a graphical depiction of R2 insertion efficiency within the endogenous Beta actin locus of HEK293FT cells transfected with 4 separate plasmids: the first containing an R2 protein encoding region, the second containing an insertion region with a pMAX gene flanked by 5’ and 3’ UTRs and homology regions to the 28S locus, the third a prime editor encoding region, and the fourth a prime editing guideRNA to introduce a 26 / 22 R2 target site at the ACTB locus. From left to right, the samples are 1) wild-type R2 protein, 2) R2 protein fused to a nuclear localization signal, 3) no R2 protein with Prime editing molecule, 4) R2 protein without prime editing molecule. Percent integration is measured by ddPCR.

[0058] . Fig. 13A is a visual depiction of the integration a payload comprised of an R2 protein attached at the C-terminus to eGFP. Fig. 13B is graphical depiction is a luminescence readout of the effect of addition of a nuclear localization signal to the N and C-terminus of the R2 protein on reporter expression. Either wild-type R2 (column 1) or NLS-appended R2 (column 2) were transfected into HEK293FT cells with a stably integrated splice reporter. A negative control is shown in column 3.13SUBSTITUTE SHEET (RULE 26)

[0059] . Figs. 14A is a visual depiction of HEK293FT cells transfected with either an R2 expression plasmid (Figs. 14A, 14B) or an R2 negative plasmid (Figs. 14C, 14D) at either 20 hours post transfection (Figs. 14A, 14C) or 36 hours post transfection (Figs. 14B, 14D). The R2 template inserts a second GFP exon into the stably transfected splice receptor, which contains the promoter and a first exon, allowing for GFP expression following integration.

[0060] . Figs. 15A is a graphical depiction of the percentage of GFP positive cells as determined by flow cytometry following transfection of specific plasmids. Fig. 15A is a graph depicting fluorescent readout of cells transfected with plasmids with wild-type R2 (column 1), a negative control (no R2 protein; column 2), 300 ng of R2 with a nuclear localization signal (column 3), 200 ng of R2 with a nuclear localization signal (column 4), 100 ng of R2 with a nuclear localization signal (column 5), 50 ng of R2 with a nuclear localization signal (column 5), and untransfected cells as a percentage of all cells in each sample. Fig. 15B is a graph depicting fluorescent readout of cells transfected with plasmids with wild-type R2 (column 1), a negative control (no R2 protein; column 2), 300 ng of R2 with a nuclear localization signal (column 3), 200 ng of R2 with a nuclear localization signal (column 4), 100 ng of R2 with a nuclear localization signal (column 5), 50 ng of R2 with a nuclear localization signal (column 5), and untransfected cells as a percentage of the number of transfected cells in each sample.

[0061] . Fig. 16A is a graphic depiction exhibiting the effect that N-terminal truncations of the R2 protein have on integration. HEK293FT cells were transfected with 3 separate plasmids: the first containing an R2 protein encoding region, in which the R2 protein has been truncated from the N-terminus, the second containing a luciferase reporter region with 26 / 22bp R2 landing sites, and the third (payload) plasmid containing the second exon necessary for luciferase signal after insertion and splicing of the reporter plasmid. Additionally to a small intronic sequence upstream of the second of two artificial luciferase exons (minimal cargo necessary for luciferase signal), the payload plasmid has 5’ and 3’ UTR and 5’ and 3’ homologies to the 28S target site. Wild-type R2 (column 1) and negative control (column 2) are also depicted. Fig. 16B is a visual representation of the N-terminal truncations of the R2 protein. Each horizontal bar represents the R2 protein expressed, with further N-terminal regions being removed as the numbers go from 1 to 10.

[0062] . Fig. 17A is a graphic depiction exhibiting the effect that C-terminal truncations of the R2 protein have on integration. HEK293FT cells were transfected with 3 separate plasmids: the first containing an R2 protein encoding region, in which the R2 protein has been14SUBSTITUTE SHEET (RULE 26)truncated from the C -terminus, the second containing a luciferase reporter region with 26 / 22bp R2 landing sites, and a third (payload) plasmid containing the second exon necessary for luciferase signal after insertion and splicing of the reporter plasmid. Additionally to a small intronic sequence upstream of the second of two artificial luciferase exons (minimal cargo necessary for luciferase signal), the payload plasmid has 5’ and 3’ UTR sequences and lOObp 5’ and 3’ homologies to the 28 S target site. Wild-type R2 (column 1) and negative control (column 2) are also depicted. Fig. 17B is a visual representation of the N-terminal truncations (Nt_l -Nt_10 from Fig. 16) as well as the C-terminal truncations (Ct_l-Ct_6) of the R2 protein. Each horizontal bar represents the R2 protein expressed, with further N or C- terminal regions being removed as the numbers get larger.

[0063] . Fig 18 is a graphical representation of the luminescence readout of HEK293FT cells transfected with three separate plasmids. HEK293FT cells were transfected with 3 separate plasmids. The first plasmid either contained an R2 protein encoding region, no R2 protein encoding region, or an R2 protein with a catalytically inactive restriction-like endonuclease (RLE) domain, which should ablate insertion activity. The second plasmid contained a luciferase reporter region with 26 / 22 (26 upstream / 22 downstream) R2 landing sites, and the third (payload) plasmid contained the second artificial exon necessary for luciferase signal after insertion and splicing of the reporter plasmid. Additionally to a small intronic sequence upstream of the second of two artificial luciferase exons (minimal cargo necessary for luciferase signal), the payload plasmid has 5’ and 3’ UTR sequences as well as 5’ and 3’ homologies.

[0064] . Fig. 19 is a graphical representation of the luminescence readout of HEK293FT cells transfected with three separate plasmids. HEK293FT cells were transfected with 3 separate plasmids. The first plasmid either contained an R2 protein encoding region, no R2 protein encoding region, or an R2 protein lacking one of several specific R2 protein domains. The second plasmid contained a luciferase reporter region with 26 / 22 (26 upstream / 22 downstream) R2 landing sites. The third plasmid contained an insertion region with a luciferase insertion as well as modified or unmodified UTRs. Columns 1-3 display the results when the transfected R2 protein is an R2 protein in which the -1 domain, which is an RNA interaction domain, has been deleted. Columns 4-6 display the results when the transfected R2 protein is an R2 protein in which the -1 and the 0 domain, which is also an RNA interaction domain, has been deleted. Columns 7-9 display the results when the transfected R2 protein is15SUBSTITUTE SHEET (RULE 26)an R2 protein in which the 0 domain has been deleted. Columns 10-12 display the results when the transfected R2 protein is an R2 protein in which the 0 domain has been replaced by an eGFP domain. Columns 13-15 display the results when the transfected R2 protein is an R2 protein in which the 0 domain has been replaced by an MS2 coat protein (MCP) domain, which binds to MS2 binding sites. Columns 16-18 display the results when the transfected R2 protein is an R2 protein with the N-terminal 6_2 truncation, and the MCP domain has been fused to the new N-terminus. Columns 19-21 display the results when the transfected R2 protein is an R2 protein with the N-terminal 6_2 truncation, MCP domain fused to the new N- terminus, and the zinc finger domain has been deleted. Columns 22-24 display the results when the transfected R2 protein includes a c-terminal MCP fusion. Columns 25-27 display wild-type R2, and columns 28-30 display the negative control. Orange bars have a payload which includes a wild-type luciferase with 5’ and 3’ UTRs. Blue bars indicate payloads in which the 5’ UTR is replaced by extended MS2 regions. Green bars indicate payloads in which both the 5’ and 3’ UTR have been replaced by MS2 regions.

[0065] . Fig. 20 is a graphical depiction exhibiting the effect that altered payloads have on integration. HEK293FT cells were transfected with 3 separate plasmids: the first containing an R2 protein encoding region, the second containing a luciferase reporter region with 26 / 22bp R2 landing sites, and the third (payload) plasmid containing the second artificial exon necessary for luciferase signal after insertion and splicing of the reporter plasmid. Additionally to a small intronic sequence upstream of the second of two artificial luciferase exons (minimal cargo necessary for luciferase signal), the payload plasmid has 5’ and 3’ UTR sequences as well as 5’ and 3’ appended at the 3’ end with a number of different nuclear retention elements, as named on the x-axis. Figure discloses "atcTgtcaGtaAGCCCcatgGaAA" as SEQ ID NO: 33547.

[0066] . Fig. 21 is a graphical depiction exhibiting the effect that altered payloads have on integration. HEK293FT cells were transfected with 3 separate plasmids: the first containing an R2 protein encoding region, the second containing a luciferase reporter region with 26 / 22bp R2 landing sites and the third (payload) plasmid containing the second artificial exon necessary for luciferase signal after insertion and splicing of the reporter plasmid. Additionally to a small intronic sequence upstream of the second of two artificial luciferase exons (minimal cargo necessary for luciferase signal), the payload plasmid has 5’ and 3’ UTR sequences and modifications thereof as named on the x-axis, as well as 5’ and 3’ homologies.16SUBSTITUTE SHEET (RULE 26)

[0067] . Fig. 22A is a graphical depiction of luminescence readout of HEK293FT cells transfected with three separate plasmids, indicating cleavage by Cas9. HEK293FT cells were transfected with 3 separate plasmids. The first plasmid either contained modified R2 / Cas9 fusion protein, linked together by an XTEN sequence. The second plasmid contained a luciferase reporter region for Cas9 cleavage. The third plasmid a single guide RNA. Columns 1-3 display the results when the transfected R2 protein is an R2 protein in which the -1 domain, which is an RNA interaction domain, has been deleted Gray bars indicate an R2 protein with a nuclear localization signal, while orange bars indicate an R2 protein without a nuclear localization signal. The x-axis lists the individual R2 / Cas9 fusion proteins tested, as well as PDY0044 and a positive control. Fig. 22B is a visual representation of the modified fusion proteins used in Fig. 20A. Vertical lines where in the R2 protein the Cas9 portion is linked to the R2 portion by the XTEN linker.

[0068] . FIG. 23A is a visual representation exhibiting the integration of a 20 bp sequence to trigger the expression of GFP using a modified Cas9 / R2 protein. Figs. 23A-N represent modified fusion proteins of Cas9 fused at the N-terminus to R2 at varying locations. The fusion proteins of Figs. 23A-N exhibit the ability to insert a missing 20 bp region into an eGFP precursor (Fig. 23Q), leading to GFP expression. Fig. 230 is a negative control and Fig. 23P is a positive control.

[0069] . FIG. 24A is a schematic of computational pipeline used to discover and classify site-specific non-LTR retrotransposon systems. Figure discloses SEQ ID NOS 33548-33553 and 33553-33554, respectively, in order of appearance. FIG. 24B-C is a visual representation of a Phylogenetic tree of single-ORF non-LTR retrotransposons. Associations with putative target sites, including tandem repeats and conserved RNA families are shown. Full length ORF size is shown in the outermost ring with associated domains shown in inner rings. Labels of specific retrotransposons orthologs used in this study as well as previously described orthologs are listed above the outer ring with associated symbols labeled on the tree. Tandem repeat GC content percentage is shown as a color scale. Protein domains are colored according to different CDD / Pfam domains analyzed. Putative Myb and zinc finger domains from Prosite and Pfam (ZF) are colored according to the different configurations detected. The 9 families of RLE-containing non-LTR retrotransposons are shaded in different colors and labeled. SL1, corresponds to SL1 spliced-leader RNA. LSU, corresponds to large subunit rRNA (28 S). SSU,17SUBSTITUTE SHEET (RULE 26)corresponds to small subunit rRNA (18S). ZF motif labels correspond to different pfam IDs. CDD labels correspond to different CDD IDs.

[0070] . FIG. 25 is a visual representation of the Size distribution of the ORFs from the first methionine for each of the 9 families of RLE containing non-LTR retrotransposons.

[0071] . FIG. 26A is a schematic of chimeric non-LTR (nLTR) retrotransposon systems with flanking homologies targeting different insertion sites. E) Gaussia luciferase (Glue) production via payload insertion of a synthetic exon 2 by selected non-LTR retrotransposons into a 28S plasmid reporter, normalized to a Cypridina luciferase (Clue) control. FIG 26B is a schematic of typical non-LTR retrotransposon insertion sites with target sites consistent on both sides of the retrotransposon.

[0072] . Fig 27A is a visual analysis of results from a multiple sequence alignment of different non-LTR retrotransposons using MUSCLE, with Pfam domain schematic above as determined by HHpred. Fig. 27B is a visual analysis of sequence identity similarity of chosen non-LTR retrotransposon family members using the MUSCLE protein alignment from E.

[0073] . Fig. 28 is a visual analysis of the 5' end of the RIOMbr locus with the microsatellite repeat region and alignment to the human 28S rDNA region highlighted. Figure discloses SEQ ID NOS 33555-33557, respectively, in order of appearance.

[0074] . Fig. 29A is an analysis of Gaussia luciferase (Glue) production via payload insertion of a synthetic exon 2 by selected non-LTR retrotransposons into a 28S plasmid reporter, normalized to a Cypridina luciferase (Clue) control. Fig. 29B is a schematic of payload homology and target sites used to evaluate RIOMbr insertion. Figure discloses SEQ ID NOS 33558-33562, respectively, in order of appearance. Fig 29C is a visual analysis of the results of an experiment analyzing Glue payload insertion by RIOMbr into a panel of luciferase reporters, as quantified by luciferase production, with R2Tg targeting the R2 28S sequence as control. Reporters with either similarity to the R228S region, or with similarity to the 28S homology region in the RIOMbr locus are used for evaluation of alternative insertion sites.

[0075] . Fig. 30A is an analysis of EGFP payload insertion by wild type and domain inactivated mutants of R2Tg at the endogenous human 28S locus, analyzed at 5' and 3' junctions via gel electrophoresis. Mutants tested were D1274A (RLE inactivation), D877A / D878A / D884A (RT domain inactivation), and ZF2 domain inactivation (replacement18SUBSTITUTE SHEET (RULE 26)of residues 262-275 with NCp7 ZF FNCGKEGHTARN (SEQ ID NO: 33379) (Rocquigny, et al., (1997) J. Biol. Chem. 272, 30753-30759) Red triangles denote faint insertion bands. Schematic above shows insert with the payload denoted in blue, UTRs denoted in black, 28S homology arms denoted red, and 28S locus denoted grey. Black primers are used to readout the left junction and gold primers are used to readout the right junction. Fig. 30B is an analysis of EGFP payload insertion by wild type and domain inactivated mutants of R2Tg into the endogenous 28S locus, quantified by next-generation sequencing. Fig. 30C is an analysis of Glue production by wild type and domain inactivated mutants of R2Tg into a 28S plasmid reporter, normalized to a Clue control.

[0076] . Fig. 31A is graphical analysis of Gaussia luciferase exon 2 (Glue) payload insertion by wild type and domain inactivated mutants of R2Tg into a 28S plasmid reporter, with editing outcomes profiled by next generation sequencing at the upstream (left) junction. Mutants tested are WT R2Tg and R2TgD1274A , R2TgD877A, D878A, D884A, and R2TgZF2mut , and outcomes are classified as perfect insertions, insertions with indels, or WT locus indels. Fig. 31B is a graphical analysis of Glue payload insertion by wild type and domain inactivated mutants of R2Tg into a 28S plasmid reporter, with editing outcomes profiled by next generation sequencing at the downstream (right) junction. Mutants tested are WT R2Tg and R2TgD1274A , R2TgD877A, D878A, D884A, and R2TgZF2mut , and outcomes are classified as perfect insertions, insertions with indels, or WT locus indels. Fig. 31C are representative edits at the 5' -insertion junction, showing examples of indels in the outcome insertion products. Figure discloses SEQ ID NOS 33563-33565, respectively, in order of appearance.

[0077] . Fig. 32A is a schematic of example N- and C-terminal R2Tg truncations for evaluating domain functionality. Not all truncations shown. Fig. 32B is a graphical analysis of Glue payload insertion by wild type and N- or C- terminal truncations of R2Tg into a 28S plasmid reporter, quantified by next-generation sequencing.

[0078] . Fig. 33A is a schematic of Cas9H840A -R2Tg insertion at the 28S target, allowing for rescue of R2TgZF2mut activity. Fig. 33B is a graphical analysis of guideprogrammed Glue payload insertion by SpCas9H840A -R2TgZF2mut into a 28S plasmid reporter, in combination with paired guides or single guides, quantified by next generation sequencing. Perfect insertions, insertions with indels, and pure indel outcomes of Cas9H840A - R2TgZF2mut fusion are compared to SpCas9H840A. Fig. 33C is a graphical analysis of Glue payload insertion by WT R2Tg into a 28S plasmid reporter, with editing outcomes profiled by19SUBSTITUTE SHEET (RULE 26)next generation sequencing. Outcomes are classified as perfect insertions, insertions with indels, or WT locus indels.

[0079] . Fig. 34A is a graphical analysis of a Glue payload insertion by dead SpCas9D10A, H840A-R2Tg and mutants with targeting and non-targeting guides into a 28S plasmid reporter, as quantified by luciferase production. Fig. 34B is a graphical analysis of a Glue payload insertion by domain inactivated versions of SpCas9H840A -R2Tg into a 28S plasmid reporter and quantified by luciferase production and normalized to the corresponding SpCas9H840A guide condition. SpCas9H840A -R2Tg is combined with either dual, single, or nontargeting sgRNA combinations. Variants tested are R2TgD1274A and R2TgZF2mut. Fig. 34C is a graphical analysis of a Glue payload insertion by wild type and domain inactivated mutants of SpCas9H840A -R2Tg fusion into a 28S plasmid reporter, quantified by luciferase production and normalized to SpCas9H840A.

[0080] . Fig. 35A is a schematic for homology length titration of R2Tg payloads, with varying 5' and 3' homology lengths (red). The Glue cargo is shown in blue. Hairpins denote the 5' and 3' UTRs. Fig. 35B is a graphical analysis of a Glue payload insertion by R2Tg into a 28S plasmid reporter with payloads of different 5' or 3' homology lengths, profiled by next generation sequencing. Editing outcomes are quantified as perfect insertions, insertions with indels, and pure indels. Fig. 35C is a schematic for R2Tg insertion outcomes at the 28S target site, either with or without scars, with junction amplification primers for Sanger sequencing and gel readouts shown. Black and gold primers are used for 5' and 3' junction analyses, respectively. Schematic shows payload denoted in blue, UTRs denoted in black, 28S homology arms denoted red, and 28S locus denoted grey.

[0081] . Fig. 36A is a schematic of R2Tg scarless payload designs, with permuted and deleted UTR domains. Fig. 36B Sanger sequencing of 5' and 3' insertion junctions at the 28S target for additional selected payload designs after R2Tg integration. Payload numbers correspond to those in Fig. 36A. Figure discloses SEQ ID NOS 33566-33567, respectively, in order of appearance. Fig. 36C is a visual depiction of Sanger sequencing of 5' and 3' insertion junctions at the 28S target for selected payload designs after R2Tg integration. Payload numbers correspond to those in 36A. Figure discloses SEQ ID NOS 33566, 33568-33569, 33568-33569, 33567, 33569, and 33567, respectively, in order of appearance.20SUBSTITUTE SHEET (RULE 26)

[0082] . Fig. 37A is a visual representation of edits at the 5' insertion junction, showing examples of indels in the outcome insertion products. Figure discloses SEQ ID NOS 33563- 33565, respectively, in order of appearance. Fig. 37B is a visual depiction of indels at the 5' junction for R2Tg insertion at the 28S target for selected payloads. Non-templated Cs from reverse transcription in the bottom strand (G in the top strand) are highlighted with red boxes. Figure discloses SEQ ID NOS 33570-33571, 33564, 33572, 33571, 33564, 33582, and 33571, respectively, in order of appearance. Fig. 37C is a visual depiction of a size analysis by gel of 5' and 3' insertion junctions at the 28S target reporter for selected payload designs after R2Tg integration. Payload numbers correspond to those in Fig. 36A.

[0083] . Fig. 38A is a graphical depiction of integration efficiency of R2Tg at the 28S target reporter with different payload designs. Integration is profiled by next-generation sequencing as perfect insertions, insertions with indels, or WT locus indels. Payload numbers correspond to those in Fig. 36A. Fig. 38B is a visual depiction of example indels at the WT 28S locus target for selected payloads. Non-templated Cs from reverse transcription in the bottom strand (G in the top strand) are highlighted with red boxes. Figure discloses SEQ ID NOS 33563, 33565, 33564, 33571, 33564, 33573, 33571, 33564-33565, and 33573, respectively, in order of appearance. Fig. 38C is a schematic representation of additional payload variant with internal homology arms against the 28S target. Fig. 38D is a graphical representation of the Gaussia luciferase exon 2 (Glue) payload insertion by wild type R2Tg into a 28S plasmid reporter with payload variants shown in part B, with editing outcomes profded by next generation sequencing at the upstream (left) junction. Outcomes are classified as perfect insertions, insertions with indels, or WT locus indels.

[0084] . Fig. 39A is a schematic for reprogramming of a R2Tg payload for insertion at the AAVS1 site with scarless insertion. Fig. 39 B is a graphical depiction of a payload insertion by SpCas9H840A -R2Tg into the endogenous NOLC1 and AAVS1 loci, mediated by either single, dual guides, or non-targeting guides and quantified by next generation sequencing. Fig. 39C is a schematic of AAVS1 targeting payload variations used in Fig. 39D. Payload is shown in blue, homology arms are shown in gold, 5' 28S homology is shown in red, and UTRs are shown as hairpins. Fig. 39D is a graphical depiction of a Glue payload insertion, with variations on UTR, 28S homology, and AAVS1 homology (100 nt), by SpCas9H840A - R2Tg at endogenous AAVS1 locus, using a single bottom strand nicking guide. Integration is profiled by next-generation sequencing as perfect insertions, insertions with indels, or indels.21SUBSTITUTE SHEET (RULE 26)

[0085] . Fig. 40A is a schematic of SpCas9H840A fused to N- and C-terminal truncations of R2Tg at different amino acid positions. Not all tested constructs are shown. Fig. 40B is a graphical depiction of a Glue payload insertion by different SpCas9H840A -R2Tg fusions, according to the schematic in A, into the endogenous AAVS1 locus quantified by next generation sequencing. Fig. 40C is a graphical depiction of the payload insertion by SpCas9H840A -R2Tg fusion, A / X G.sd / ) / dd,ii84o \-R2Tg fusion, and SpCas9H840A and R2Tg in trans. Payloads are inserted at either AAVS1 or NOLC1 loci, with insertion at AAVS1 quantified by next generation sequencing and insertions at NOLC1 quantified by ddPCR.

[0086] . Fig. 41A is a graphical depiction of a Glue payload insertion by SpCas9H840A -R2Tg at the endogenous AA VS J target site with a panel of dual and single guides, compared with SpCas9H840A . Payloads have 100 nt of homology to the target site. Editing outcomes are quantified as perfect insertions, insertions with indels, and indels at the unmodified target site. The optimized payload design is used with a 5' 28S homology arm, truncated 5' R2Tg UTR, and internal AAVS1 homology arms. Fig. 41B is a graphical depiction of the integration of Glue payload at the endogenous AAVS1 locus by the SpCas9H840A -R2Tg fusion with a payload containing 50 nt homology arms.

[0087] . Fig. 42A is a graphical depiction of a Glue payload insertion into a 28S plasmid reporter by selected non-LTR retrotransposons fused to SpCas9H840A , with either targeting or non-targeting guides, quantified by Glue production normalized to a control Clue. Data is shown as ratio of targeting signal to non-targeting signal. Fig. 42B is a schematic of AAVS1 insertion with optimized payloads containing the cognate 5' UTR corresponding to each non- LTR retrotransposon ortholog being evaluated. Fig. 42C is a graphical depiction of a Glue payload insertion into the endogenous AA VS J locus by selected non-LTR retrotransposons fused to SpCas9H840A , with either targeting or non-targeting guides, quantified by next generation sequencing. Fig. 42D Glue payload insertion into the endogenous AAVS1 locus by selected non-LTR retrotransposons fused to SpCas9H840A , with either targeting or nontargeting guides, profiled by next generation sequencing. Editing outcomes are quantified as perfect insertions, insertions with indels, and indels at the unmodified WT target site.

[0088] . Fig. 43A is a graphical depiction of EGFP payload insertion (50 nt homology arms) by STITCHR with SpCas9H840A -R2Toc into the endogenous NOLC1 locus, with combinations of single and dual guides, compared to SpCas9H840A and quantified by digital droplet PCR (ddPCR). Editing outcomes are quantified as total insertions, integrations with22SUBSTITUTE SHEET (RULE 26)indels, and WT locus indels. Fig. 43B is a graphical depiction of a Glue payload insertion by STITCHR with SpCcts9H840A -R2Toc into the endogenous SERPINA1 locus (left homology 100 nt and right homology 50 nt), with combinations of single and dual guides, compared to SpCcts9H840A and profded by next generation sequencing. Editing outcomes are quantified as perfect insertions, insertions with indels, and WT locus indels. Fig. 43C is a graphical depiction of an EGFP payload insertion by STITCHR with SpCas9H840A -R2Toc into the endogenous NOLC1 locus, with combinations of single and dual guides, compared to a nontargeting guide control and quantified by digital droplet PCR (ddPCR). Fig. 43D is a graphical depiction of an EGFP payload insertion by STITCHR with SpCas9H840A -R2Toc into the endogenous NOLC1 locus, with combinations of single and dual guides, compared to a nontargeting guide control and profiled by next generation sequencing. Editing outcomes are quantified as perfect insertions, insertions with indels, and WT locus indels.

[0089] . Fig. 44A is a graphical depiction of an EGFP payload insertion by STITCHR with SpCas9H840A -R2Toc into the endogenous NOLC1 locus, with a panel of payloads with 50 nt homology arms targeting NOLC1 or AAVS1 targets, or without homology. Payloads are evaluated with single, dual, or non-targeting guides and are compared to SpCas9H840A . Editing is quantified by ddPCR. N denotes the NOLC1 target. A denotes the AAVS1 target. Fig. 44B is a graphical depiction of an EGFP payload insertion by STITCHR with SpCas9H840A -R2Toc into the endogenous NOLC1 locus, with a panel of payloads with varying homology arm lengths. Payloads are evaluated with dual or non-targeting guides and are compared to SpCas9H840A. Editing is quantified by ddPCR. Fig. 44C is a graphical evaluation of gene integration at the AAVS1 locus with SpCas9H840A -R2Toc and SpCas9H840A using payloads of varying sized homology arms (100 nt, 75 nt, 50 nt, and 30 nt). Integration is evaluated with dual guides, single guides, and non-targeting guides. Fig 44D is a graphical evaluation of gene integration at the SERPINA1 locus with SpCas9H840A - R2Toc and SpCas9H840A using payloads of varying sized homology arms (100 nt, 75 nt, 50 nt, and 30 nt). Integration is evaluated with dual guides, single guides, and non-targeting guides.

[0090] . Fig. 45A is a schematic of STITCHR using SpCas9H840A -R2Toc to insert EGFP as a scarless in-frame fusion at the N-terminus of the human NOLC1 gene. The EGFP template is transcribed in a reverse complement manner to minimize background expression in the absence of insertion with 50 nt homology arms. Fig. 45B is an immunohistochemical23SUBSTITUTE SHEET (RULE 26)analysis of STITCHR-mediated EGFP tagging of N0LC1, visualized by confocal microscopy, and compared to immunofluorescence staining of N0LC1. White scale bar denotes 10 pm. Fig. 45C is a graphical depiction of therapeutically relevant payload insertion by STITCHR with SpCcis9H840A -R2Toc into the endogenous AAVS1 locus, with sizes and identities of payload panel members shown and 100 nt homology arms. Integration is quantified by next generation sequencing and compared to SpCas9H840A . Fig. 45D is a graphical depiction of therapeutically relevant payload insertion by STITCHR with SpCas9H840A -R2Toc into the endogenous AAVS1 locus, compared to SpCas9H840A . Integration is profiled by nextgeneration sequencing as perfect insertions, insertions with indels, or WT locus indels.

[0091] . Fig. 46A is a graphical depiction of EGFP payload insertion (50 nt homology arms) by STITCHR with SpCas9H840A -R2Toc into the endogenous NOLC1 locus in cells treated with varying concentrations of aphidicolin. Integration is quantified by ddPCR and compared to SpCas9H840A . Fig. 46B is a graphical depiction of ^Cas- -mediated HDR editing of the EMX1 gene in cells treated with varying concentrations of aphidicolin. Genome editing is quantified by next generation sequencing. Fig. 46C is a graphical depiction of EGFP payload insertion efficiencies at endogenous NOLC1 locus by homology-directed repair (HDR), using SpCas9, at different concentrations of the cell cycle inhibitor aphidicolin or DMSO control.

[0092] . Fig. 47A is a graphical depiction of multiplexed gene integration by STITCHR with SpCas9H840A -R2Toc at NOLC1 and AAVS1 sites. EGFP payload insertion at NOLC1 is quantified by ddPCR, and Glue insertion at AAVS1 is quantified by next generation sequencing. Targeting conditions are compared to non-targeting guide controls. Fig. 47B is a graphical depiction of multiplexed gene integration by STITCHR with SpCas9H840A -R2Toc at NOLCl and AAVS1 sites, profiled by next generation sequencing. Total insertion for NOLC1 is quantified by ddPCR. Editing outcomes are quantified as perfect insertions, insertions with indels, and WT locus indels. N denotes NOLC1, whereas A denotes AAVS1.

[0093] . Fig. 48 is a schematic representation of STITCHR, enabling programmable and modular scarless gene insertion with site-specific non-LTR (nLTR) retrotransposons.

[0094] . Fig. 49 is a graphical representation of the results of an experiment in which an EGFP payload was inserted (50 nt homology arms) by STITCHR with SpCas9H840A-R2Toc into the endogenous NOLC1 locus, with a single fixed guide, compared to SpCas9H840A and24SUBSTITUTE SHEET (RULE 26)quantified by digital droplet PCR (ddPCR). Homology arms on the templates are separated by 0, 50, 100, or 150bp on the genome causing a deletion to occur followed by simultaneous insertion of the STITCHR EGFP payload. The payload arms are also shifted to match the locations of the single nicking guide and the desired end of the deletion to enable the deletion and subsequent insertion.

[0095] . Fig. 50A is a graphical representation of payload insertion (50 nt homology arms) by STITCHR with 5 iCas9H840A-R2 Toe into the endogenous NOLC1 locus, with dual guides N4 and N8, compared to S iCas9H840Aand quantified by next generation sequencing. The introduced edit is either a mismatch to the genome to demonstrate single base corrections or are small insertions as noted in the x-axis of the plot. Fig. SOB is a graphical representation of payload insertion (50 nt homology arms) by STITCHR with SpCas9H840A-R2Toc into the endogenous NOLC1 locus, with dual guides N4 and N8, compared to SpCas9H840A and quantified by next generation sequencing. The introduced edit is either a mismatch to the genome to demonstrate single base corrections or are small insertions as noted in the x-axis of the plot. Cargo is driven by either the U6 promoter or the CAG promoter, showing that the CAG promoter expression of the cargo results in slightly higher editing.

[0096] . Fig. 51 is a graphical representation of the results of an experiment in which EGFP payload was inserted (50 nt homology arms) by STITCHR with SpCas9H840A-R2Toc into the endogenous NOLC1 locus, with dual guides N4 and N8, compared to SpCas9H840A and quantified by digital droplet PCR (ddPCR). STITCHR insertion is also compared to SpCas9H840A and R2Toc being expressed separately (in trans).

[0097] . Fig. 52 is a heatmap chart representation of nLTR families with diverging target preferences, with counts of co-occurring divergent Rfam annotation target pairs.

[0098] . Fig. 53 are loci of nLTR system families with divergent target preferences as determined via Rfam analysis. Families are clustered by ORF identity.

[0099] . Fig. 54A is a schematic representation of the insertion by non-LTR retrotransposons at the natural 28S target site, depicting initial nicking and strand invasion, target-primed reverse transcription, first strand synthesis, nicking-initiated second strand synthesis, and insertion of a payload sequence into the genome. 28S homology, UTR sequences, and payload sequence are indicated. Fig. 54B is a schematic representation of25SUBSTITUTE SHEET (RULE 26)Gaussia luciferase (Glue) production via payload insertion of a synthetic Glue exon 2 by 12 selected non-LTR retrotransposons into a 28S plasmid reporter containing a synthetic Glue exon 1, normalized to a constitutive Cypridina luciferase (Clue) control. Fig. 54C is a schematic representation of Glue exon 2 payload insertion by R27g into a 28S plasmid reporter with payloads of different 5' or 3' UTR deletions and homology site permutations, profiled by next generation sequencing. Schematic shows the payload design used with UTRs, 5' 28S homology arms, 3' 28S homology arms, and the Glue exon 2 insert.

[0100] . Fig. 55A are gel electrophoresis images of the analysis of 5' and 3' insertion junctions at the 28S target reporter using payload designs with permuted UTR and homology positions after R2Tg integration. Payload numbers correspond to those in Fig. 54C. Fig. 55B is a schematic representation of the Glue exon 2 payload insertion by WT R2Tg, R2TgD1274A, or the RT domain deletion R2TgA(874-884)into a 28S plasmid reporter with payloads containing 28S or AAVS1 targeting homology arms, profiled by next generation sequencing. Fig. 55C is a graphical representation of the EGFP payload insertion at the NOLC1 target using R2Tg, R2TgD1274A, or R2TgRTmutand a payload containing the 5' UTR and 50 nt NOLC1 homology arms, quantified by next-generation sequencing.

[0101] . Fig. 56A is a schematic representation of the reprogramming of a R2Tg payload for insertion at a novel site with scarless insertion using SpCas9H840A. Fig. 56B is a graphical representation of the payload insertion by SpCas9H840A-R2Tg or SpCas9H840A-R2TgD1274Ainto the endogenous NOLC1 locus, mediated by dual guides or non-targeting guides and quantified by ddPCR.

[0102] . Fig. 57 is a schematic representation of the EGFP payload insertion, with variations on 5' and 3' UTR sequence by SpCas9H840A-R2Tg at the endogenous NOLC1 locus, using dual guides. Integration is quantified by ddPCR. Schematic of payload variations used with the payload, homology arms, 5' and 3' UTRs are illustrated.

[0103] . Fig. 58A is a graphical representation of the EGFP payload insertion by SpCas9H840A-R2Tg (WT), SpCas9H840A- R2TgF875A / A876L / D877A / D878A / L879A / V880A / L881A(RTmut), and SpCas9H840A-R2TgA(874'884)(A(874-884)), and SpCas9H840Aat the endogenous NOLC1 target site with dual guides. Fig. 58B is a schematic representation of AAVS1 insertion with optimized payloads containing the cognate 5' UTR corresponding to each non-LTR retrotransposon ortholog being evaluated. Glue payload insertion into the endogenous AAVS126SUBSTITUTE SHEET (RULE 26)locus by selected non-LTR retrotransposons fused to SpCas9H840A, with either targeting or nontargeting (NT) guides, is quantified by next generation sequencing. The heatmaps correspond to Glue integration efficiency (top) and the associated indels generated at the AAVS1 locus (bottom).

[0104] . Fig. 59A is a schematic representation of the EGFP payload insertion (50 nt homology arms) by STITCHR with SpCas9H840A-R2Toc into the endogenous AAVS1, LMNB1, EMX1, and NOLC1 loci, with combinations of single and dual guides, compared to SpCas9H840A-R2TocRTmut and wild-type SpCas9. The left heatmap shows integration rate of the EGFP payload, whereas the right heatmap corresponds to indels detected at the corresponding loci. Fig. 59B is a schematic representation of different STITCHR edits evaluated ranging from single-base variants, small insertions, and large insertions. Fig. 59C is a graphical representation of the evaluation of different sized edits using STITCHR at the NOLC1 locus using either SpCas9H840A-R2Toc or SpCas9H840A.

[0105] . Fig. 60A is a schematic representation of STITCHR-replace methodology involving replacement of a region of the genome while inserting the STITCHR payload. Fig. 60B is a graphical representation of the evaluation of STITCHR-replace at the NOLC1 locus using a single guide and homology arms spaced 50-150 bp apart on the genome.

[0106] . Fig. 61 is a schematic representation of the natural reprogramming of RLE- containing non-LTR retrotransposons, incorporating flexible internal priming and UTR deletions that might occur during the process.

[0107] . Fig. 62A is a graphical representation of the distribution of distances from candidate retrotransposons to detected Rfam annotation or tandem repeat targets for each of the 9 families of RLE containing non-LTR retrotransposons. Fig. 62B is a graphical representation of the distribution of the predicted 5' and 3' UTR sizes for all non-LTR RLE-containing retrotransposons. UTR sizes are predicted based on the distance from the ORF and nearest predicted target site. Box plots are shown with the median, 25th percentile, 75th percentile, and whiskers that are 1.5x the interquartile range. All outliers are shown as individual points. Fig. 62C is a graphical representation of the distribution of the lengths of observed non-coding conservation regions flanking the 5' and 3' ends of the retrotransposon ORF. Box plots are shown with the median, 25th percentile, 75th percentile, and whiskers that are 1.5x the interquartile range. All outliers are shown as individual points.27SUBSTITUTE SHEET (RULE 26)

[0108] . Fig. 63 is the phylogenetic tree representation of 9 families of RLE-containing nLTR systems showing majority of detected Rfam targets in the vicinity of the nLTR ORF.

[0109] . Fig. 64A-E are the DNA sequence alignments of nLTR families with divergent target preferences in the noncoding areas surrounding the nLTR ORFs. Identified Rfam annotations in the surrounding locus are highlighted.

[0110] . Fig. 65A is the graphical representation of the Glue payload insertion by R27 reverse transcriptase domain deletions, RLE inactivation mutants (R1274A) and reverse transcriptase mutationsRTmut), at the 28 S locus luciferase reporter, as quantified by luciferase. Fig. 65B is the graphical representation of the Glue payload insertion by R27 reverse transcriptase domain mutations, includinginactivation mutants (R1274A), at the 28 S locus luciferase reporter, as quantified by luciferase.

[0111] . Fig. 66A is a schematic representation of the secondary structure analysis of the 5' UTR of R2Tg, including the full length, 15 nt truncated variant, and the 15 nt truncated variant with the 50 nt 28S homology sequence upstream. Figure discloses SEQ ID NOS 33574-33576, respectively, in order of appearance. Fig. 66B is a graphical representation of the validation of the 3-primer NGS assay for analysis of AAVS1 integration via the left insertion junction. Standards consist of edited and WT amplicons that are mixed in the listed ratios (xaxis) and the measured editing is determined by the 3-primer NGS assay (y-axis). Fig. 66C is the schematic and graphical representation of the Glue integration at the endogenous AAVS1 locus via the SpCas9H840A-R2Tg fusion using payloads with the full length or 15-nt truncated 5' UTR, an upstream 28S 50 nt sequence, and internal AAVS1 homology arms. Integration is quantified by next-generation sequencing.

[0112] . Fig. 67A is a schematic representation of SpCas9H840Afused to N- and C- terminal truncations of R2Tg at different amino acid positions. Not all tested constructs are shown. Fig. 67B is a graphical representation of the Glue payload insertion by different SpCas9H840A-R2Tg fusions, according to the schematic in Fig. 67A, into the endogenousAAVS1 locus quantified by next generation sequencing. Fig. 67C is a graphical representation of the Glue integration at the endogenous AAVS1 target by SpCas9H840A-R2Tg, SpCas9H840A-R2Tg F875A / A876L / D877A / D878A / L879A / V880A / L881 A , and SpCas9 H840A ■R2Tg A(874-884) and SpCas9H840Aalone.28SUBSTITUTE SHEET (RULE 26)

[0113] . Fig. 68 is a schematic representation of the Glue payload insertion into the endogenous AAVS1 locus by selected non-LTR retrotransposons fused to SpCas9H840A, with either targeting or nontargeting guides, profded by next generation sequencing. Editing outcomes are quantified as perfect insertions, insertions with indels, and indels at the unmodified WT target site.

[0114] . Fig. 69A is a graphical representation of the Glue payload insertion by STITCHR with SpCas9H840A-R2Toc into the endogenous AAVS1 locus, with combinations of single and dual guides, compared to a non-targeting guide control and quantified by next generation sequencing. Fig. 69B is a graphical representation of the EGFP payload insertion by STITCHR with SpCas9H840A-R2Toc into the endogenous LMNB1 locus, with combinations of single and dual guides, compared to a non-targeting guide control and SpCas9H840Aalone. Editing was quantified by digital droplet PCR (ddPCR). Fig. 69C is a graphical representation of the EGFP payload insertion by STITCHR with SpCas9H840A-R2Toc into the endogenous EMX1 locus, with combinations of single and dual guides, compared to a non-targeting guide control and SpCas9H840Aalone. Editing was quantified by digital droplet PCR (ddPCR).

[0115] . Fig. 70A is a graphical representation of the Glue payload insertion bySpCas9H840A-R2Toc (WT), SpCas9H840AR2TocF811A’A812L’D813A’D814A’L815A’V816A’L817A,SpCas9H840A-R2TocA(811'814), SpCas9H840A-R2TocA(810'820), and SpCas9H840Aat the endogenousAAVS1 target site. Editing is quantified by next generation sequencing. Fig. 70B is a graphical representation of the EGFP payload insertion by SpCas9H840A-R2Toc (WT),SpCas9H84°AR2T0CF811A’A812L’D813A. D814A, L815A, V816A, L817A SpCas9H840A-R2TocA(875'878),SpCas9H840A-R2TocA(874'884), and SpCas9H840Aat the endogenous NOLC1 target site. Editing is quantified by ddPCR. Fig. 70C is a graphical representation of the GFP payload insertion by SpCas9H840A-R2Toc (WT), SpCas9H840A-R2TocD1210A, and SpCas9H840Aat the endogenousNOLC1 target site. Editing is quantified by ddPCR.

[0116] . Fig. 71A is a graphical representation of the GFP payload insertion by STITCHR with SpCas9H840A-R2Toc into the endogenous NOLC1 locus in HepG2 cells, compared to SpCas9H840A. Editing is quantified by ddPCR. Fig. 71B is a graphical representation of STITCHR EGFP payload insertion at endogenous EMX1, NOLC1 and two AAVS1 loci in Huh-7 cells by SpCas9H840A-R2Toc compared to SpCas9H840A- R2TocRTmut. Insertion is quantified by ddPCR. Fig. 71C is a graphical representation of STITCHR EGFP payload insertion at endogenous EMX1 and NOLC1 loci in HepG2 cells by29SUBSTITUTE SHEET (RULE 26)SpCas9H840A-R2Toc compared to SpCas9H840A-R2TocRTmut. Insertion is quantified by ddPCR.

[0117] . Fig. 72 is a graphical representation of the installation of small edits and insertions using STITCHR at the NOLC1 locus, using a U6 promoter for payload expression.

[0118] . Fig. 73 are sequencing reads of the EGFP insertion site at NOLC1 for STITCHR replace, showing the desired 50-150 bp deletions. Figure discloses SEQ ID NOS 33577-33578, 33577, 33577, 33577, 33579, 33579, 33579, 33579-33580, 33580, 33580, 33580-33581, 33581, 33581, and 33581, respectively, in order of appearance.

[0119] . Fig. 74A is a graphical representation of the EGFP payload insertion (50 nt homology arms) by STITCHR with SpCas9H840A-R2Toc into the endogenous AAVS1 locus in cells treated with cell cycling inhibitor Mirin or double thymidine. Integration is quantified by next-generation sequencing and compared to SpCas9H840A. Fig. 74B is a graphical representation of the SpCas9-mediated HDR editing of the EMX1 gene in cells treated with cell cycling inhibitor Mirin or double thymidine. Genome editing is quantified by next generation sequencing.

[0120] . Fig. 75 is a graphical representation of 10 orthologs sampled from various nLTR families (1,4, 5, 6, 7, 9) compared to R2Toc for programmed insertion at the AAVS1 locus. Orthologs were synthesized with mammalian codon optimization, and putative 5' and 3' UTR regions were cloned surrounding a luciferase payload. Protein and payload constructs were transfected along with a SpCas9 plasmid and guide plasmid into HEK293FT cells, and 3 days later cells were harvested and efficiency of insertion were quantified by next generation sequencing.

[0121] . Fig. 76A-C are tables showing plasmid vectors for genome editing.

[0122] . Fig. 77 is a heatmap of 28S luciferase reporter assay, testing integration by R2Bm, R2Tg, R2Mes and R2TgRTmut (x axis) using RNA payloads containing UTRs from different retrotransposon ortholog systems (y axis).

[0123] . Fig. 78A is a depiction of long-read sequencing of EGFP payload insertion by SpCas9H840A-R2Toc at the endogenous NOLC1 locus. Shown is read alignments to scarless EGFP insertion at NOLCl. Fig. 78B Circos plots depicting genome-wide insertion sites of30SUBSTITUTE SHEET (RULE 26)payloads by SpCas9H840A-R2Toc using sgRNAs and payload homologies to b) AAVS1 (chrl9) and c) N0LC1 (chrlO). Counts are defined as the number of mapped reads occurring within a 5kb window.

[0124] . Fig. 79A-B are bar graphs and western blots examining the insertion of Glue payload with (A) or without (B) UTRs into 28S DNA target + / -payload RNA, + / - 28S DNA, + / - R2 protein, + / - Mg2+ and + / - dNTPs, as indicated. Above, NGS quantitation of insertion efficiency and schematic of the used RNA payloads. Arrows on the gels indicate the specific TPRT products.

[0125] . Fig. 80A is a bar graph depicting the results of a biochemical assay assessing TPRT by R2Tg into 28 S DNA using RNA payloads with 100 bp, 60 bp, 30 bp and 0 bp 28 S homology and no RNA payload control. Insertion frequency is quantified by NGS. Fig. 80B is an image of a western blot depicting the results of a Biochemical assay assessing TPRT by R2Tg into 28S DNA using RNA payloads with or without 5' cap and / or 3' poly-A tail modifications as well as no RNA payload control. Fig. 80C is a bar graph depicting the NGS insertion quantification of TPRT shown in 80B.

[0126] . Fig. 81A is an image of a western blot result of a biochemical assay assessing TPRT by R27 into 28S DNA with decreasing concentrations of protein using the 28S RNA payload with full UTRs and 100 bp homology. Concentrations tested were (left to right): 500nM, 166nM, 55nM, 19nM, 6nM and OnM. Fig. 81B is an image of a western blot assessing the timecourse of biochemical TPRT by R27 into 28 S DNA with or without RNA payloads with different incubation times, as indicated. Fig. 81C is a bar graph depicting the NGS insertion quantification of TPRT shown in Fig. 81B.

[0127] . Fig. 82A depicts the R27g retrotransposition of synthetic RNA payload into top- and bottom-strand labeled 28S DNA (top is Cy5 labeled, red, and bottom is FAM labeled, green), + / - payload RNA, + / - dNTPs and + / - R2 protein, as indicated. Schematics on the side of the gel indicate the expected identify of each band, including the TPRT product. Fig. 82B is a bar graph and western blot depicting the results of an assay assessing biochemical insertion of the Glue RNA payload into 28S DNA by wild type R27 , RT inactivated, and RLE inactivated proteins and a 1:1 mixture of RT and RLE mutant proteins. Above, NGS quantification of insertion efficiency and a schematic of the RNA payload used. Mutants tested were D1274A (RLE inactivation) and A(875-878) (RT domain inactivation). Arrow on the gel31SUBSTITUTE SHEET (RULE 26)indicates the specific TPRT product. Fig. 82C is an immunoblot depicting the results of a Primer extension assay by WT R27 , RLE inactivated R2TgD1274A, and no protein, where 28S RNA payload and complementary primer were hybridized and extended by reverse transcription activity of the R27 protein.

[0128] . Fig. 83A is an immunoblot depicting a size analysis by gel electrophoresis of 5' and 3' insertion junctions at the 28S target reporter for payload designs from Fig. 38C-D after R2Tg integration. Fig. 83B depicts the integration percentage of Glue exon 2 payload insertion by WT R2Tg, R2TgD1274A, or the RT domain deletion R2TgA(874-884) into a 28S plasmid reporter with payloads containing 28 S or AAVS1 targeting homology arms, profiled by next generation sequencing.

[0129] . Fig. 84A depicts the results of a biochemical primer extension assay, using IVT -transcribed RNA payloads for NOLC1 or 28S sequences and a primer complementary to the 28S and NOLC1 sequences (U) or to the NOLC1 sequence only (N). Arrow on the gel indicates the specific TPRT product. Fig. 84B depicts the results of an assay assessing biochemical retrotransposition of an RNA payload into the NOLC1 DNA target + / - Cas9- assisted nicking and with withdrawal of R2Tg protein, RNA, dNTPs, DNA target, or MgC12, as indicated. Labels on the gel indicate the specific TPRT product, DNA target band, Cas9 produced nicked fragments, and R2Tg produced nicked fragments. Unless otherwise specified, paired NOLC1 guides 4 and 8 are used, si, single NOLC1 guide 4. s2, single NOLC1 guide 8. Fig. 84C depicts the editing percentage as determined by NGS quantification of insertion data shown in Fig. 84B

[0130] . Fig. 85 is a bar graph depicting the integration percentage of an EGFP payload insertion at human endogenous NOLC1 locus by natural reprogrammed wild-type R2Tg as well as R2TgD1274A and R2TgRTmut.

[0131] . Fig. 86A is an image depicting the reprogrammed biochemical retrotransposition of an IVT -transcribed RNA payload containing the optimized 5' and 3' UTR and homology regions into the AAVS1 DNA target by R2Tg + / - DNA target, + / - RNA, + / - Cas9-assisted nicking, and + / - R2Tg, as indicated. Black arrow on the gel indicates the specific TPRT product. The blue arrow denotes the cleaved DNA band generated by R2Tg protein alone reprogrammed by its payload RNA. Fig. 86B is a bar graph depicting the NGS quantification of insertion data shown in Fig. 86A. Fig. 86C is an image depicting the32SUBSTITUTE SHEET (RULE 26)reprogrammed biochemical retrotransposition by R2Tg into the N0LC1 DNA target, using a homologous IVT -transcribed NOLC1 payload (N) with + / - 5' cap and 3' tail modifications compared to EMX1 (E)- or 28-homologous (28S) payloads (i.e. non-homologous to N0LC1). Integration is quantified by NGS.

[0132] . Fig. 87A is a bar graph depicting the integration efficiencies, quantified by NGS, of reprogrammed biochemical TPRT of an RNA payload by R2Tg into varying amounts of NOLC1 DNA target compared to no RNA controls. Fig. 87B is a bar graph depicting the integration efficiencies, quantified by NGS, of reprogrammed biochemical TPRT by R2Tg using NOLC1 RNA payloads incorporating either different single-base mismatches or insertions into the NOLC1 DNA, as indicated. Either in vitro transcribed mRNA or synthetic RNA templates were used as the payloads.

[0133] . Fig. 88A is a bar graph depicting the payload retrotransposition into the human endogenous NOLC1 genomic locus by SpCas9H840A-R2Tg fusion, SpCas9H840A only, SpCas9H840A-R2TgRTmut, SpCas9H840A-R2TgD1274A, and complementing SpCas9H840A-R2TgD1274A + SpCas9H840A-R2TgRTmut. Integration is quantified by NGS. Inset shows payload design and locus schematic with homology arms colored and top guide in red and bottom guide in blue. Fig. 88B is a bar graph depicting Glue integration at the endogenous AAVS1 target by SpCas9H840A-R2Tg, SpCas9H840A- R2TgF875A / A876L / D877A / D878A / L879A / V880A / L881A(RTmut), and SpCas9H840A- R2TgA(874-884), and SpCas9H840A alone. Fig. 88C is a bar graph depicting TPRT activity in HEK293FT cells with SpCas9H840A alone or fused to R2Tg, R2TgF875A / A876L / D877A / D878A / L879A / V880A / L881A (RTmut), or R2TgA874-884 into the NOLC1 genomic target with dual guides. EGFP payload contains the full 5' and 3' UTRs forR2Tg.

[0134] . Fig. 89A and Fig. 89B are bar graphs depicting TPRT activity in HEK293FT cells by R2Tg into the NOLC (Fig. 89A) and AAVS1 (Fig. 89B) genomic targets, with in trans complementation of R2TgRLEmut and R2TgRTmut, quantified by NGS.

[0135] . Fig. 90A is a pair of images depicting the results of an assay in which EGFP payload insertion by wild type and domain inactivated mutants of R2Tg at the endogenous human 28S locus in HEK293FT cells was assessed, analyzed at 5' and 3' junctions via gel electrophoresis. Mutants tested were RLE inactivated, RT domain inactivated, and ZF2 domain33SUBSTITUTE SHEET (RULE 26)inactivated (replacement of residues 262-275 with NCp7 ZF FNCGKEGHTARN37). Payload was expressed from a plasmid template. Fig. 90B is a bar graph depicting the results of Glue payload insertion by R2Tg reverse transcriptase domain deletions, RLE inactivation mutants (R1274A), and reverse transcriptase mutations (R2TgF875A / A876L / D877A / D878A / L879A / V880A / L881A, RTmut), at the 28S locus luciferase reporter target, as quantified by luciferase activity. Luciferase activity was assayed in HEK293FT cells. Fig. 90C is a bar graph depicting the results of Glue payload insertion by R2Tg RT domain mutations, including R2TgF875A / A876L / D877A / D878A / L879A / V880A / L881A (RTmut), R2TgD877R, D878R, and R2TgD877H, D878H, and the RLE inactivation mutant (R1274A) at the 28S locus luciferase reporter, as quantified by luciferase. Luciferase activity was assayed in HEK293FT cells.

[0136] . Fig. 91A depicts a pair of images assessing payload insertion into a 28S integration site. Above, RNA payload insertion into a 28S plasmid reporter by wild type R2Tg, RLE inactivated, RT inactivated, and complemented RT and RLE inactivated proteins + / - RNA payload, as indicated. RNA templates used were IVT transcribed with a 5' cap and a poly A tail. Expected band size = 260 bp. NT, non-targeting RNA templates that have homology to the NOLC1 target instead of the 28S locus. Below, R2Tg insertion into human 28S endogenous locus with payloads containing 100, 50, 30 or 0 homology to the 28 S target site. RNA templates used were IVT transcribed with a 5' cap and a poly A tail. Expected band size = 374 bp. Fig. 91B is a bar graph depicting the results of a Luciferase assay of Glue insertion of an IVT -transcribed RNA payload with variable 3' tail length into a 28S reporter target by WT R2Tg and RLE-inactivated R2TgD1274A. Luciferase activity was assayed in Huh-7 cells.

[0137] . Fig. 92A is a bar graph and image depicting the results of a biochemical assay editing percentage in an AAVS1 site. Top: Biochemical retrotransposition of an RNA payload into AAVS1 DNA by R2Toc with and without SpCas9H840A-assisted nicking, + / - RNA payload, + / - DNA target, + / - R2Toc protein, as indicated. Bottom, NGS quantification of R2Toc insertion. Black arrow on the gel indicates the specific TPRT product. The blue arrow denotes the cleaved DNA band generated by the R2Toc protein alone reprogrammed by its payload RNA. Fig. 92B is a bar graph depicting STITCHR payload insertions at human endogenous genomic NOLC1 loci by SpCas9H840A-R2Toc, SpCas9H840A only, SpCas9H840A-R2TocRTmut, R2TocRTmut alone, SpCas9-R2TocRTmut and complemented34SUBSTITUTE SHEET (RULE 26)R2TocRTmut + SpCas9-R2TocRLEmut. Integration is quantified by ddPCR. Inset shows payload design and locus schematic with homology arms colored and top guide in red and bottom guide in blue. Fig. 92C is a bar graph depicting STITCHR payload insertions at human endogenous genomic AAVS1 loci by SpCas9H840A-R2Toc, SpCas9H840A only, SpCas9H840A-R2TocRTmut, R2TocRTmut alone, SpCas9-R2TocRTmut and complemented R2TocRTmut + SpCas9-R2TocRLEmut. Integration is quantified by NGS. Inset shows payload design and locus schematic with homology arms colored and bottom guide in blue. Fig. 92D_is a bar graph depicting protein expression of wild type and mutant versions of different R2Tg orthologs (indicated on x-axis), quantified by luciferase signal.

[0138] . Fig. 93A is a bar graph depicting STITCHR 20 bp payload insertion on a luciferase reporter plasmid from a synthetic RNA lacking the 5' UTR and containing a Cas9 guide scaffold. Integration is quantified by NGS. Fig. 93B is a bar graph depicting Glue reconstitution by correction of a 20 bp deletion by delivery of plasmid or synthetic RNA payloads, quantified by Glue expression normalized to control Clue expression. The synthetic RNA template is an extension of the Cas9 sgRNA. Fig. 93C-D are bar graphs depicting Glue reconstitution by R2Tg mutants with synthetic RNA payloads extended off the guide RNA as quantified by NGS (Fig. 93C) and Glue (Fig. 93D) expression normalized to control Clue.

[0139] . Fig. 94A is a bar graph depicting STITCHR 38 bp payload insertion at the endogenous LMNB1 locus from a synthetic RNA lacking the 5' UTR and containing a Cas9 guide scaffold. Integration is quantified by NGS. Fig. 94B is a bar graph depicting STITCHR 700 bp EGFP payload insertion at the endogenous NOLC1 locus from an in vitro transcribed mRNA containing a full 5' and 3' UTR and either with or without a 5' cap or polyA tailing. Integration is quantified by NGS. Inset shows payload design and locus schematic with homology arms colored and top guide in red and bottom guide in blue. Fig. 94C is a bar graph depicting STITCHR 700 bp EGFP payload insertion in the Huh-7 hepatocellular carcinoma line at the endogenous NOLC1 locus from an in vitro transcribed mRNA containing either a truncated R2Tg 5' UTR (s) or full R2Tg 5' and 3' UTRs. Insertion is tested with either SpCas9H840A-R2Tg or SpCas9H840A-R2TgRTmut. Integration is quantified by NGS. Inset shows payload design and locus schematic with homology arms colored and top guide in red and bottom guide in blue. Fig. 94D is a bar graph depicting insertion of a GFP payload delivered as an IVT-transcribed mRNA with UTRs and other variable modifications, as35SUBSTITUTE SHEET (RULE 26)indicated, into the human endogenous N0LC1 locus by SpCas9H840A-R2Toc in HEK293FT cells.

[0140] . Fig. 95A is an image depicting the result of a PCR junctional analysis of STITCHR 700 EGFP bp payload insertion at the endogenous NOLC1 locus from an in vitro transcribed mRNA containing either or truncated 5' UTR (s) or a full 5' and 3' UTR (f).Insertion is tested with either SpCas9H840A-R2Toc or SpCas9H840A-R2TocRTmut. Fig. 95B is a bar graph depicting STITCHR 700 bp EGFP payload insertion in the Huh-7 hepatocellular carcinoma line at the endogenous NOLC1 locus from an in vitro transcribed mRNA containing either a truncated R2Tg 5' UTR (s) or full R2Tg 5' and 3' UTRs. Insertion is tested with either SpCas9H840A-R2Tg or SpCas9H840A-R2TgRTmut. Integration is quantified by NGS. Inset shows payload design and locus schematic with homology arms colored and top guide in red and bottom guide in blue. Fig. 95C is a bar graph depicting the results of an assay assessing SpCas9H840A-R2Toc integration of an RNA payload containing an intron at the human endogenous NOLC1 locus. Shown is NGS quantification of the spliced insertion (i.e., without intron).

[0141] . Fig. 96A is a diagram depicting guide positions of Fig. 59A, depicted as loci schematics indicating the top (red) or bottom (blue) SpCas9 guide positions relative to the colored homology region for each gene. Fig. 96B is a bar graph depicting the results of EGFP payload insertion by STITCHR with SpCas9H840A-R2Toc into the endogenous AAVS1 locus, with combinations of single and dual guides, compared to SpCas9H840A alone, SpCas9H840A-R2TocRTmut, and SpCas9. Insertion is quantified by ddPCR.

[0142] . Fig. 97A is a bar graph depicting the results of EGFP payload insertion at endogenous NOLC1 by STITCHR, delivered by adenovirus to HEK293FT cells at different viral amounts. Shown is a comparison of insertion efficiency when delivering STITCHR machinery with one vector and guides and template with the other, compared to delivery of guides and template only as a control. Fig. 97B is a bar graph depicting the results of EGFP payload insertion by SpCas9H840A-R2Toc atNOLCl target in quiescent primary human hepatocyte cells compared to SpCas9H840A control. Total viral amount used was 1 ,4el 1 viral copies in the dual vector condition and half of that for the single vector pay load only condition. Fig. 97C is a bar graph depicting the results of EGFP payload insertion by STITCHR at the NOLC1 endogenous locus in HEK293FT cells, comparing editing efficiencies with two insertion designs: one that removes the endogenous PAM sequence and one that maintains it.36SUBSTITUTE SHEET (RULE 26)Fig. 97D is a bar graph depicting the results of STITCHR insertion of EGFP payload at the endogenous N0LC1 locus by SpCas9H840A-R2Toc compared to SpCas9D10A-R2Toc.

[0143] . Fig. 98A is an image showing the results from the retargeting of R2 substrate nicking via reprogramming of homology arms independent of Cas9 toward a AAVS1 target. Fig. 98B is a schematic representation of the profiling with next-generation sequencing of adaptors ligated to free DNA ends. Fig. 98C is a graph that shows that no appreciable cleavage could be observed with the majority reads corresponding to the 5' or 3' ends of the uncleaved target.

[0144] . Fig. 99A is an image showing the results from the reprogramming of R2Tg towards a NOLC1 target. Fig. 99B is a graph showing the cleavage sites when using R2Tg combined with RNA. Fig. 99C is a graph showing the cleavage sites when using R2Tg not combined with RNA.DETAILED DESCRIPTION

[0145] . The present disclosure is directed to site specific non-Long Terminal Repeat (LTR) retrotransposons and systems incorporating these non-LTR retrotransposons for inserting large nucleic acids at targeted locations within a genome. The present disclosure is also directed to site-specific non-LTR retrotransposons and related systems for performing small nucleotide changes in a genome. In some embodiments, a small nucleotide change comprises a point mutation. In some embodiments, a small nucleotide change comprises a small nucleotide insertion.

[0146] . The present disclosure is also directed to modified R2 fusion proteins for inserting large nucleic acids at targeted locations within a genome. The present disclosure is also directed to Cas9 fusion proteins for inserting large nucleic acids at targeted locations within a genome, which includes Cas9-R2 fusion proteins. In some embodiments, the genome is a human genome.

[0147] . The present disclosure is also directed to the insertion of exogenous R2 landing sites within a genome, such that a R2 protein, modified R2 protein, or R2 fusion protein that may target a non -28 S locus for insertion of a large genetic element. In some embodiments, the R2 fusion protein is an R2-Cas9 fusion protein. In some embodiments, the R2 fusion protein is a Casl2-R2 fusion protein. In some embodiments, the R2 fusion protein is a TALEN-R2 fusion protein.37SUBSTITUTE SHEET (RULE 26)Definitions

[0148] . Unless stated otherwise, terms and techniques used within this application have the meaning generally known to one of skill in the art.

[0149] . The term “about” as used herein is understood to modify the specified value. Unless explicitly stated otherwise, the term about is understood to modify the specified values + / - 10%. As used herein, the term about applied to a range modifies both endpoints of the range. By way of example, a range of “about 5 to 10” is understood to mean “about 5 to about 10.”

[0150] . Unless explicitly stated otherwise, the term “payload” as used herein means at least a nucleic acid that may be integrated into a host genome. Thus, “payload RNA” will be understood to comprise an RNA molecule comprising at least an insertion region, wherein the insertion region can be integrated into a host genome.

[0151] . As used herein, “cell-specific,” or “cell-type specific,” would be understood by one of skill in the art to mean occurring or being expressed at a higher frequency or existing at an increased level in one cell type in contrast to other cell types.

[0152] . As used herein, the terms “target site” and “landing site” are used interchangeably unless specified otherwise.

[0153] . Unless explicitly stated otherwise, the term “nucleic acid” is understood to refer to both ribonucleic acid (RNA) and deoxyribonucleic acid (DNA) molecules. This may include chemically synthesized nucleic acid molecules, single stranded or double stranded nucleic acid molecules, linearized nucleic acid molecules, circularized nucleic acid molecules, chemically modified nucleic acid molecules, and nucleic acids with biochemical modifications.RLE Domain Containing non-LTR Retrotransposon Families

[0154] . In addition to canonical single-ORF RLE domain containing non-LTR retrotransposons, such as R2, R4, R5, R8, R9, Dong, and Cre families, retrotransposons for use in or as part of the genome editing system described herein may also be characterized as part of a larger phylogenetic family. The retrotransposons in these larger phylogenetic families contemplated for use in or as a part of the genome editing systems described herein include the 8,248 RLE-domain containing retrotransposon uncovered as part of the computational analysis described in Example 7. These 8,248 retrotransposon-like orthologs are divided into 9 families,38SUBSTITUTE SHEET (RULE 26)termed RLED1-RLED9. In some embodiments, the non-LTR retrotransposon is a member of the RLED1 family. In some embodiments, the non-LTR retrotransposon is a member of the RLED2 family. In some embodiments, the non-LTR retrotransposon is a member of the RLED3 family. In some embodiments, the non-LTR retrotransposon is a member of the RLED4 family. In some embodiments, the non-LTR retrotransposon is a member of the RLED5 family. In some embodiments, the non-LTR retrotransposon is a member of the RLED6 family. In some embodiments, the non-LTR retrotransposon is a member of the RLED7 family. In some embodiments, the non-LTR retrotransposon is a member of the RLED8 family. In some embodiments, the non-LTR retrotransposon is a member of the RLED9 family. In some embodiments, the non-LTR retrotransposon is a member of the R1 family. In some embodiments, the non-LTR retrotransposon is a member of the R2 family. In some embodiments, the non-LTR retrotransposon is a member of the R4 family. In some embodiments, the non-LTR retrotransposon is a member of the R5 family. In some embodiments, the non-LTR retrotransposon is a member of the R6 family. In some embodiments, the non-LTR retrotransposon is a member of the R7 family. In some embodiments, the non-LTR retrotransposon is a member of the R8 family. In some embodiments, the non-LTR retrotransposon is a member of the R9 family. In some embodiments, the non-LTR retrotransposon is a member of the Cre family. In some embodiments, the non-LTR retrotransposon is a member of the NeSL family. In some embodiments, the non-LTR retrotransposon is a member of the HERO family. In some embodiments, the non-LTR retrotransposon is a member of the Utopia family.R2 Element Enzymes

[0155] . Without limiting the instant disclosure to any one particular theory, R2 retrotransposons are thought to work via a mechanism known as target-primed reverse transcription, or “TPRT.” TPRT is a mechanism by which an endonuclease creates a nick in a first DNA strand at a specific location, creating a “primed” 3’ hydroxyl end for reverse transcription. After the initial DNA nick, an mRNA molecule is reverse transcribed by the reverse transcriptase.

[0156] . In some embodiments, the R2 element enzyme is modified. In some embodiments, the R2 element enzyme is modified by an N-terminal truncation of the R2 element enzyme sequence, a C-terminal truncation of the R2 element enzyme sequence, or both an N-terminal and a C-terminal truncation of the R2 element enzyme sequence.39SUBSTITUTE SHEET (RULE 26)

[0157] . In some embodiments, the R2 element enzyme is a fusion protein. In some embodiments, the R2 element enzyme comprises a fusion of an R2 protein with a Cas9 protein. In some embodiments, the R2 element enzyme comprises a fusion of an R2 protein with a Casl2 protein. In some embodiments, the R2 element enzyme comprises a fusion of an R2 protein with a Cas9 protein, wherein the Cas9 portion and the R2 protein portion are connected by a linker. In some embodiments, the R2 element enzyme comprises a fusion of an R2 protein with a Casl2 protein, wherein the Cast 2 portion and the R2 protein portion are connected by a linker.Protein Binding Elements

[0158] . Protein binding elements of the disclosure can come in a multitude of forms. In one embodiment, a protein binding element may be an endogenous nucleic acid sequence. In one embodiment, a protein binding element may be an exogenous or introduced nucleic acid sequence. In one embodiment, the protein binding element may be a synthesized nucleic acid sequence.Guide Elements

[0159] . In some embodiments the genome editing system comprises a guide RNA. In some embodiments, the genome editing system comprises multiple guide RNAs. In some embodiments, the genome editing system comprises paired guide RNAs.Genomic Insertion Sites and Targets

[0160] . The R2 element naturally targets the 28S rRNA locus. The instant disclosure contemplates the insertion of payloads into either the 28 S rRNA locus or into other genomic loci. In some embodiments, the insertion site is a targeted genomic insertion site. In some embodiments, the insertion site is targeted by a targeting domain in a fusion protein. In some embodiments, the insertion site has been exogenously introduced to the genome. In some embodiments, the insertion site has been exogenously introduced by a site-directed genome editing system that is not capable of delivering large genetic insertions. In some embodiments, the targeted genomic site is targeted for a point mutation. In some embodiments, the targeted genomic site is targeted for a small nucleotide insertion.

[0161] . The instant disclosure also contemplates additional non-LTR site-specific retrotransposons for use in or as part of the genome editing system described herein that do not target the 28S rRNA locus. In some embodiments, the genome is targeted for a large genetic40SUBSTITUTE SHEET (RULE 26)insertion. In some embodiments, the insertion site is a targeted genomic insertion site. In some embodiments, the insertion site is targeted by a targeting domain in a fusion protein. In some embodiments, the insertion site has been exogenously introduced to the genome. In some embodiments, the insertion site has been exogenously introduced by a site-directed genome editing system that is not capable of delivering large genetic insertions. In some embodiments, the targeted genomic site is targeted for a point mutation. In some embodiments, the targeted genomic site is targeted for a small nucleotide insertion.Payloads

[0162] . Payloads of the instant disclosure may encode proteins, such as enzymes. In some embodiments, the payload may act as a regulatory element. Thus, if an embodiment of the disclosure states, by way of example, that “the payload comprises a therapeutic protein,” it is generally understood that the payload comprises a template that, upon insertion, will lead to expression of a therapeutic protein encoded by the template. Exemplary vectors for expression are shown in Fig. 76.

[0163] . In some embodiments, the insertion region comprises a template for a reporter gene. In some embodiments, the reporter gene encodes a fluorescent protein. In some embodiments, the reporter gene encodes a green fluorescent protein. In some embodiments, the reporter gene encodes eGFP.

[0164] . In some embodiments, the insertion region comprises a template for a transcription factor gene.

[0165] . In some embodiments, the insertion region comprises a template for a transgene.

[0166] . In some embodiments, the insertion region comprises a template for an enzyme gene, or a therapeutic gene. In some embodiments, the therapeutic protein can be used in conjunction with another therapeutic.

[0167] . In some embodiments, the payload comprises a protein that is capable of converting one cell type to another.

[0168] . In some embodiments, the payload comprises a protein that is capable of killing a specific cell type. In some embodiments, the payload comprises a protein that is capable of41SUBSTITUTE SHEET (RULE 26)killing a tumor cell. In some embodiments, the payload comprises an immune modulating protein.

[0169] . In some embodiments, the payload comprises a 5’UTR. In some embodiments, the payload comprises a 3’UTR. In some embodiments, the payload comprises a 5’UTR and a 3’ UTR. In some embodiments, the payload consists of a 5’UTR. In some embodiments, the payload consists of a 3’UTR. In some embodiments, the payload comprises a 5’UTR and a 5’ homology region. In some embodiments, the payload comprises a 3’UTR and a 3’ homology region. In some embodiments, the payload comprises a 5’UTR, a 5’ homology region, a 3’UTR and a 3’ homology region. In some embodiments, the payload comprises a 5’ homology region, a 3’UTR and a 3’ homology region. In some embodiments, the payload comprises a 5’UTR, a 5’ homology region, and a 3’ homology region. In some embodiments, the payload comprises a 5’ homology region and a 3’ homology region. In some embodiments, the 3’ homology region comprises less than 30 base pairs. In some embodiments the 3’ homology region comprises less than 20 base pairs. In some embodiments, the 3’ homology region comprises less than 10 base pairs. In some embodiments, the 3’ homology region comprises less than 5 base pairs.Programmable Nucleases, Nickases, and DNA Binding Proteins

[0170] . The instant disclosure contemplates programmable nucleases or nickases for use in or as a part of the genome editing systems described herein. In some embodiments, the programmable nuclease or nickase is a Cas9 protein. In some embodiments, the programmable nuclease or nickase is a Casl2 protein. In some embodiments the programmable nuclease or nickase is IscB. In some embodiments, the programmable nuclease or nickase is IsrB. In some embodiments, the programmable nuclease or nickase is TnpB. In some embodiments, the programmable nuclease or nickase is a TALEN nuclease. In some embodiments, the programmable nuclease or nickase is fused to the non-LTR site-specific retrotransposon element. In some embodiments, the programmable nuclease or nickase is non-covalently linked to the non-LTR site-specific retrotransposon element. In some embodiment, the programmable nuclease or nickase acts in cis with the non-LTR site-specific retrotransposon element. In some embodiments, the programmable nuclease or nickase acts in trans with the non-LTR site-specific retrotransposon element.42SUBSTITUTE SHEET (RULE 26)Therapeutic Gene Insertions

[0171] . In some embodiments, the payload results in the insertion of a therapeutic gene into a host genome. In some embodiments, the therapeutic gene is intended to treat a neurological disorder or a neurodegenerative disorder. In some embodiments, the therapeutic gene is intended to treat cancer. In some embodiments, the therapeutic gene is intended to treat an autoimmune disorder.

[0172] . In some embodiments, the payload results in the insertion of a therapeutic gene for treating a genetically inherited disease. In some embodiments, the genetically inherited disease is Meier-Gorlin syndrome. In some embodiments, the genetically inherited disease is Seckel syndrome 4. In some embodiments, the genetically inherited disease is Joubert syndrome 5. In some embodiments, the genetically inherited disease is Leber congenital amaurosis 10. In some embodiments, the genetically inherited disease is Charcot-Mari e-Tooth disease, type 2. In some embodiments, the genetically inherited disease is leukoencephalopathy. In some embodiments, the genetically inherited disease is Usher syndrome, type 2C. In some embodiments, the genetically inherited disease is spinocerebellar ataxia 28. In some embodiments, the genetically inherited disease is glycogen storage disease type III. In some embodiments, the genetically inherited disease is primary hyperoxaluria, type I. In some embodiments, the genetically inherited disease is long QT syndrome 2. In some embodiments, the genetically inherited disease is Sjogren-Larsson syndrome. In some embodiments, the genetically inherited disease is hereditary fructosuria. In some embodiments, the genetically inherited disease is neuroblastoma. In some embodiments, the genetically inherited disease is amyotrophic lateral sclerosis type 9. In some embodiments, the genetically inherited disease is Kallmann syndrome 1. In some embodiments, the genetically inherited disease is limb-girdle muscular dystrophy, type 2L. In some embodiments, the genetically inherited disease is familial adenomatous polyposis 1. In some embodiments, the genetically inherited disease is familial type 3 hyperlipoproteinemia. In some embodiments, the genetically inherited disease is Alzheimer’s disease, type 1. In some embodiments, the genetically inherited disease is metachromatic leukodystrophy. In some embodiments, the genetically inherited disease is cancer. In some embodiments, the genetically inherited disease is Uveitis. In some embodiments, the genetically inherited disease is SCA1. In some embodiments, the genetically inherited disease is SCA2. In some embodiments, the genetically inherited disease is FUS- Amyotrophic Lateral Sclerosis (ALS). In some embodiments, the genetically inherited disease is MAPT-Frontotemporal Dementia (FTD). In some43SUBSTITUTE SHEET (RULE 26)embodiments, the genetically inherited disease is Myotonic Dystrophy Type 1 (DM1). In some embodiments, the genetically inherited disease is Diabetic Retinopathy (DR / DME). In some embodiments, the genetically inherited disease is Oculopharyngeal Muscular Dystrophy (OPMD). In some embodiments, the genetically inherited disease is SCA8. In some embodiments, the genetically inherited disease is C9ORF72-Amyotrophic Lateral Sclerosis (ALS). In some embodiments, the genetically inherited disease is SOD 1 -Amyotrophic Lateral Sclerosis (ALS). In some embodiments, the genetically inherited disease is SCA6. In some embodiments, the genetically inherited disease is SCA3 (Machado-Joseph Disease). In some embodiments, the genetically inherited disease is Multiple system Atrophy (MSA). In some embodiments, the genetically inherited disease is Treatment-resistant Hypertension. In some embodiments, the genetically inherited disease is Myotonic Dystrophy Type 2 (DM2). In some embodiments, the genetically inherited disease is Fragile X-associated Tremor Ataxia Syndrome (FXTAS). In some embodiments, the genetically inherited disease is West Syndrome with ARX Mutation. In some embodiments, the genetically inherited disease is Age-related Macular Degeneration (AMD) / Geographic Atrophy (GA). In some embodiments, the genetically inherited disease is C9ORF72-Frontotemporal Dementia (FTD). In some embodiments, the genetically inherited disease is Facioscapulohumeral Muscular Dystrophy (FSHD). In some embodiments, the genetically inherited disease is Fragile X Syndrome (FXS). In some embodiments, the genetically inherited disease is Huntington's Disease. In some embodiments, the genetically inherited disease is Glaucoma. In some embodiments, the genetically inherited disease is Acromegaly. In some embodiments, the genetically inherited disease is Achromatopsia (total color blindness). In some embodiments, the genetically inherited disease is Ullrich congenital muscular dystrophy. In some embodiments, the genetically inherited disease is Hereditary myopathy with lactic acidosis. In some embodiments, the genetically inherited disease is X-linked spondyloepiphyseal dysplasia tarda. In some embodiments, the genetically inherited disease is Neuropathic pain (Target: CPEB). In some embodiments, the genetically inherited disease is Persistent Inflammation and injury pain (Target: PABP). In some embodiments, the genetically inherited disease is Neuropathic pain (Target: miR-30c-5p). In some embodiments, the genetically inherited disease is Neuropathic pain (Target: miR-195). In some embodiments, the genetically inherited disease is Friedreich's Ataxia. In some embodiments, the genetically inherited disease is Uncontrolled gout. In some embodiments, the genetically inherited disease is Inflammatory pain (Target: Navi.7 and Navi.8). In some embodiments, the genetically inherited disease is Choroideremia. In some44SUBSTITUTE SHEET (RULE 26)embodiments, the genetically inherited disease is Focal epilepsy. In some embodiments, the genetically inherited disease is Alpha-1 Antitrypsin deficiency (AATD). In some embodiments, the genetically inherited disease is Androgen Insensitivity Syndrome. In some embodiments, the genetically inherited disease is Opioid-induced hyperalgesia (Target: Raf-1). In some embodiments, the genetically inherited disease is Neurofibromatosis type 1. In some embodiments, the genetically inherited disease is Stargardt's Disease. In some embodiments, the genetically inherited disease is Dravet Syndrome. In some embodiments, the genetically inherited disease is Retinitis Pigmentosa. In some embodiments, the genetically inherited disease is Hemophilia A (factor VIII). In some embodiments, the genetically inherited disease is Hemophilia B (factor IX). In some embodiments, the genetically inherited disease is Parkinson's Disease.Linkers

[0173] . In some embodiments, the linker is a polypeptide linker. In some embodiments, the linker is a non-peptide linker. In some embodiments, the linker comprises a polypeptide portion and a non-peptide portion. In some embodiments, the linker comprises an extended recombinant polypeptide (XTEN). In some embodiments, the linker comprises the amino acid sequence (Gly4Ser)n(SEQ ID NO: 33380), where n is an integer. In some embodiments, the linker comprises the amino acid sequence (Gly4Ser)n, wherein n is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 (SEQ ID NO: 33381). In some embodiments, the linker comprises the amino acid sequence (Gly4Ser)n, wherein n is greater than 10 (SEQ ID NO: 33382). In some embodiments, the linker comprises a synthetic portion. In some embodiments, the linker comprises polyethylene glycol (PEG). In some embodiments, the linker is a synthetic linker. In some embodiments (Gly2Ser)n, wherein n is an integer. In some embodiments, the linker comprises the amino acid sequence (Gly2Ser)n, wherein n is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 (SEQ ID NO: 33383). In some embodiments, the linker comprises the amino acid sequence (Gly2Ser)n, wherein n is greater than 10 (SEQ ID NO: 33384). In some embodiments, the linker comprises the amino acid sequence (Ser-Gly-Gly-Ser)n(SEQ ID NO: 33385), where n is an integer. In some embodiments, the linker comprises the amino acid sequence (Ser-Gly-Gly-Ser)n, wherein n is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 (SEQ ID NO: 33386). In some embodiments, the linker comprises the amino acid sequence (Ser-Gly-Gly-Ser)n, wherein n is greater than 10 (SEQ ID NO: 33387). In some embodiments the linker comprises the amino acid sequence (Glu-Ala-Ala- Ala-Lys)n(SEQ ID NO: 33388), wherein n is an integer. In some embodiments, the linker comprises the amino acid sequence (Glu-Ala-Ala-Ala-Lys)n, wherein n is 1, 2, 3, 4, 5, 6, 7, 8,45SUBSTITUTE SHEET (RULE 26)9, or 10 (SEQ ID NO: 33389). In some embodiments, the linker comprises the amino acid sequence (Glu-Ala-Ala-Ala-Lys)n, wherein n is greater than 10 (SEQ ID NO: 33390). In some embodiments, the linker comprises a proline linker.Methods of the Disclosure

[0174] . The present disclosure relates to a method of editing a genome using a genome editing system. The present disclosure also relates to the method of editing a genome using a genome editing system, wherein the genome editing system comprises i) an R2 element enzyme, and ii) a payload RNA; wherein the payload RNA comprises one or more of a 5’ homology region, a 3’ homology region, a protein binding element, and an insertion region; wherein the insertion region comprises a template for a small or large nucleic acid insertion into the genome; and wherein the R2 element enzyme comprises a targeting domain, a reverse transcriptase domain, and a nickase domain.

[0175] . In some embodiments, the target genome is in a eukaryotic cell. In some embodiments, the targeted genome is in a mammalian cell. In some embodiments, the targeted genome is in a dividing mammalian cell. In some embodiments, the targeted genome is in a non-dividing cell. In some embodiments, the targeted genome is in a quiescent cell.

[0176] . In some embodiments, the genome editing system targets a genomic position for deletion rather than editing. In some embodiments, the genome editing system targets a genomic site for deletion that is between 1 and 150 nucleotides. In some embodiments, the genome editing system comprises a payload RNA with a 5’ homology region and a 3’ homology region, wherein the 5’ homology region and the 3’ homology region, wherein the 5’ homology region and the 3’ homology region are positioned to delete the genomic target. In some embodiments, the genome editing system is capable of deleting a genomic target and inserting a novel nucleic acid region into the genome concurrently.Compositions

[0177] . The present disclosure relates to compositions, wherein the composition comprises a cell, and wherein the cell comprises a genome that has been edited using a genome editing system.Delivery systems

[0178] . The present disclosure relates to genome editing systems comprising an R2 element enzyme and a template. In some embodiments, the genome editing system is a46SUBSTITUTE SHEET (RULE 26)delivery system comprising several components. In some embodiments, the components comprise an R2 element enzyme or a molecule that encodes an R2 element enzyme. In some embodiments, the components comprise a template. In some embodiments, the delivery system components comprise an R2 element enzyme or a molecule that encodes an R2 element enzyme and a template. In some embodiments, the R2 element enzyme and the template are delivered together. In some embodiments, the R2 element enzyme and the template are delivered in a designed delivery system. In some embodiments, the R2 element enzyme is delivered as an RNA molecule that is suitable for in vivo translation to an R2 element enzyme. In some embodiments, the R2 element enzyme is delivered in its proteinaceous form. In some embodiments, the template is delivered as an RNA molecule. In some embodiments, the template is delivered as a DNA molecule suitable for in vivo transcription to an RNA molecule. In some embodiments, the R2 element enzyme is delivered as a DNA molecule that is suitable for in vivo transcription and translation to an R2 element enzyme. In some embodiments, the R2 element enzyme is delivered as an RNA molecule and the template is delivered as an RNA molecule. In some embodiments, the designed delivery system comprises a lipid nanoparticle. In some embodiments, the designed delivery system comprises a cationic molecule. In some embodiments, the R2 element enzyme and the template are injected directly into a cell as naked RNA. In some embodiments, the components of the delivery system can be delivered by lipofection. In some embodiments, the components of the delivery system can be delivered in lipid nanoparticles. In some embodiments, the components of the delivery system can be delivered by a viral delivery system.Sequences

[0179] . Exemplary sequences of payload UTRs and target homologies are provided in Table 1.Table 1. Exemplary payload UTRs and target homologies.47SUBSTITUTE SHEET (RULE 26)48SUBSTITUTE SHEET (RULE 26)

[0180] . Exemplary sequences of Cas9 guides are provided in Table 2.Table 2. Exemplary Cas9 guides.49SUBSTITUTE SHEET (RULE 26)50SUBSTITUTE SHEET (RULE 26)

[0181] .Exemplary sequences of NGS, gel primers, and Sanger primers are provided in Table 3.Table 3. Exemplary NGS, gel primers, and Sanger primers.51SUBSTITUTE SHEET (RULE 26)SUBSTITUTE SHEET (RULE 26)

[0182] . Exemplary sequences of ddPCR primers and probes are provided in Table 4.Table 4. Exemplary ddPCR primers and probes.SUBSTITUTE SHEET (RULE 26)

[0183] . Having now described the present disclosure in detail, the same will be more clearly understood by reference to the following examples. The following examples are included solely for purposes of illustration and are not considered limiting embodiments. All patents and publications referred to herein are expressly incorporated by reference.EXAMPLESExample 1. Insertion of non-human R2 into the 28S locus of the human genome.

[0184] . To determine the ability of animal R2 elements to integrate into the human genome, HEK293FT cells were transfected with specific plasmids containing the zebra finch (Taeniopygia guttata) R2 element (R2Tg), a payload, or both the R2tg plasmid and a payload plasmid. Following isolation of DNA from transfected cells, those cells transfected with an R2Tg plasmid and an eGFP payload (eGFP flanked by UTR regions and 100 bp homology to the human R2 locus), showed a distinct PCR product (Fig. 1, lane 1), indicating integration of the eGFP payload into the human genome through R2Tg. When cells were transfected with R2Tg without a payload (Fig. 1, lane 2), payload alone with no R2 (Fig. 1, lanes 3, 8, 9), or other R2 orthologs from Geospiza fortis (Gfo; Fig. 1, lane 3-5) with or without payloads, no PCR product is identified These results demonstrate that R2Tg can successfully integrate payloads into the human genome.Example 2. Modification of the target landing site.

[0185] . Following successful insertion of an eGFP payload, the features of the R2 system that could increase integration efficiency were examined In the following experiments, unless otherwise stated, three plasmids are used. The first plasmid contains at least an R2 protein. The second plasmid contains at least a portion of a payload reporter. The third plasmid contains at least R2 landing sites.

[0186] . The R2 landing site plasmids contain R2 landing sites of variable size. This size is indicated in the format 26 / 3 (Fig. 2), where the first number indicates the number of base pairs upstream of the insertion site, and the second number indicates the number of base pairs downstream of the insertion site.

[0187] . Following transfection of these three plasmids with varying length of R2 landing sites, integration was measured by luminescence, indicating integration of the luminescent payload (Fig. 2). of an artificial luciferase exon (introduced only with the payload) that allows the inserted reporter to splice and reconstitute a functional luciferase gene (Fig. 2).54SUBSTITUTE SHEET (RULE 26)The payload, which is RNA, is transcribed from a DNA (payload plasmid template) where an artificial luciferase exon is flanked by 5’ and 3’ UTRs as and 5’ and 3’ homologies. Two negative controls (Fig. 2, lanes 11-12) exhibited little luminescence. The landing site which proved to be the most efficient for integration was 26 / 6 (Fig. 2, lane 6; 26 bp upstream, 6 bp downstream of the insertion site). Given that the normal target site at the 28 S locus in the human genome is hundreds of base pairs, it is unexpected that the shorter landing sites tested here provided such efficient integration.

[0188] . Next, the tolerability of mutations within the R2 landing sites was tested. Fig. 3A displays the predicted zinc finger binding sites (red) within the R2 landing sites and the mutations tested (orange, lowercase bases). Fig. 3 B shows that there is a great deal of tolerability within the R2 landing sites that still allows for integration. Fig. 4 shows additional mutations that may be tolerated. However, mutation of all three, predicted zinc finger binding sites results in abrogated insertion efficiency (Fig 4B, target_37_23_mut_10). Based on this evidence, a great degree of tolerability for mutations away from the traditional R2 landing sites is found and can help in the development of exogenous landing sites.Example 3. Modification of the payload homology regions

[0189] . After determining that short landing sites could provide for efficient integration, the effect of insertion homology length (to the landing sites) on integration efficiency was evaluated. To test the effect of homology length on integration efficiency, HEK293FT cells were transfected with three separate plasmids. The first plasmid contained an R2 protein encoding region, the second plasmid encoded a partial (inactive) luciferase reporter region and R2 landing sites, and the third plasmid encoded a luciferase insertion as well as regions of homology of varying number of base pairs homologous to the R2 landing site in the second plasmid. Cells were then treated with aphidicolin, which blocks cell division and thus also stops Homology Directed Repair (HDR). Without being bound to any one theory, by blocking HDR, integration is more likely to occur due to an R2 related mechanism.

[0190] . When treated with 1 pm, 5 pm, or 25 pm aphidicolin (or DMSO control) (Fig. 5), plasmids with either 60 base pair homology (Fig. 5, columns 1-4) or 40 base pair homology (Fig. 5, columns 5-8) still exhibited successful integration, indicating that the integration of these payloads occurs by an HDR-independent mechanism.55SUBSTITUTE SHEET (RULE 26)

[0191] . When flanking regions (UTR and additional homology region) were increased in size to 100 bp (Fig. 6, columns 1-4), 200 bp (Fig. 6, columns 5-8), or 300 bp (Fig. 6, columns 9-12) and treated with aphidicolin at 1 pm, 5 pm, or 25 pm (or DMSO control), a significant improvement in integration efficiency is exhibited with longer flanking regions (Fig. 6). When transfected with Cas9 only, no integration was seen. Cells were also transfected with a 300 bp flanking template and no R2 protein (Fig. 6, lanes 13-16) to measure the level of HDR in the system.

[0192] . An overview of the role homology of the payload plays in integration efficiency (as measured by luminescent readout) is seen in Fig. 7. Greater 5’ homology (y-axis) to the R2 landing site is associated with more efficient integration. This is not the case for 3’ homology (x-axis), which is less clear, but indicates that shorter homology results in more efficient integration in some cases.

[0193] . Also, the effect of truncations of the 5’ and 3’UTRs from the payload portion (Fig. 8) on integration efficiency was examined. Three plasmids were transfected into HEK293FT cells. The first plasmid contained a partial luciferase reporter with wild-type R2 landing sites (wtR2) of 26 / 22 bp. The second plasmid encoded an R2 protein. The third plasmid contained a luciferase payload with the UTR modifications listed along the x-axis. Generally, 3’ UTR (Fig. 8, columns 16-29) truncations resulted in greater integration efficiency (as measured by luminescence readout) than 5’ UTR truncations (Fig. 8, columns 3- 15). The greatest increases in integration efficiency were seen in truncations greater than 90 base pairs. Nearly all truncations, however, retained some form of integration activity.

[0194] . Next, we evaluated how solely altering the 3’ homology regions would affect integration efficiency. In this experiment, HEK293FT cells were transfected with 3 plasmids. The first plasmid contained an R2 protein encoding region. The second plasmid contained a partial luciferase reporter with wtR2 landing sites. The third plasmid contained a luciferase insertion with alterations to the 3’ UTR, as named on the x-axis (Fig. 9A) and described visually in Fig. 9B. HDV is an HDV ribozyme, which cleaves the insertion region directly after the 3’ UTR. mutHDV is an inactive HDV, incapable of cleaving the homology region just beyond the 3 ’UTR. All modifications retained significant activity, except for the HDV only modification This indicates that cleavage directly beyond the 3 ’UTR in the homology region (i.e., no further homology region remains), dramatically decreased integration efficiency (Fig.56SUBSTITUTE SHEET (RULE 26)9 A, column 3). This is in concert with the discoveries above, where a minimal (but not absent) 3’ homology region is required for significant integration efficiency.Example 4. Modification of the R2 enzyme

[0195] . Next, we evaluated whether modifications to the R2 protein could increase integration efficiency. First, permissible domains within the R2 protein into or onto which various additional moieties could be fused were identified. As before, three plasmids were introduced into HEK293FT cells. The first plasmid contained an R2 protein which contained different GFP variants at different points along the R2 protein. The second plasmid encoded a partial (inactive) luciferase reporter region and R2 landing sites, and the third plasmid encoded a luciferase insertion as well as regions of homology to the R2 landing site in the second plasmid.

[0196] . These variant R2 proteins were modified by inserting GFP variants throughout the length of the protein, beginning from the N-terminus. By example, LNK1_1 is located closer to the N-terminus than is LNK1_7. LNK_nt indicates a fusion to the N-terminus, while LNK_ct indicates a fusion to the C-terminus. As seen in Fig. 10, an N-terminal fusion of eGFP resulted in the greatest integration efficiency, suggesting that this fusion may be ideal for additional fusion molecules. However, multiple “permissive insertion sites” were identified in Fig. 10, including R2Tg_LNKl_l, R2Tg_LNKl_2, R2Tg_LNKl_3, R2Tg_LNKl_4, R2Tg LNK1 5, R2Tg LNK2 1, R2Tg LNK2 3, R2Tg LNK2 9 and R2Tg LNK2 10 (Fig. 10).

[0197] . The matter of whether R2 could integrate a payload using a “short target” - truncated R2 landing sites (26 / 3 bp) was investigated. Fig. 11 exhibits the ability of R2 to deliver a payload even given this short landing site (Fig. 11, column 1).

[0198] . Also, the matter of whether the addition of a nuclear localization signal would increase integration efficiency at the Beta-actin locus of HEK293FT cells (Fig. 12) was examined. HEK293FT cells were transfected with four separate plasmids. The first plasmid encoded an R2 protein. The second plasmid contained pMAX as a payload (including 5’ and 3’ UTRs, as well as 5’ and 3’ homologies) for R2-dependent insertion. The third plasmid encoded a prime editor protein, and the fourth plasmid expressed a prime editing guideRNA. The prime57SUBSTITUTE SHEET (RULE 26)editor first inserts a 48bp (28 S) target site in ACTB to then, in a second step, R2-dependent insertion of the pMAX payload.

[0199] . After determining the ability of a nuclear localization signal to boost integration, the primary localization of transfected R2 proteins into HEK293FT cells was evaluated. Fig. 13A shows that R2 does not primarily localize to the nucleus of the cell. However, when HEK293Ft cells were transfected with two plasmids (the first an R2 protein, the second a payload protein) into cells that had been stably transfected to integrate a portion of the splice reporter, addition of a nuclear localization signal to the N- and C-terminus of the R2 protein dramatically increased payload insertion efficiency (Fig. 13B).

[0200] . Thus, modifying the R2 protein portion can allow for greater integration efficiency. To further study integration efficiency, a fluorescent GFP reporter responsive to R2 activity (Fig. 14) was developed. The R2 reporter that was developed has a single GFP exon and promoter that is not activated until the R2 payload, with a second GFP exon, is integrated (Fig. 14A, B). Thus, R2 integration can be read by a fluorescent readout.

[0201] . Using this fluorescent readout approach, the efficiency of integration was evaluated using flow cytometry. HEK293FT cells were transfected with specific plasmids. These samples were wild-type R2 (Fig. 15A, column 1), a negative control (Fig. 15A, no R2 protein; column 2), 300 ng of R2 with a nuclear localization signal (Fig. 15 A, column 3), 200 ng of R2 with a nuclear localization signal (Fig. 15A, column 4), 100 ng of R2 with a nuclear localization signal (Fig. 15 A, column 5), 50 ng of R2 with a nuclear localization signal (Fig. 15A, column 5), and untransfected cells as a percentage of all cells in each sample. The results shown in Fig. 15A clearly demonstrate the increased integration efficiency of R2 proteins with a nuclear localization signal compared to wild type R2 without a nuclear localization signal. This increase persists when the GFP + cells are normalized to only those cells that were successfully transfected (Fig. 15B).

[0202] . Next, the matter of whether the truncation of the R2 protein resulted in alteration of integration efficiency was studied, he N-terminal portion of the R2 protein was serially truncated, as indicated by the vertical lines in Fig. 16B. These truncations did not result in any significant drop in integration efficiency until reaching NT_7, which demarcates the current limit of truncation for a single R2 protein to maintain integration efficiency.58SUBSTITUTE SHEET (RULE 26)

[0203] . Also, the matter of whether C-terminal truncations of the R2 protein may result in viable R2 proteins that sustain integration efficiency (Fig. 17) was evaluate. However, even the shortest C-terminal truncation resulted in a drastic decrease in integration efficiency, highlighting the importance of the C-terminal domains in contrast to the somewhat expendable N-terminal domains (Fig. 17A, 17B).

[0204] . The issue that ablation of the restriction-like endonuclease (RLE) domain would affect integration activity was then studied. HEK293FT cells were transfected by three plasmids. The first plasmid contains a partial luciferase reporter with wtR2 landing sites (26 / 22bp). The second plasmid encodes either a wild type R2 protein or an RLE deficient R2 protein. The third plasmid encodes a luciferase payload. Absence of the RLE domain in the R2 protein almost completely abolishes the integration efficiency of a wild-type R2 protein (Fig. 18, column 3).

[0205] . Finally, the matter of whether certain other domains of the R2 protein could be removed or modified without adverse effect, was evaluated. Fig. 19. Displays the results of an experiment in which HEK293FT cells were transfected with 3 plasmids. The first plasmid encoded a partial luciferase reporter with wtR2 landing sites. The second plasmid encoded a luciferase payload. The third plasmid encoded an R2 protein with various modifications, including to the -1 domain, 0 domain, zinc finger domains, or to add C- or N-terminal fusions. Three payloads were examined for each modified group of plasmids. A wild type luciferase payload (orange), a luciferase payload in which the MS2 binding site replaces the 5’UTR, and a luciferase payload in which the 5’ and 3’UTRs are replaced with MS2 binding sites. Deletion of the -1 domain (Fig. 19, columns 1-3), of the -1 and 0 domains (Fig. 19, columns 4-6) and of the 0 domain alone (Fig. 19, columns 7-9) significantly impaired integration efficiency.Further, replacing the 0 domain with an eGFP (Fig. 19, columns 10-12) or with an MCP domain (Fig. 19, columns 13-15) also significantly decrease integration efficiency, as did deleting a zinc finger domain (Fig. 19, columns 19-21). However, fusing the truncated N- terminus of the R2 protein to an MCP domain (i.e., a targeting domain) did show some integration efficiency, though not to the level of wild type. This experiment helps to define the indispensable domains for the R2 protein, and where modifications may be made.Example 5. Modification of Payloads.59SUBSTITUTE SHEET (RULE 26)

[0206] . This Example tested whether the payload itself could be modified to sustain nuclear localization. Fig. 20 sets out the relative insertion efficiency of payloads with various nuclear retention elements appended to the payload. Nuclear retention signals have varying levels of effect on the integration efficiency of the R2 payloads, indicating that nuclear localization may be important for optimal integration activity.

[0207] . Further, whether the UTR elements of the payload were necessary for their integration, or if they may be modified, was studied. In this experiment, HEK293FT cells were transfected with three plasmids. The first plasmid encoded an R2 protein. The second plasmid encoded a partial luciferase reporter and wtR2 landing sites. The third plasmid contained the luciferase payload and any of many UTR modifications (Fig. 21). UTRs were replaced by MS2 binding sites (Fig. 21, columns 1, 2, and 4), the 3’UTR was deleted (Fig. 21, column 3), the 5’ UTR replaced by an MS2 binding site while the 3’UTR is deleted (Fig. 21, column 5), the 5’ and 3’ UTR were both deleted (Fig. 21, column 6), the 5’UTR is deleted and the 3’UTR is replaced with an MS2 binding site (Fig. 21, column 7), as well as positive and negative controls (Fig. 21, columns 8 and 9, respectively). In each situation some integration activity was confirmed. Importantly, this also occurred in which both the 5’ and 3’ UTRs were deleted without any replacement (Fig. 21, column 6).Example 6. Linkers and Fusion Proteins

[0208] . Also, the evaluation of R2 fusion proteins and fusion proteins with linkers were viable for use in genome editing was carried out. In this experiment, HEK293FT cells were transfected with 3 plasmids. The first plasmid contained an R2 protein (with or without an NLS) fused to a Cas9 protein connected by an XTEN linker (16 amino acids in length) at various points through the N-terminal portion of the R2 protein (see Fig. 22B). The second plasmid contains a luciferase reporter that is designed to indicate cleavage by Cas9. The third plasmid expresses a single guide RNA. Multiple Cas9-R2 fusion proteins exhibited the ability to cleave the Cas9 target protein, either with or without the nuclear localization signal (Fig. 22A).

[0209] . Lastly, the determination of whether these Cas9-R2 fusion proteins were capable of editing human genomes was carried out. HEK293FT cells were stably transfected with a eGFP precursor gene with a 20 bp deletion. As such, the reporter is inactive until the 20 base pairs are inserted into the precursor. Fig. 23A-N exhibit integration and editing efficiency60SUBSTITUTE SHEET (RULE 26)based on the expression of eGFP in these cells. This indicates that the large-scale insertion mechanism of R2 can function in concert with the targeted editing enzyme Cas9 for editing a human genome.Example 7. Computational Analysis of Single-ORF Retroelements

[0210] . The ORFs of 4,464 eukaryotic assemblies (animals and protists) from GenBank for RT, CCHC zinc finger, and RLE domains of known retroelements were also examined. Using a computational pipeline (Fig. 24A) we searched for single protein site-specific non- LTR retrotransposons based on their stereotyped architecture of C-terminal RLE and RT domains as a signature. We identified 8,248 RLE-domain containing representative orthologs (Fig 24) with diverse RT domains, ZF motifs, and predicted insertion preferences, which clustered into 9 families based on phylogenetic analysis and the presence or absence of flanking rRNA sequences, microsatellite repeats, tRNA genes, or splicing RNAs (Table 1).

[0211] . We found that families varied in length, with the longer family 3 and 5 ORFs having mean lengths of 1,390 and 1,280 residues, respectively, and family 4 containing shorter ORFs, with a mean length of 966 residues (Fig. 24B, 24C; Fig, 25; Table 1).

[0212] . The distance to the predicted insertion site, which is indicative of UTR length, also varied substantially, with family 1, 8, and 9 having the least distance between up and downstream annotations and ORF, suggesting shorter UTR lengths (Fig. 62A). While the 5' and 3' UTR lengths based on distance to nearest predicted target site show wide variability between 181-932 bp and 101-647 bp (inter-quartile ranges), respectively, the UTRs predicted based on non-coding sequence conservation flanking the ORFs are much smaller and have tighter length distributions (Fig. 62B-C). Using non-coding conservation, 5' and 3' UTR lengths vary between 115-327 bp and 82-172 bp (interquartile ranges), respectively (Fig. 62C). While families 1, 3, 5, 6, 7, 8, and 9 associate with previously identified orthologs and subfamilies, families 2 and 4 had no association to known subfamilies (Table 5).Table 5. Summary of characteristics of non-LTR RLE containing retrotransposon families61SUBSTITUTE SHEET (RULE 26)

[0213] . We next examined the preferred integration sites for these families. Family 1 exhibited a preference for integrating into 28 S and 18S rRNA gene sites; family 3 exhibited a preference for integrating into 5S and likely spliced leader sequences; families 4, 6, and 9 exhibited a preference for integrating into tandem repeats and microsatellites, including novel repeat sequences; family 5 exhibited a preference for integrating into snRNA gene loci and some tRNA preferences; family 7 exhibited a preference for integrating into tRNA; and family 8 exhibited a preference for integrating into 28S loci (Table 1). Family 2 has an unknown integration site preference. Accordingly, the zinc finger motifs across these different families are divergent (Fig. 24B, 24C).

[0214] . Clusters showed two reverse transcriptase (RT) architectures, with families 3 and 4 containing broad RT-like domains, and all other families containing more specific non- LTR retrotransposon RT domains (Fig. 24A, 24B). In contrast to previous efforts profiling RLE-containing non-LTR retrotransposon diversity (Kojima, et al., PLoS One. 11, eO 163496 (2016); Eickbush et al., PLoS One. 8, e66441 (2013); Luchetti, etal., PLoS One. 8, e57076 (2013)), our computational expansion covers an order of magnitude more orthologs than the 418 surveyed before (Kojima et al., Genes Genet. Syst. 94, 233-252 (2020); Bao et al., Mob. DNA. 6, 11 (2015).), allowing discovery of families with multiple integration preferences, such as in family 1, where 5S rDNA preferences are interspersed between 28S preferences, or families with discordance between 5' and 3' site predictions, such as in family 5.62SUBSTITUTE SHEET (RULE 26)

[0215] . We next investigated retroelements which had discordant 5’ and 3’ homologies. We found multiple instances of discordant homologies, including in family 1, which has members with 5' small subunit rRNA preferences and 3' large subunit rRNA preferences, and family 5 which contains systems with 5' SL1 splicing leader preferences and 3' U2 small nuclear RNA (snRNA) target preferences (Fig. 26). Our analysis revealed two broad classes of insertions, which we termed Class 1 and Class 2 based on the nature of surrounding elements (Fig 26A, 26B). Class 1 insertions include ORFs with a canonical target site on one side and a different target gene on the other side. In contrast, Class 2 insertions involve canonical integration into a target site flanking the ORF retrotransposon, with additional putative insertion targets nearby.

[0216] . To elucidate divergent target preferences, Rfam annotations were made around all members (Fig. 24A-B, 62, 63) and the results show 188 systems clustering into 39 groups with divergent target preferences (Fig. 52, 53). Many of these divergent protein families show one dominant target site preference with a subset of member systems displaying new preferences such as a change from a 5S to tRNA site preference (Fig. 53).

[0217] . We also heterologously reconstituted site-specific retrotransposition in human cells to model integration preferences and retargeting in eukaryotic genomes. We synthesized a panel of 12 retrotransposon ORFs from our computational exploration, selecting a sample that included R2 elements with demonstrated activity in mammalian cells (R2O1) (A. Kuroki-Kami, et al. 2019 Mob. DNA. 10, 23; Su, et al., 2019. RNA. 25, 1432-1438), experimentally characterized retrotransposon groups without proven activity in mammalian cells (R2Bm), previously computationally described retrotransposons (R2Ci, R2Tg, R2Is, R2Pap, R2Dr, R2Tsp, HeroDr) (Kojima et al., 2016 PLoS One. 11, e0163496), and novel retrotransposons (RIOMbr, R2Toc, R2Mes) (Table 6), which all ranged in sequence similarity between 13%- 67% (Fig. 27, 64A-E). RIOMbr, which occurs in the genome of Myotis brandtii, appeared to integrate in GTA microsatellites (Fig. 28) and lacked similarity to integration preferences to other families. As such it was designated as a putative R10 family member.

[0218] . To evaluate the native targeting capacity of these candidates for the 28S loci, we developed a plasmid reporter containing 200 bp of the 28 S target with upstream expression of the N-terminus of Gaussia luciferase (Glue) and delivered a payload containing an exon with 28S homology, predicted UTRs for corresponding orthologs, and a C-terminal Glue fragment. This system enabled readout of insertion efficiency by luciferase production, and we63SUBSTITUTE SHEET (RULE 26)found that only a limited subset (R2Bm, R2Tg, and R2Mes) had native activity from insertion of this heterologous Glue cargo in HEK293FT cells (Fig. 29A) as measured by luciferase reporter reconstitution. Interestingly, R2O1, which has previously been demonstrated to be active for 28S genome insertion (Su, et al., 2019. RNA. 25, 1432-1438), did not have activity5 in the luciferase reconstitution assay (Fig. 29A). As suggested by the predicted RIOMbr preference for microsatellites, we did not see any production of luciferase in these conditions. To confirm that RIOMbr did not integrate into any putative 28S sites, we evaluated a panel of 28S sites known to have insertion by various site-specific retroelements and found no insertion at the tested 28 S targeting sites, including in a 28 S region with similarity to sequence flanking10 the RIOMbr locus (Fig. 29B-C, 65A-B), validating our assignment to a novel RIO family that prefers GTA microsatellites, which do not occur in the human genome (Subramanian et al., 2003. Genome Biol. 4, R13). RIOMbr and R2Toc, which occurs in the Talpa occidentalis genome, are both found in mammalian genomes.

[0219] . To evaluate cross compatibility between payloads with UTRs from different15 orthologs and orthlogs R2Bm, R2Tg, and R2Mes, we utilized a 28S luciferase reporter assay to ascertain whether these three orthologs could perform insertion with the other templates. For R2Tg and R2Mes their cognate UTR payload was most efficiently integrated. For R2Bm the payload with R2Toc UTRs was most efficiently integrated, with 6.4x higher insertion efficiency than the cognate R2Bm payload. (Fig. 77).20 Table 6. Exemplary non-LTR retrotransposon orthologsSUBSTITUTE SHEET (RULE 26)SUBSTITUTE SHEET (RULE 26)SUBSTITUTE SHEET (RULE 26)SUBSTITUTE SHEET (RULE 26)SUBSTITUTE SHEET (RULE 26)SUBSTITUTE SHEET (RULE 26)70SUBSTITUTE SHEET (RULE 26)SUBSTITUTE SHEET (RULE 26)72SUBSTITUTE SHEET (RULE 26)SUBSTITUTE SHEET (RULE 26)SUBSTITUTE SHEET (RULE 26)SUBSTITUTE SHEET (RULE 26)SUBSTITUTE SHEET (RULE 26)SUBSTITUTE SHEET (RULE 26)SUBSTITUTE SHEET (RULE 26)79SUBSTITUTE SHEET (RULE 26)80SUBSTITUTE SHEET (RULE 26)81SUBSTITUTE SHEET (RULE 26)SUBSTITUTE SHEET (RULE 26)83SUBSTITUTE SHEET (RULE 26)SUBSTITUTE SHEET (RULE 26)Example 8. Examination of R2Tg Activity

[0220] . As R2Tg had the highest insertion activity, we continued to explore the programmability of this R2 system. The characterization of R2Tg enzymatic activities and payload flexibility at the 28 S locus and a reprogrammed target in human cells were assessed (Fig. 30A-C, 32, 54A-C, 55A-C). We tested R2Tg for heterologous activity at the endogenous 28S locus by designing an EGFP payload flanked by the cognate R2Tg 5' and 3' UTRs and 28S homology arms. Co-transfection of this engineered payload together with wild-type R2Tg resulted in EGFP insertion into endogenous 28 S loci, as determined by left and right PCR junctional analysis (Fig. 30A). To verify dependence on the retrotransposition mechanism, we introduced inactivating mutations in the RLE endonuclease domain (R2TgDi274A ) and ZF domain (R2TgzF2mut ), and found these mutations ablated insertion activity (Fig. 3 OB). Alternatively, mutations introduced at catalytic residues in the RT domain (R2TgD877A,D878A,D884A) significantly reduced, but did not eliminate, insertion activity (Fig.3 OB), which we confirmed by quantifying insertion events using next generation sequencing of targeting amplicons (NGS) (Fig. 30C). We validated these findings on inactivating mutations with our plasmid reporter assay by both luciferase production and editing by NGS (Fig. 30D and Fig. 31 A-B). Based on NGS reads and gel electrophoresis readouts, all R2Tg insertions were found to be full length (Fig. 30), in contrast to observed partial insertions with R2O1 (Su et al., 2019 RNA. 25, 1432-1438). However, R2Tg integration was accompanied by indels at the 28S target, consistent with the previously observed non-templated addition of deoxycytidines by the RT domain (Bibillo, et al., 2004. Journal of Biological Chemistry. 279, pp. 14945-14953.) (Fig. 31C). To finely profile boundaries of functional domains, we tested N- and C- terminal truncations, finding that no C-terminal truncations were tolerated, likely due to loss of the RLE domain, whereas N-terminal truncations were tolerated up to the ZF motifs (fig. 32). These results show the necessity of the ZF and RLE domains for activity and demonstrate that the N-terminal domain upstream of the ZF motifs does not critically contribute to the insertion process.

[0221] . Having determined that the R2TgZF2mut mutant ablated integration, we speculated that supplementing additional DNA binding or nicking activity could rescue R2 integration activity at the 28S target site. We mutated Cas9 from Streptococcus pyogenes to generate either nickase (SpCas9H840A) or dead (SpCas9D10A,H840A) variants and fused85SUBSTITUTE SHEET (RULE 26)these Cas9 variants via an XTEN linker to the N-terminus of R2TgAl-184,ZF2mut , which contains both a truncation that retains activity (Al-184) and the inactivating ZF2 domain mutation (ZF2mut). We then designed Cas9 guides against the 28S target region and coupled these with the R2Tg variants (Fig. 33A). We found that both single guides and paired guides around the target site were able to recruit with SpCas9H840A - R2TgZF2mut and restore integration at the locus, up to 72% of that of WT R2Tg (Fig. 33B-C). However, fusions of SpCas9D10A,H840A with the ZF2 mutant failed to restore activity, implying that the ZF2 binding was necessary for successful nicking (Fig. 34A). We also observed that SpCas9H840A fusion to the RLE deficient mutant R2TgD1274A failed to rescue insertion activity, suggesting involvement of the native nicking of the RLE domain in insertion process, perhaps for second strand nicking or initiation of second strand synthesis (Fig. 34B). These observations held over a larger panel of mutations in the RT and RLE domains as well (Fig. 34C). Therefore, the insertion process involving the RLE and RT domains can be rescued when combined with SpCas9H840A nickase, suggesting a possible route for evolutionary retargeting dependent on ZF evolution or reengineering via Cas9 supplementation.Example 9. Identification of Factors Affecting Integration Dynamics

[0222] . Given that the homology of the RNA template is a strong determinant of the target site, we probed the necessary homology for integration. We tested iterative truncations of either the 5' or 3' homology regions (Fig. 35A), finding that, while the 5' region was sensitive to truncation and required a minimum homology between 20 and 40 nt, the 3' region was robust to truncations, allowing efficient integration even in the absence of homology (Fig. 35B). This leniency may be due in part to promiscuous priming of the R2 systems, suggesting an avenue for evolving preferences to new loci via asymmetric acquisition of homology that would be compatible with Class 1 insertions observed in our computational exploration.

[0223] . The malleable constraints of RNA cargo homology, especially at the 3' end, prompted us to test cargo components. We next tested whether priming could occur internally to cargo, which would allow for successful integration after swapping the UTR and homology regions. Successful insertion from internal homology allows for scarless integration, with significant gene editing applications (Fig. 35C). We evaluated a panel of cargo permutations (Fig. 36A), swapping or duplicating homology elements to investigate86SUBSTITUTE SHEET (RULE 26)whether internal homology could allow for template insertion. Moving homology internal to the UTR resulted in successful scarless insertions (Fig. 36C and Fig. 36B), as confirmed by sanger sequencing, suggesting flexible template priming. Traces of payloads with homology external to the 5' UTR, had a loss of phasing at the 5' junction due to multiple populations, and next generation sequencing confirmed these were due to non-templated addition of nucleotides, similar to what we observed at the wildtype 28S locus (Fig. 37A-B). Analysis of cross-junctional PCR products of insertion products with cargos having internal homology showed a reduction of size corresponding to a complete absence of the UTR region (Fig. 37C, Fig. 38A-D, Fig. 60, and Fig. 83A), confirming scarless insertion, the flexibility of the retrotransposon cargo architecture, and the efficiency of scarless integration especially with cargo 6 (Fig. 38C-D). Targeted integration with internal homology also required homology to the 28 S region, as alternative homology to the AAVS1 locus failed to show detectable insertion (Fig. 83B). These results highlight that priming off the template is very flexible, implying a very direct path for an expressed retrotransposon to acquire new priming sequences by landing in new areas via promiscuous priming of novel target sites or acquiring nearby targets and supporting both the Class 1 and Class 2 insertion mechanism.

[0224] . While permutations of cargo components and complete removal of the 3’ UTR were tolerated, deletion of the 5' UTR region resulted in significantly lower integration rates (Fig. 38A); as integration was not completely eliminated, this suggests that some element of the 28S homology region is still recognized by R2Tg for integration. All tested payloads also had some amount of residual indel formation (Fig. 37B, Fig. 38A-B). Overall, moving homology regions internal to the UTRs could produce scarless insertion at both 5' and 3' junctions while still maintaining efficient integration, especially with cargo 9 (Fig. 38A). These modifications also show that scar formation of R2Tg due to external homology is not a necessary component for the system to function and suggested the feasibility of acquiring new sites via similarity to internal regions.Example 10. Programming of R2Tg for Integration at Specific Loci

[0225] . We next programmed the R2Tg system to integrate at different loci by swapping target homologies (Fig. 39A). We designed scarless insertion payloads with homology arms to either AAVS1 or NOLC1 loci and co-transfected these payloads with R2Tg in HEK293FT cells, finding targeted insertion at NOLC1 at -0.5%, which depended on the RLE catalytic residues of R2Tg, and no detectable insertion at AAVS1 (Fig. 39B). To87SUBSTITUTE SHEET (RULE 26)improve efficiencies of retargeting R2Tg at both loci, we tested whether SpCas9H840A could improve insertion through additional nicking activity. We designed a pair of guide RNAs to introduce nicks on the bottom and top strands of the N0LC1 locus or a single guide RNA to introduce a nick at the AAVS1 locus. We co-delivered these along with a cargo carrying transgene payloads, 5' and 3' R2Tg UTRs, and homology arms directed around the nicking site of 100 or 50 nt for AAVS1 and NOLC1 respectively. We found that SpCas9H840A - R2Tg fusion had increased efficiency at both NOLC1 ( ~3%) and AAVS1 ( -0.5%) (Fig. 39B), showing that SpCas9H840A could significantly improve R2Tg insertion efficiency.

[0226] . To find optimal payloads for efficient insertion at new loci, we designed a panel of payloads following integration guidelines that were effective at the 28S locus (Fig. 39C). Across designs, including internally located homology arms, deletion of the 3' UTR, and truncation of the 5' UTR, we progressively observed increased integration at the AAVS1 locus up to 6% (Fig. 39D). Importantly, addition of the 5' 28S homology arm upstream of the 5' UTR in payloads 2, 6, and 7 substantially improved integration activity. Payloads 4-7 with homology arms directly flanking the insert had scarless insertion at the AAVS1 locus, with minimal indel formation and perfect insertions representing more than 99% of the editing activity. The most truncated 5' UTR sequence had the highest editing, suggesting that R2Tg recognition of the payload only required a small sequence region. As was expected from 28 S payload characterization, the 3' UTR was also dispensable for AAVS1 insertion. We also examined whether insertion activity at the endogenous AAVS1 locus could be optimized via better SpCas9H840A fusions to different R2Tg truncations, again finding that C-terminal truncations were not tolerated, whereas the 1-184 residue truncation of R2Tg had maximum activity compared to other truncations while offering a more compact version of the SpCas9H840A -R2Tg fusion (fig. 40A-B). To test the dependence of these SpCas9H840A - R2Tg fusions on the binding and nicking activities of SpCas9H840A independently, we compared the SpCas9H840A -R2Tg fusion to the dead SpCas9D10A,H840A-R2Tg fusion, as well as SpCas9H840A and R2Tg delivered in trans as separate proteins. We found that, while the SpCas9D10A,H840A-R2Tg had no insertion activity, co-delivery of SpCas9H840A and R2Tg was sufficient to efficiently insert the payload at both NOLC1 and AAVS1 loci, showing that the nicking activity, but not binding activity, of SpCas9H840A was enhancing insertion efficiency (Fig. 40C).88SUBSTITUTE SHEET (RULE 26)

[0227] . As some R2 retrotransposons have been proposed to function as a homodimer upon binding their cognate RNA templates (Yang et al., 1998. Mol. Cell. Biol. 18, 3455- 3465), we were motivated to explore whether dual guides on opposing DNA strands might emulate dual nicking and recruitment of R2Tg and stimulate more efficient integration. Comparing single and dual guides, we found that certain paired guides achieved up to 15% integration with minimal indels generated and near perfect integration >99% using payloads with 100 nt of homology (Fig 41A). Specific combinations of paired guides had low levels of integration with SpCas9H840A alone, indicating some contribution from HDR mediated insertion of the payload off the DNA vector, and this effect was less prominent with single guides. Interestingly, top strand nicking guides, such as guide A4, could promote insertion, suggesting that the RLE domain of the R2Tg protein could initiate bottom strand nicking at the AAVS1 target (Fig. 41A). To reduce HDR background, we tested payloads with homology arms reduced from 100 nt to 50 nt and found that these designs maintained insertion while blunting HDR byproducts (Fig. 41B). Surprisingly, while integration with SpCas9H840A -R2Tg had minimal indel formation, SpCas9H840A alone generated substantially more indels at the WT locus, indicating competition between complete integration and continued nicking and indel formation (Fig. 41 A).Example 11. Further Development and Integration of Re-targeted Retrotransposons

[0228] . We next determined whether diverse non-LTR retrotransposons could be repurposed for integration in cells despite failing at the 28S locus. To compensate for potentially ineffective binding or cleavage at the 28 S locus in mammalian cells, we fused a panel of 11 additional retrotransposon candidates to SpCas9H840A and tested them for additional guided insertion improvements at the 28 S locus. We found that several of the retrotransposons, including many without activity at 28 S target, had significant increases in 28 S insertion when paired with targeting guides (Fig. 42A), including R2Bm, R2Ci, HeroDr, RIOMbr, R2Oi, and R2Tsp, whereas R2Tg and R2Mes did not have further increases, likely due to their already high natural integration.

[0229] . We modified corresponding payloads for scarless insertion by rearranging homology regions internal to UTRs, and reprogrammed homology regions and SpCas9 guides to target payloads to the AAVS1 locus (Fig. 58B). We found that our framework for retrotransposon retargeting generalized, with 6 out of 12 orthologs tested efficiently reprogrammed (Fig. 42B-D) showing efficient reprogramming, with minimal indel formation89SUBSTITUTE SHEET (RULE 26)accompanying the insertion activity (Fig. 58B and 68). R2Toc had a high efficiency of reprogramming with strongly reduced background 28S insertion (Fig. 29A).Example 12. Site-specific Target-primed Insertion via Targeted CRISPR Homing of Retroelements (STITCHR)

[0230] . After developing our SpCas9H840A -R2Toc-based insertion system, which we refer to as Site-specific Target-primed Insertion via Targeted CRISPR Homing of Retroelements (STITCHR), we explored multiple applications for STITCHR-based programmable gene insertion in mammalian cells.

[0231] . We first demonstrated STITCHR biochemically by purifying recombinant R2Toc protein and co-incubating it with SpCas9H840A to reprogram RNA templated insertion at an AAVS1 target. When R2Toc was assisted by SpCas9H840A nicking using two sgRNAs, it had 9% insertion at the target site, compared to 1.5% insertion without SpCas9H840A (Fig. 92A). As with R2Tg, R2Toc alone generated a unique cleavage pattern on the AAVS1 target, indicating it also could be reprogrammed for cleavage and TPRT via its payload RNA. When STITCHR was examined in human cells, it could insert with 7% and 8% efficiencies at the NOLC1 and AAVS1 targets, respectively. RLE and RT mutants eliminated insertion activity (Fig. 92B). As with R2Tg, the RT and RLE mutants complemented each other, as co-delivery of both mutants in trans rescued insertion activity (Fig. 92B-C). To ensure expression level differences of mutants and wild- type R2Tg and R2Toc proteins are not causing differences in integration efficiency, we measured the expression of each ortholog’s wild-type and mutant versions, finding fairly uniform expression levels (Fig. 92D).

[0232] . To generalize STITCHR reprogramming to other loci beyond AAVS1, we targeted the NOLC1 and SERPINA1 loci with panels of single and dual guides, finding that dual guides integration efficiencies up to 13% and 10% insertion at NOLC1 and SERPINA1, respectively (Fig. 43A-D). While single guides had measurable integration activity, dual guides tended to better promote integration. Assaying the fidelity of insertion, we found low indel formation at these sites, indicating that integration was with high fidelity and that integration by SpCas9H840A -R2Toc outcompeted indel formation, as indels were higher with SpCas9H840A alone (Fig. 43 A, 43D). Moreover, integration was scarless, as would be expected from our payloads with internal homology regions. While many dual guide90SUBSTITUTE SHEET (RULE 26)combinations and single guides enabled STITCHR gene insertion, minimal editing was observed with SpCas9H840A alone. Interestingly, single top strand nicking guides, in addition to bottom strand guides, could stimulate STITCHR insertion, suggesting R2Toc RLE domain participation in bottom strand nicking (Fig. 43 A, 43C). Furthermore, we found that elimination of payload homology at N0LC1 or substitution for non-homologous sequences ablated editing (Fig. 44A). Conversely, increasing payload homology did not substantially increase integration efficiency, but led to higher background due to HDR (Fig. 44B). We also found that for high background loci, reducing payload homology could support gene integration with reduced HDR background, as observed at the AAVS1 and SERPINA1 loci with SpCas9H840A -R2Toc where we could achieve 8% gene integration with no background from HDR (Fig. 44C-D). Interestingly, we observed that R2Toc, like R2Tg, was also capable of programmable insertion without the assistance of Cas9 via the payload homology as the non-targeting guide conditions had 2% N0LC1, 1.3% AAVS1, and 0.35% SERPINA1 insertion in HEK293FT cells (Fig. 43A-B, Fig. 44C, Fig. 71A) and up to 5% in HepG2 cells (Fig. 71A-C).

[0233] . To take advantage of scarless genome insertion with R2Toc, we investigated whether we could place an EGFP tag in-frame to a protein target. We chose NOLC1 due to its distinct nuclear organization and designed our template in the reverse direction to prevent constitutive expression of the EGFP off the template cargo (Fig. 45 A). We found that STITCHR-mediated GFP insertion led to NOLC1 tagging, as verified by confocal imaging and corresponding colocalization with immunofluorescence staining (Fig. 45B). We then explored additional payload flexibility of the STITCHR system at the AAVS1 locus, using a panel of cargo sequences of different lengths. Evaluating various therapeutically relevant genes, including BTK, CEP290, HBB, HEXA, OTC, and PAH, we found insertion efficiencies of 10-20% at the AAVS1 locus with minimal insertion using SpCas9H840A alone (Fig.45C-D, Fig. 74). These payloads varied in size between 0.7-7.7 kb, showing that STITCHR mediated insertion can insert a wide range of insert sizes.

[0234] . Multiple types of genomic edits by STITCHR, including single base edits, small insertions, and a range of large payload insertions are enabled by the flexible nature of the retrotransposon insertion pathway (Fig. 59A-B, Fig. 61, Fig. 69A-C, Fig. 70A-C). We tested a panel of edits at the NOLC1 locus, spanning single base changes (transitions and transversions), small insertions (l-10bp), therapeutic cargos, and large gene insertions.91SUBSTITUTE SHEET (RULE 26)STITCHR could effectively install these diverse edit types (Fig. 59C), including therapeutically relevant genes of different sizes, such as BTK, CEP290, HBB, HEXA, OTC, and PAH, and synthetic sequences up to 10.9 kb. STITCHR also inserted these therapeutic genes at AAVS1 (Fig. 45D). For cargos carrying small edits, we found both that extending the transcript beyond the homology arms further improved editing, presumably due to stabilization of the RNA transcript or better expression from the Pol II promoter (Fig. 59C), and U6 promoters could effectively produce smaller templates and genomic edits (Fig. 72). To combine STITCHR-mediated insertion with deletion, we tested simultaneous replacement of genomic regions by separating the homology target sites by 50-150 bp (Fig. 60A), which we refer to as STITCHR-replace. We found that an EGFP payload could be simultaneously inserted while replacing 50-150 bp of genomic sequence with 6-7% integration efficiency (Fig. 60B and Fig. 73).

[0235] . Testing STITCHR in other cell types, we observed 4-10% integration at the NOLC1 and EMX1 loci in HepG2 cells and 12-30% gene integration at the AAVS1, NOLC1, and EMX1 loci in Huh-7 cells (Fig71A-C).

[0236] . To test STITCHR activity in a non-dividing context, we inhibited HDR using the cell cycling inhibitor aphidi colin, which traps cells at the Gl / S phase transition and inhibits HDR activity. We found that STITCHR integration of an EGFP cargo at the NOLC1 locus was not inhibited by increasing concentrations of aphidicolin and led to increases in efficiency at intermediate aphidicolin concentrations (Fig. 46A). In contrast, HDR integration by SpCas9 nuclease at the EMX1 locus was inhibited by up to 94% by aphidicolin (Fig.46B), and residual NOLC1 HDR insertion observed with SpCas9H840A alone was eliminated at all tested aphidicolin concentrations, further demonstrating a retrotransposition and HDR-independent based mechanism for insertion (Fig. 46B). HDR insertion at NOLC1 of the GFP STITCHR template with 50 bp homology arms was inhibited up to 80% by aphidicolin (Fig. 46C). We also found that other cell cycle inhibitors, mirin and double thymidine similarly inhibited HDR but still maintained efficient editing with STITCHR at the AAVS1 locus (Fig. 74).

[0237] . To further apply STITCHR in non-dividing cells, an adenoviral delivery of the STITCHR machinery was designed and tested. Using one adenoviral vector carrying the STITCHR protein vector and a second vector expressing guides and template, STITCHR could achieve 6% integration in HEK293FT cells (Fig. 97A) and, in quiescent primary92SUBSTITUTE SHEET (RULE 26)human hepatocytes, 0.5% gene integration was achieved (Fig. 97B). To further improve STITCHR efficiency, we eliminated potential re-nicking of the integrated sequence by removal of the PAM in the payload homology, resulting in a substantial increase in integration rate (Fig. 97C). To confirm that guide orientation was critical, we explored whether nicking the opposite strands using the D10A version of the SpCas9 nickase would still promote TPRT by STITCHR, finding that this substantially reduced integration efficiencies (Fig. 97D).

[0238] . To extend STITCHR to multiplexed editing without reliance on cell division, we investigated whether STITCHR could mediate multiplexed integration at two different sites in the genome. We simultaneously delivered guide RNAs and cargos targeting the AAVS1 and NOLC1 loci for Glue and EGFP insertion, respectively, finding that multiplexed insertion was possible with 12% and 6% integration at the AAVS1 and NOLC1 loci, respectively (Fig. 47A-B).

[0239] . We also examined STITCHR in the context of a concurrent insertion / deletion approach. We compared a SpCas9H840A-R2Toc using a single fixed guide RNA (N4, see table 7) to target the NOLC1 locus to that of the non-targeting, SpCas9H840Aalone. An EGFP insert was used as a payload. When homology arms on the payload template were separated by 0 bp, 50 bp, 100 bp, or 150 bp, we were successfully able to delete the genomic target while concurrently inserting the EGFP payload into the NOLC1 locus (Fig. 49). Exemplary sequences for the 50 bp deletion, 100 bp deletion, and 150 bp deletion, as well as the Guide sequence used for this experiment are found in Table 7.Table 7. EGFP Cargo and Guide Sequences for Concurrent Insertion / DeletionSUBSTITUTE SHEET (RULE 26)94SUBSTITUTE SHEET (RULE 26)

[0240] . We further examined the possibility of using STITCHR to create single nucleotide edits and small nucleotide insertions. SpCas9H840A-R2Toc was used with dual guides N4 and N8 (N8 Sequence: GGGAACCACGCGGCGAATGC (SEQ ID NO: 33429)) with a payload of either a GFP insert (Fig. 50A, columns 1-2,) a payload with a 1 bp mismatch to the NOLC1 locus (Fig. 50A, columns 3-8), or a payload with a small nucleotide insert (Fig. 50A, columns 9-14). When compared to the non-targeting SpCas9H840A, the SpCas9H840A-R2Toc system was able to make single base pair edits, as well as small nucleotide inserts (1-50 bp). We also examined the effect of the promoter in driving the STITCHR cargo (Fig. 50B). Use of the CAG promoter to express the cargo resulted in slightly higher editing levels, potentially due to higher expression of the template RNA sequence. Sequences used in these experiments are found at table 8.

[0241] . The fidelity of STITCHR insert sequence was also assessed. We amplified the EGFP insert at the NOLC1 locus and performed long-read sequencing. Only a single amplicon species was detected. This amplicon aligned completely with a single, scarless TPRT insertion of EGFP at NOLC 1 (Fig. 78A). We also examined potential off-target insertions by linear amplification PCR and found that the majority of inserts occurred at the on-target site. The majority of off-target inserts occurred oat one of four sites on other chromosomes. (Fig. 78B).Table 8. Cargo and Guide Sequences for Concurrent Single Nucleotide Edits and Small Nucleotide Inserts95SUBSTITUTE SHEET (RULE 26)Example 13. Trans Delivery of Nuclease Activity

[0242] . We next tested whether the nuclease activity of the genome editing system had to be provided in cis or if it could be provided in trans. An EGFP payload (with 50 nt homology arms) was used in conjunction with a SpCas9H840A-R2Toc, in which Cas9 is fused to the R2Toc element, targeting the NOLC1 locus with dual N4 and N8 guides, and was compared to the non-targeting SpCas9H840A. In addition, the nuclease activity conferred by SpCas9H840Awas also examined with separate (trans) expression of R2Toc (Fig. 51, columns 5-6). This non-linked SpCas9H840Aand R2Toc exhibited a payload insertion level similar to that of the fused system, SpCas9H840A-R2Toc. When the nuclease activity was not supplemented with the non-LTR site specific retrotransposon element, little payload insertion was observed.Example 14. Methods of the Examples.Mammalian cell culture

[0243] . HEK293FT cells (ATCC) were cultured in Dulbecco’s Modified Eagle Medium with 4.5 g / 1 glucose, sodium pyruvate, GlutaMAX (Thermo Fisher Scientific) and supplemented with 10% (v / v) fetal bovine serum (FBS) and lxpenicillin-streptomycin (Thermo Fisher Scientific). Cells were maintained below confluency at 37°C and 5% CO2Cell transfection, genomic DNA extraction and purification

[0244] . Cells were transfected in 96 well poly-D-Lysine plates (Corning) 16-24h after plating at a confluency of 70% using Lipofectamine 3000 according to the manufacturer’s protocol. In brief, 50 ng R2-expressing plasmid, 50ng cargo plasmid, 50ng reporter plasmid (optional) and 30 ng of sgRNA-expressing plasmids were transfected. 72h post transfection, genomic DNA was isolated by removing media and adding 50 pl QuickExtract (Lucigen) per well. After a 5 min incubation at room temperature, the lysate was transferred to a 96 well PCR plate and incubated at 65°C for 15 min, 68°C for 15 min, and 98°C for 10 min and used as input for targeted deep sequencing. Lysates were further purified using AMPure magnetic96SUBSTITUTE SHEET (RULE 26)beads (Beckman Coulter) according to the manufacturer’s protocol and eluted in 25 pL water, if used as input for ddPCR or NGS-based assays.Editing quantification by next generation sequencing or ddCPR

[0245] . Insertion efficiencies into plasmid and genomic DNA were quantified using a 3 -primer assay. Here, a forward primer was combined with two reverse primers, one of which binds in the uninserted DNA and the other in inserted DNA. The forward and two reverse primers in a 2: 1 : 1 ratio were added at a total combined concentration of 0.5 pM for a first round PCR counting 20 cycles. A second round PCR with 12 cycles added barcoded primers for Illumina NGS. The 28S, AAVS1, and SERPINA1 experiments were quantified by 3 primer NGS for total integration and indel rates. For NOLC1, the 3-primer assay was used for analyzing indels associated with integration events and the WT locus. NOLC1 total integration was assayed by digital droplet PCR (ddPCR) as described below.

[0246] . To quantify NOLC1 integration efficiency by digital droplet PCR, 24 pL solutions were prepared in a 96-well plate containing 1) 12 pL 2x ddPCR Supermix for Probes (Bio-Rad) 2) primers for amplification of the integration junction at 250 nM-900 nM, 3) FAM probe for detection of the integration junction amplicon at 250 nM 4) 1.44 pL RPP30 HEX reference mix (Bio-Rad) 5) 0.12 pL FastDigest restriction enzyme for degradation of primer off-targets (Thermo Fisher) and 6) Sample DNA at 1-10 ng / pL. The 20 pL of reaction mix was transferred to a Dg8 Cartridge (Bio-Rad) and loaded into a QX2000 droplet generator (Bio-Rad). 40 pL droplets suspended in ddPCR droplet reader oil were transferred to a new 96-well plate and thermocycled according to manufacturer’s specifications. Lastly, the 96-well plate was transferred to a QX200 droplet reader (Bio-Rad) and the generated data were analyzed using Quantasoft Analysis Pro to quantify DNA editing.Example 15. Cas9-assisted Retrotransposon Insertion.

[0247] . We next tested whether R27 could be reprogrammed to target a nicked substrate, such as one cut with a Cas9 nickase, allowing TPRT off a template with corresponding homology (Fig. 56). To simulate R27g-based insertion into a “pre-nicked” substrate, we tested primer extension of an EGFP-coding payload RNA with homology to the human NOLC1 locus instead of the 28 S target. Hybridization of either of two complementary primers to this NOLC1 payload resulted in primer extension when incubated with the R2Tg97SUBSTITUTE SHEET (RULE 26)protein (Fig. 84A). While a universal primer, but not a N0LC1 -specific primer, enabled extension of a 28S template, no extension was observed in the absence of an RNA template (Fig. 84A). These results suggest that the RT domain of the R2Tg protein is flexible and can extend RNA templates beyond its endogenous 28S sequence.

[0248] . SpCas9H840A has the potential to improve insertion through recruitment and supplementation of nicking activity (Fig. 56A). We next probed NOLC1 TPRT product formation. SpCas9H840A was co-incubated in combination with R2Tg, an EGFP payload RNA with NOLC1 homology arms and 5' and 3' UTRs, dNTPs, a dsDNA NOLC1 target, and either single or paired guides. TPRT was more active with paired Cas9 guides and was dependent on magnesium, dNTP and an RNA template (Fig. 84B-C). Surprisingly, some TPRT products could be observed in the absence of Cas9 suggesting R2Tg to be capable of reprogrammed TPRT directed by the payload homology arms (Fig. 84B-C). Moreover, in the R2Tg only condition with SpCas9H840A, a unique cleavage pattern could be observed, further confirming that the R2Tg protein can be reprogrammed for cleavage and TPRT (Fig.84B)

[0249] . To determine if modifying homology sites to a new locus could direct insertion to a different target in cells, we designed scarless insertion payloads with internal homology to the NOLC1 locus and co-transfected plasmids expressing these payloads with R2Tg into HEK293FT cells. Reprogrammed insertion was achieved atNOLCl at -0.1% that was dependent on the RLE and RT domains (Fig. 85), demonstrating homology-guided retargeting of non-LTR retrotransposons.

[0250] . To determine if SpCas9H840A could further improve insertion through supplementation of nicking activity, a pair of guide RNAs was designed to introduce nicks on the bottom and top strands of NOLC1 and co-delivered these guides with a cargo carrying transgene payloads, a 5' R2Tg UTR, and internal 50 nt homology arms placed around the nicking site at the NOLC1 locus. SpCas9H840A-R2Tg fusion was found to have increased efficiency at NOLC1 (-0.6%) (Fig. 56B) in a guide and RLE-dependent fashion, demonstrating that SpCas9H840A can significantly improve R2Tg insertion efficiency.

[0251] . A panel of payloads was designed to optimize payload design for efficient insertion at retargeted loci. The panel was designed to target the NOLC1 locus to expand upon our initial findings from R2Tg natural insertion at the 28S locus (Fig. 57). Payloads98SUBSTITUTE SHEET (RULE 26)were designed with varying 5' UTR sequences by panning 65 nt windows of the annotated 5' UTR, including regions upstream containing the 5' 28S homology region to navigate around a potentially relevant HDV-like cleavage site occurring in said region in R2Bm and R2Tg 5,29. Windows overlapping the distal 5’ UTR region and 28S homology region upstream of a 5' target homology and payload sequence, either with or without a 3' UTR region, were found to be necessary and sufficient for reprogrammed insertion atNOLCl (Fig 57). A truncated 28S- 5' UTR sequence improved insertion efficiency over the complete 5' UTR and retained significant secondary structure, indicative of potential conserved function (Fig. 66A). Retargeting at the AAVS1 locus followed similar rules, requiring the upstream 28S and a minimal 15 nt 5' UTR for efficient gene integration quantified using a validated sequencing assay (Fig. 66B-C, Fig. 75). Efficient integration was observed at AAVS1, with 15% efficiency using the Cas9-assisted nicking approach and 4% efficiency using the R2Tg protein alone (Fig. 86A-B). Similarly, N0LC1 biochemical integration was also improved using this updated payload design, with 6-8% integration efficiency (Fig. 86C) and insertion was homology specific with non-homologous templates showing no insertion activity (Fig. 86C). Integration efficiency was dependent on target concentration (Fig. 87A). Small RNA templates carrying a single base mismatch or insertion were still functional for TPRT, yielding efficiency in the 1-2% range on the N0LC1 target (Fig. 87B). Interestingly, on the AAVS1 target, as observed with N0LC1 (Fig. 84), a unique cleavage pattern was observed in the R2Tg only condition, suggesting that R2Tg could be reprogrammed for cleavage and TPRT in absence of SpCas9H840A. SpCas9H840A stimulated a higher rate of TPRT than with R2Tg alone (Fig. 86). These results shows that the 28 S sequence together with a truncated 5' UTR sequence, can function as a bona fide 5' UTR, and that the entire R2Tg 3 'UTR can be dispensable for retargeted insertion.

[0252] . Insertion activity was tested at the endogenous AAVS1 locus using additSpCas9H840A-R2Tg fusion proteins with different R2Tg protein truncations. C- terminal truncations were found to be not tolerated, whereas the 1-184 residue N-terminal truncation of R2Tg retained activity while offering a more compact version of the SpCas9H840A-R2Tg fusion (Fig. 67A-B). To probe the mechanism of retargeted insertion at the NOLCl and AAVS1 loci by the SpCas9H840A-R2Tg truncation fusion, insertion with the mutagenized variation of the RT domain was tested, confirming that integration was dependent on the RT activities of the retrotransposon and consistent with a TPRT based mechanism for programmable integration (Fig. 58A and Fig. 67C).99SUBSTITUTE SHEET (RULE 26)

[0253] . To probe the mechanism of retargeted insertion by the S »Cas9H840A-R27A184fusion in cells, we tested insertion with the mutagenized variation of the RT domain and confirmed that integration was RT-dependent, consistent with a TPRT-based mechanism for programmable integration (Fig. 88A-C). We tested whether co-incubation of R27gRLE and RT mutants in trans would rescue TPRT. While protein mutants with either RLE or RT domain inactivated were TPRT-deficient, in combination the two mutants partly restored insertion activity at both the NOLC1 and AAVS1 loci (Fig. 88A). We also found that the R27RTmutin trans with SpCas9H840Ais inactive, but that wild-type R27 in trans with SpCas9H840Ais active, allowing for insertion at the NOLC1 and AAVS1 loci (Fig. 89A-B). This is consistent with TPRT as the mechanism of payload insertion by R2Tg.Example 16: Target Primed Reverse Transcription (TPRT) with R27g

[0254] . We examined the biochemical mechanism of retrotransposon activity by testing to analyze TPRT. Unless otherwise noted, in vitro TPRT reactions were performed in a total volume of 10 pL, containing 165 nM purified recombinant R2 protein, 90 ng DNA target, 300 ng RNA template, murine RNase inhibitor (lx, NEB) in a buffer containing 50 mM Tris-HCl (pH 8), 200 mM NaCl, 2 mM MgC12, 5 mM DTT and 500 pM of each dNTP. For Cas9-ni eking assisted reprogramming of TPRT to new sites, reactions were further supplemented with 400nM final concentration SpCas9H840A nickase (IDT) and 200nM final concentration of each synthetic nicking guide RNA (Synthego). TPRT reactions were incubated at 37 oC for 1 hour, followed by 80oC for 15 minutes. 1 ul (7U) of RNase A (Qiagen) was then added to each reaction and incubated for a further 15 minutes at 50oC. The reactions were purified on MinElute columns (Qiagen), separated by electrophoresis on Novex 6% TBE Gels (Invitrogen) and visualized by SYBR Gold staining (Invitrogen). Using a purified R2Tg protein and an in vitro transcribed RNA payload containing the Glue coding sequence, 100 nt 5' and 3 ' arms homologous to the 28 S DNA target and either with or without 5' and 3' R2Tg UTRs, we observed magnesium- and dNTP dependent TPRT (Fig. 79). Insertion occurred with DNA double strand cleavage of the 28S target (Fig. 79A). TPRT was sensitive to RNA payload design: in the absence of UTRs, insertion was significantly diminished but there was no decrease in target cleavage (Fig. 79B). Target cleavage was influenced by the complete absence of the payload RNA, which substantially reduced cleavage (Fig. 79A, B). TPRT efficiency was also highest with 100 nt homology arms on the payload and progressively decreased with 60 and 30 nt arms, whereas 0 nt arms completely eliminated TPRT (Fig. 80A). R2Tg was most active on RNA payloads containing a 5' cap100SUBSTITUTE SHEET (RULE 26)modification and TPRT was substantially lower on templates containing poly-A tails (Fig.80B-D). TPRT product formation was also dependent on R2Tg concentration and accumulated over time (Fig. 81 A-C).

[0255] . We also examined the dependence of first and second strand synthesis on TPRT. To accomplish this, the top and bottom strands of the DNA target were labeled with different fluorophores. Cleavage of both strands of the DNA target was observed (Fig. 82A), confirming that the larger bands observed in Fig. 79 were indeed motility-shifted target- primed products containing a large insertion. Cleavage of only the bottom strand was TPRT dependent.

[0256] . R2Tg was mutated to determine the catalytic effects on TPRT. Both RLE (D1274A) and RT (A875-878, FADD) R2Tg mutants eliminated TPRT (Fig. 82B). To verify that the RLE R2Tg mutant was capable of isolated reverse transcription activity, we performed a primer extension assay consisting of the RNA payload pre-primed with a DNA primer. Comparable primer extension efficiency was observed between the wild-type and RLE mutant R2Tg proteins (Fig. 82C). Co-incubation with both the RT and RLE mutant proteins rescues TPRT activity (Fig. 82B), further indicating that the nuclease and reverse transcriptase activities of the R2Tg protein can function in trans.

[0257] . TPRT activity was also examined in mammalian cells. We tested R2Tg for heterologous activity at the endogenous 28S locus by designing an EGFP payload flanked by the cognate R2Tg 5' and 3' UTRs and 28S homology arms. We found that co-transfection of this engineered payload together with wild-type R2Tg resulted in EGFP insertion into endogenous 28S loci, as determined by left and right PCR junctional analysis (Fig. 90A). These R2Tg insertions were primarily full length, in contrast to observed partial insertions with R2O119. To verify dependence on the retrotransposition mechanism, we introduced inactivating mutations in the RLE endonuclease domain (R2TgD1274A, hereafter referred to as R2TgRLEmut), RT domain (R2TgF875A, A876L, D877A,D878A, L879A, V880A, L881A, hereafter referred to as R2TgRTmut ), and ZF domain (R2TgZF2mut). R2TgRTmut residues for mutagenesis were selected on the basis of the widely conserved YXDD RT motif, consisting of YXDD residues and three additional conserved hydrophobic residues essential for catalytic activity of the RT26. Each of the three mutants were incapable of insertion activity alone (Fig. 90A), suggesting that each domain has a role in the observed TPRT activity. To further confirm that insertion was RT dependent, we engineered additional101SUBSTITUTE SHEET (RULE 26)RT modifications, including deleting all 7 residues of the YXDD box (R2TgA(874-884) hereafter referred to as R2TgARTmut) and mutagenesis of the two aspartates in the FADD motif to positively charged residues, which has been shown to inactivate retroviral RTs27. We similarly observed that all these mutants significantly inhibited insertion activity of the R2Tg system, concordant with an RT-dependent insertion mechanism via TPRT (Fig. 90B- C).Example 17: Mechanisms of payload insertion

[0258] . We tested mammalian insertion with in vitro transcribed RNAs, as additional evidence that insertion is occurring via reverse transcription from an RNA template. We synthesized mRNA templates with a 5' cap and variable length poly A tail modifications and delivered them to cells along with a plasmid coding for R2Tg and a plasmid reporter target; to account for transcriptional lag, mRNA was transfected one day after plasmid transfection. Analysis of both the 28S plasmid reporter target and the endogenous genomic 28S locus through junction-spanning PCR revealed bands corresponding to the correct insertion product in an RT- and RLE-dependent fashion (Fig. 91A). Accordingly, luciferase expression off the reporter target plasmid was observed (Fig. 91B). Taken together, this evidence shows that R2Tg is capable of inserting payloads by reverse transcription of RNA by its RT domain and nicking of target DNA by its RLE domain.Example 18: STITCHR templates

[0259] . To better understand the RNA templated mechanism, we explored STITCHR’s ability to use small synthetic RNA templates in cells extended off the SpCas9 sgRNA scaffold instead of a 5' R2 UTR sequence, allowing for template recruitment via SpCas9. We first tested reconstitution of a 20 bp deletion in a luciferase reporter to restore luciferase activity. When delivering SpCas9H840A-R2Toc or SpCas9H840A-R2Tg as plasmid constructs a day before, a synthetic RNA template extended off a SpCas9 sgRNA scaffold sequence generated 3-5% editing, compared with 7% with the same payload expressed off of a plasmid (Fig. 93A-D). Editing efficiencies corresponded to measurable levels of protein production as measured by luciferase activity (Fig. 93B-D). We next explored targeting an endogenous site with a similar synthetic RNA template extended off a SpCas9 sgRNA scaffold and lacking a 5' UTR sequence. Using this approach, we detected significant installation of a 38 bp sequence (Fig. 94A). We next tested an in vitro transcribed mRNA template containing an optimal 5' UTR sequence for insertion of a -700 bp GFP ORF at the NOLC1 locus and found 0.5-2% insertion efficiency using the R2Toc STITCHR102SUBSTITUTE SHEET (RULE 26)system in both HEK293FT and HUH-7 cells (Fig. 94B-D), with detectable PCR junction bands corresponding to correct insertion events (Fig. 95A). R2Tg-based STITCHR demonstrated similar 1-1.5% integration efficiency using an in vitro transcribed RNA templated delivered to cells (Fig. 95B).Example 19: Insertion and Integration via STITCHR

[0260] . To corroborate our findings that STITCHR utilizes an RNA templated integration mechanism, we designed a GFP-containing mRNA template carrying an intron and quantified insertion of spliced payloads by sequencing. Using this readout, we quantified 0.02-0.1% integration of spliced templates from both R2Tg and R2Toc based STITCHR systems (Fig. 95C). These data suggest that, in line with previous findings, STITCHR is utilizing an RNA templated mechanism of insertion.

[0261] . Next, we explored multiple applications for STITCHR-enabled programmable gene insertion in mammalian cells. We generalized STITCHR reprogramming to other loci, targeting AAVS1, NOLC1, LMNB1, and EMX1 loci with panels of single and dual guides, which produced integration efficiencies between 5% to 11% (Fig. 96A, Fig 59A). Insertion was RT and RLE domain dependent, with minimal integration from the RT mutant (SpCas9H840A-R2TocRTmut), RLE mutant (SpCas9H840A-R2TocD1210A) or SpCas9H840A alone (Fig. 69, Fig. 70, Fig. 96), supporting a retrotransposon mediated insertion mechanism. The SpCas9H840A-R2TocRTmut reduced integration activity by 75- 97% across all the guides and genes tested, indicating the importance of the RT domain for TPRT and integration. AAVS1 insertion was quantified by both next-generation sequencing and digital-droplet PCR, finding similar levels of integration efficiency (Fig. 96A-B; Fig 59A). Indel formation was low across all sites, suggesting relatively high product purity of SpCas9H840A-R2Toc-mediated insertions (Fig. 96A-B; Fig 59A). In contrast, SpCas9- stimulated HDR using the same insertion template designs had reduced efficiency of integration relative to STITCHR and resulted in indel formation from 12%-30% (Fig. 96A; Fig 59A).

[0262] . While SpCas9H840A controls showed that insertion with STITCHR required retrotransposon activity, an alternative mechanism for insertion could rely on reversetranscription mediated ssDNA generation stimulating HDR, as has been demonstrated with retron-based systems in mammalian cells (Kong, X. et al. Protein Cell 12, 899-902 (2021); Zhao etal. CRISPRj. 5, 31-39 (2022)). To determine contributions from HDR, we evaluated103SUBSTITUTE SHEET (RULE 26)the cell-cycle dependence of STITCHR, using the cell cycling inhibitor aphidicolin, which traps cells at the Gl / S phase transition (Borel, F. et al. J. Cell Sci. 115, 2829-2838 (2002). We found that STITCHR integration of an EGFP cargo at the NOLC1 locus was not inhibited by increasing concentrations of aphidicolin, and instead increased efficiency at intermediate aphidicolin concentrations (Fig. 46A). In contrast, SpCas9-stimulated HDR at the EMX1 locus of a small insert was inhibited by up to 94% by aphidicolin (Fig. 46B) and HDR insertion at NOLC1 of the GFP STITCHR template with 50 bp homology arms was inhibited up to 80% by aphidicolin (Fig. 46C). We also found that other cell cycle inhibitors, mirin and double thymidine similarly inhibited HDR but still maintained efficient editing with STITCHR at the AAVS1 locus (Fig. 74A-B).Example 20: Cas9 Independent R2Tg retargeting

[0263] . To test retargeting of R2 substrate nicking via reprogramming of homology arms independent of Cas9, we incubated R2Tg with a novel target and corresponding homology -containing payloads in vitro and assayed for both cleavage and TPRT Unless otherwise noted, in vitro TPRT reactions were performed in a total volume of 10 pL, containing 165 nM purified recombinant R2 protein, 90 ng DNA target, 300 ng RNA template, murine RNase inhibitor (lx, NEB) in a buffer containing 50 mM Tris-HCl (pH 8), 200 mM NaCl, 2 mM MgC12, 5 mM DTT and 500 pM of each dNTP. TPRT reactions were incubated at 37°C for 1 hour, followed by 80°C for 15 minutes. 1 ul (7U) of RNase A (Qiagen) was then added to each reaction and incubated for a further 15 minutes at 50oC. The reactions were purified on MinElute columns (Qiagen), separated by electrophoresis on Novex 6% TBE Gels (Invitrogen) and visualized by SYBR Gold staining (Invitrogen).. We designed an AAVS- targeting RNA payload with 100 nt homology arms and incubated it with a PCR target generated from the AAVS1 human locus. We found that in the presence of the RNA payload, R2Tg, and dNTPs, TPRT could be observed, with weak cleavage bands corresponding to cleaved, but unintegrated DNA products. Removal of dNTPs eliminated TPRT and correspondingly increased cleavage products. In absence of R2Tg, the RNA payload, or Mg2+, we did not observe either cleavage or TPRT products (Fig. 98A New). To map the cleavage fragments, we ligated adaptors to free DNA ends and amplified ligated products with an adapter specific primer and a primer targeting either the 5' or 3' regions of the target. These products, which reveal 3' and 5' cleavage regions, respectively, were profiled with next-generation sequencing (Fig. 98B New). Comparing the cleavage locations between the no dNTP reaction and no RNA payload reaction, we found a majority of104SUBSTITUTE SHEET (RULE 26)cleavage ends flanked homology arm positions, suggesting direct retargeting of R2Tg nicking by the RNA homology (Fig. 98C New). In the no RNA payload conditions, no appreciable cleavage could be observed with the majority reads corresponding to the 5' or 3' ends of the uncleaved target (Fig. 98C New). We also evaluated reprogramming R2Tg towards a N0LC1 target, finding that the R2Tg protein was capable of RNA-dependent cleavage and TPRT off of this novel DNA sequence and that the cleavage sites could similarly be mapped using a ligation based sequencing assay, with some of the cleavage sites originating around the homology arms (Fig.99A-C).Example 21: Delivery of R2 element and payload as RNA

[0264] . This example will describe the results of experiments in which an R2 element is delivered as part of an RNA delivery system. The example further describes the results of experiments in which the genome editing system as a whole is delivered as RNA. Both modified R2 elements and unmodified R2 elements will be used. The modified R2 elements will be directly delivered as RNA or delivered as part of a delivery system designed to improve administration of the RNA. The integration efficiency of these R2 element enzymes delivered as RNA will be assessed as in previous examples.105SUBSTITUTE SHEET (RULE 26)

Claims

We claim:

1. A genome editing system comprising: i) an R2 element enzyme; and ii) a payload RNA, wherein the payload RNA comprises an insertion template and optionally one or more of a 5’ homology region, a 3’ homology region, and a protein binding element, wherein the insertion template comprises a sequence for a nucleic acid insertion into the genome, and wherein the R2 element enzyme comprises a reverse transcriptase domain, and a nickase domain.

2. The genome editing system of claim 1, wherein the R2 element enzyme further comprises a targeting domain.

3. The genome editing system of claim 2, wherein the targeting domain is a natural targeting domain or an engineered targeting domain.

4. The genome editing system of claim 1, wherein the nucleic acid insertion into the genome is a DNA or RNA insertion template.

5. The genome editing system of claim 1, wherein the R2 element enzyme is a modified R2 element enzyme.

6. The genome editing system of claim 5, wherein the coding sequence of the R2 element enzyme is modified.

7. The genome editing system of claim 5, wherein the modified R2 element enzyme is modified by an N-terminal or C-terminal truncation of the R2 element enzyme sequence.

8. The genome editing system of claim 5, wherein the modified R2 element enzyme comprises a linker.

9. The genome editing system of claim 8, wherein the linker is an XTEN linker.

10. The genome editing system of claim 1, wherein the genome editing system targets a genomic locus.106SUBSTITUTE SHEET (RULE 26)11. The genome editing system of claim 1, wherein the genome editing system targets a genomic locus other than the 28 S rRNA locus.

12. The genome editing system of claim 11, wherein an N-terminal zinc finger domain of the R2 element enzyme is modified to target a genomic locus other than the 28S rRNA locus.

13. The genome editing system of claim 11, wherein a non-naturally occurring targeting region is fused to the N-terminus of the R2 element enzyme or inserted into the R2 element enzyme.

14. The genome editing system of claim 5, wherein the modified R2 element enzyme is a fusion protein.

15. The genome editing system of claim 5, wherein the modified R2 element is fused to a Cas9 protein that is fully active, catalytically dead (H840A / D10A for SpCas9), or functioning as a nickase (H840A or D10A for SpCas9).

16. The genome editing system of claim 5, wherein the modified R2 element is fused to a Casl2 protein that is fully active, catalytically dead, or functioning as a nickase.

17. The genome editing system of claim 15, further comprising a guide RNA.

18. The genome editing system of claim 5, wherein the modified R2 element is fused to aTALEN protein, zinc finger protein, argonaute, or meganuclease protein.

19. The genome editing system of claim 16, further comprising a guide RNA.

20. The genome editing system of claim 11, wherein the 5’ homology region, the 3’ homology region, or both the 5’ and 3’ homology region of the payload RNA is engineered to target a genomic locus other than the 28S rRNA locus.

21. The genome editing system of claim 1, wherein the 5’ homology region, the 3’ homology region, or both the 5’ and 3’ homology region target an exogenously introduced landing sequence.

22. The genome editing system of claim 1, wherein the insertion region is introduced into the genome of a specific cell type.107SUBSTITUTE SHEET (RULE 26)23. The genome editing system of claim 22, wherein the specific cell type is a post-mitotic cell.

24. The genome editing system of claim 1, wherein the genome editing system functions in post-mitotic cells.

25. The genome editing system of claim 1, wherein the genome editing system functions independently from intrinsic nucleic acid repair systems.

26. The genome editing system of claim 1, wherein the payload RNA template further comprises a 5’ untranslated region (UTR), a 3’ UTR, or both a 5’ UTR and a 3’ UTR.

27. The genome editing system of claim 26, wherein the 5’ homology region and the 3’ homology region are located between the 5’ UTR and 3’ UTR.

28. The genome editing system of claim 26, wherein the 5’ homology region and the 3’ homology region are located outside the 5’ UTR and 3’ UTR.

29. The genome editing system of claim 1, wherein the payload RNA further comprises a 5’ untranslated region (UTR), a 3’ UTR, or both a 5’ and a 3’ UTR, wherein the UTRs are truncated.

30. The genome editing system of claim 1, wherein the payload RNA does not comprise a 5’ UTR.

31. The genome editing system of claim 1, wherein the payload RNA does not comprise a 3’ UTR32. The genome editing system of claim 1, wherein the payload RNA further comprises a nuclear retention element.

33. The genome editing system of claim 1, wherein the payload RNA further comprises a Cas9 or Casl2 guide RNA, and wherein the Cas9 or Casl2 guide RNA comprises an extension with a 5’ homology sequence, a 3’ homology sequence, a 5’ untranslated region (UTR), a 3’ UTR, an insertion template, or any combination thereof34. The genome editing system of claim 1, wherein the nucleic acid insertion template is a sequence of greater than 1000 base pairs.108SUBSTITUTE SHEET (RULE 26)35. The genome editing system of claim 1, wherein the R2 element enzyme comprises a nuclear localization signal (NLS).

36. The genome editing system of claim 1, wherein the insertion region comprises a template for a reporter gene, a transcription factor gene, a transgene, an enzyme gene, or a therapeutic gene.

37. A method of inserting a large nucleic acid into a genome within a cell using a Cas9 or Casl2 fusion protein, wherein the method comprises supplying a Cas9 or Casl2 fusion protein to a cell, wherein the Cas9 or Casl2 fusion protein is supplied with a payload RNA template, wherein the RNA template is reverse transcribed by the Cas9 or Casl2 fusion protein prior to being inserted into the genome of the cell; and wherein the large nucleic acid is inserted into the genome of the cell.

38. The method of claim 37, wherein the Cas9 fusion protein comprises a Cas9 portion and an R2 element portion.

39. The method of claim 38, wherein the Cas9 fusion protein comprises a targeting domain, a reverse transcriptase domain, and a nickase domain.

40. The method of claim 37, wherein the Casl2 fusion protein comprises a Casl2 portion and an R2 element portion.

41. A method of inserting an exogenous nucleic acid into the genome of a post-mitotic cell, wherein the method comprises subjecting the genome of the post-mitotic cell to a modified Cas9 protein that inserts the exogenous nucleic acid into the genome of the postmitotic cell.

42. The method of claim 41, wherein the modified Cas9 protein is fused to an R2 element enzyme.

43. The method of claim 42, wherein the modified Cas9 fusion protein targets an endogenous landing site.

44. The method of claim 42, wherein the Cas9 fusion protein targets an exogenously introduced landing site in the genome of the post-mitotic cell.109SUBSTITUTE SHEET (RULE 26)45. A method of editing a genome comprising subjecting the cell to the genome editing system of claim 1.

46. A composition comprising the cell edited by the method of claim 37.

47. A genome editing system comprising: i) a payload RNA, wherein the payload RNA comprises an insertion template and optionally one or more of a 5’ homology region, a 3’ homology region, and a protein binding element, wherein the insertion template comprises a sequence for a nucleic acid insertion into the genome; ii) a non-LTR site specific retrotransposon element enzyme; wherein the non-LTR site specific retrotransposon element enzyme comprises a reverse transcriptase domain and, optionally, a nuclease or nickase domain, and wherein if the non-LTR-site specific retrotransposon element enzyme does not comprise the optional nuclease or nickase domain, the genome editing system further comprises iii) a nuclease or nickase enzyme.

48. The genome editing system of claim 47, wherein the nuclease or nickase enzyme is a programmable nuclease or nickase.

49. The genome editing system of claim 47, wherein the non-LTR site specific retrotransposon element enzyme further comprises a targeting domain.

50. The genome editing system of claim 49 where the non-LTR site specific retrotransposon comes from the Rl, R2, R4, R5, R6, R7, R8, R9, CRE, NeSL, HERO, or Utopia families, or from the 9 new family classifications established for RLE domain containing nLTR retrotransposons.

51. The genome editing system of claim 49, wherein the targeting domain is a natural targeting domain or an engineered targeting domain.

52. The genome editing system of claim 47, wherein the nucleic acid insertion into the genome is a DNA or RNA insertion template.110SUBSTITUTE SHEET (RULE 26)53. The genome editing system of claim 47, wherein the non-LTR site specific retrotransposon element enzyme is a modified non-LTR site specific retrotransposon element enzyme.

54. The genome editing system of claim 53, wherein the coding sequence of the non-LTR site specific retrotransposon element enzyme is modified.

55. The genome editing system of claim 53, wherein the modified non-LTR site specific retrotransposon element enzyme is modified by an N-terminal or C-terminal truncation of the non-LTR site specific retrotransposon element enzyme sequence.

56. The genome editing system of claim 53, wherein the modified non-LTR site specific retrotransposon element enzyme comprises a linker.

57. The genome editing system of claim 56, wherein the linker is an XTEN linker, a synthetic linker, a PEG linker, a Gly / Ser linker, or a proline linker.

58. The genome editing system of claim 47, wherein the genome editing system targets a genomic locus.

59. The genome editing system of claim 47, wherein the genome editing system targets a genomic locus other than the 28 S rRNA locus.

60. The genome editing system of claim 59, wherein an N-terminal zinc finger domain of the non-LTR site specific retrotransposon element enzyme is modified to target a genomic locus other than the 28 S rRNA locus.

61. The genome editing system of claim 59, wherein a non-naturally occurring targeting region is fused to the N-terminus of the non-LTR site specific retrotransposon element enzyme or inserted into the non-LTR site specific retrotransposon element enzyme.

62. The genome editing system of claim 53, wherein the modified non-LTR site specific retrotransposon element enzyme is a fusion protein.

63. The genome editing system of claim 53, wherein the modified non-LTR site specific retrotransposon element is fused to a Cas9 protein that is fully active, catalytically dead (H840A / D10A for SpCas9), or functioning as a nickase (H840A or D10A for SpCas9).I l lSUBSTITUTE SHEET (RULE 26)64. The genome editing system of claim 53, wherein the modified non-LTR site specific retrotransposon element is co-delivered with a Cas9 protein that is fully active, catalytically dead (H840A / D10A for SpCas9), or functioning as a nickase (H840A or D10A for SpCas9).

65. The genome editing system of claim 53, wherein the modified non-LTR site specific retrotransposon element is fused to a Casl2, IscB, IsrB, or TnpB protein that is fully active, catalytically dead, or functioning as a nickase.

66. The genome editing system of claim 53, wherein the modified non-LTR site specific retrotransposon element is delivered in trans with a Casl2, IscB, IsrB, or TnpB protein that is fully active, catalytically dead, or functioning as a nickase67. The genome editing system of claim 63 or claim 64, further comprising a guide RNA.

68. The genome editing system of claim 63 or claim 64, further comprising multiple guide RNA69. The genome editing system of claim 53, wherein the modified non-LTR site specific retrotransposon element is fused to a TALEN protein, zinc finger protein, argonaute, or meganuclease protein.

70. The genome editing system of claim 65 or claim 66, further comprising a guide RNA.

71. The genome editing system of claim 65 or claim 66, further comprising multiple guide RNA.

72. The genome editing system of claim 59, wherein the 5’ homology region, the 3’ homology region, or both the 5’ and 3’ homology region of the payload RNA is engineered to target a genomic locus other than the 28S rRNA locus.

73. The genome editing system of claim 47, wherein the 5’ homology region, the 3’ homology region, or both the 5’ and 3’ homology region target an exogenously introduced landing sequence.

74. The genome editing system of claim 47, wherein the insertion region is introduced into the genome of a specific cell type.112SUBSTITUTE SHEET (RULE 26)75. The genome editing system of claim 74, wherein the specific cell type is a post-mitotic cell, a non-dividing cell, or a quiescent cell.

76. The genome editing system of claim 47, wherein the genome editing system functions in post-mitotic cells, non-dividing cells, or quiescent cells.

77. The genome editing system of claim 47, wherein the genome editing system functions independently from intrinsic nucleic acid repair systems.

78. The genome editing system of claim 47, wherein the payload RNA template further comprises a 5’ untranslated region (UTR), a 3’ UTR, or both a 5’ UTR and a 3’ UTR.

79. The genome editing system of claim 78, wherein the 5’ homology region and the 3’ homology region are located between the 5’ UTR and 3’ UTR.

80. The genome editing system of claim 78, wherein the 5’ homology region and the 3’ homology region are located outside the 5’ UTR and 3’ UTR.

81. The genome editing system of claim 47, wherein the payload RNA further comprises a 5’ untranslated region (UTR), a 3’ UTR, or both a 5’ and a 3’ UTR, wherein the UTRs are truncated.

82. The genome editing system of claim 47, wherein the payload RNA does not comprise a 5’ UTR.

83. The genome editing system of claim 47, wherein the payload RNA does not comprise a 3’ UTR84. The genome editing system of claim 47, wherein the payload RNA further comprises a nuclear retention element.

85. The genome editing system of claim 47, wherein the payload RNA further comprises a Cas9 or Casl2 guide RNA, and wherein the Cas9 or Casl2 guide RNA comprises an extension with a 5’ homology sequence, a 3’ homology sequence, a 5’ untranslated region (UTR), a 3’ UTR, an insertion template, or any combination thereof86. The genome editing system of claim 47, wherein the nucleic acid insertion template is a sequence of greater than 1000 base pairs.113SUBSTITUTE SHEET (RULE 26)87. The genome editing system of claim 47, where the genome editing system targets a genome for a deletion.

88. The editing system of claim 87, where the deletions are between 1 and 150 bases.

89. The genome editing system of claim 47, wherein the non-LTR site specific retrotransposon element enzyme comprises a nuclear localization signal (NLS).

90. The genome editing system of claim 47, wherein the insertion region comprises a template for a reporter gene, a transcription factor gene, a transgene, an enzyme gene, or a therapeutic gene.

91. A method of inserting a large nucleic acid into a genome within a cell using a Cas9 or Casl2 fusion protein, wherein the method comprises supplying a Cas9 or Casl2 fusion protein to a cell, wherein the Cas9 or Casl2 fusion protein is supplied with a payload RNA template, wherein the RNA template is reverse transcribed by the Cas9 or Casl2 fusion protein prior to being inserted into the genome of the cell; and wherein the large nucleic acid is inserted into the genome of the cell.

92. The method of claim 91, wherein the Cas9 fusion protein comprises a Cas9 portion and a non-LTR site specific retrotransposon element portion.

93. The method of claim 92, wherein the Cas9 fusion protein comprises a targeting domain, a reverse transcriptase domain, and a nickase domain.

94. The method of claim 91, wherein the Casl2 fusion protein comprises a Casl2 portion and a non-LTR site specific retrotransposon element portion.

95. A method of inserting an exogenous nucleic acid into the genome of a post-mitotic cell, wherein the method comprises subjecting the genome of the post-mitotic cell to a modified Cas9 protein that inserts the exogenous nucleic acid into the genome of the postmitotic cell.

96. The method of claim 95, wherein the modified Cas9 protein is fused to a non-LTR site specific retrotransposon element enzyme.

97. The method of claim 96, wherein the modified Cas9 fusion protein targets an endogenous landing site.114SUBSTITUTE SHEET (RULE 26)98. The method of claim 96, wherein the Cas9 fusion protein targets an exogenously introduced landing site in the genome of the post-mitotic cell.

99. A method of editing a genome comprising subjecting the cell to the genome editing system of claim 91.

100. A composition comprising the cell edited by the method of claim 91.

101. A method of correcting a genetic mutation related to disease or human pathology, wherein the method comprises making small nucleotide changes or small nucleotide insertions (1-100 bp) in a human genome using the genome editing system of claim 1 or claim 47.

102. The method of claim 101 or the genome editing system of any one of claims 1 to 100, wherein the genome editing system is delivered via single or multi vector AAV, adenovirus, lentivirus, herpes simplex virus, PEG10 viral like particles, PNMA viral like particles, gag-like viral like particles, nanoblades, gesicles, or Friend murine leukemia virus (FMLV) viral like proteins.

103. The method of claim 101 or claim 102, or the genome editing system of any one of claims 1 to 100, wherein the components of the genome editing system are delivered as all RNA in lipid nanoparticles or another RNA delivery reagent.

104. The method of claim 103, wherein the non-LTR site specific retrotransposon is delivered as mRNA.

105. The method of claim 103 or claim 104, wherein the guide RNAs are delivered as synthetic RNA.

106. The method of claim 103, wherein the payload is delivered as mRNA.

107. The genome editing system of claim 1, wherein the genome editing system targets and edits the genome at more than one site.

108. A genome editing system comprising:(i) a delivery system wherein the delivery system comprises a first component and a second component,115SUBSTITUTE SHEET (RULE 26)wherein the first component is an R2 element enzyme or a nucleic acid molecule encoding an R2 element enzyme, wherein the second component is a payload template, and wherein the nucleic acid molecule encoding an R2 element enzyme is capable of being transcribed, translated, or transcribed and translated in vivo.

109. A genome editing system comprising: i) an RNA encoding an R2 element enzyme; and ii) a payload template, wherein the payload template comprises an insertion template and optionally one or more of a 5’ homology region, a 3’ homology region, and a protein binding element, wherein the insertion template comprises a sequence for a nucleic acid insertion into the genome, and wherein the R2 element enzyme comprises a reverse transcriptase domain and a nickase domain.

110. A genome editing system comprising: i) an RNA encoding an R2 element enzyme; and ii) a payload RNA, wherein the payload RNA comprises an insertion template and optionally one or more of a 5’ homology region, a 3’ homology region, and a protein binding element, wherein the insertion template comprises a sequence for a nucleic acid insertion into the genome, and wherein the R2 element enzyme comprises a reverse transcriptase domain and a nickase domain.

111. The genome editing system of claim 110, wherein the RNA encoding said R2 element enzyme is naked mRNA.

112. The genome editing system of claim 110, wherein the payload template is naked mRNA.

113. The genome editing system of claim 110, wherein the R2 element enzyme is delivered as part of a designed delivery system.116SUBSTITUTE SHEET (RULE 26)114. The genome editing system of claim 110, wherein the R2 element enzyme is delivered as part of a designed delivery system.

115. The genome editing system of claim 110, wherein the payload template is delivered as part of a designed delivery system.

116. The genome editing system of claim 110, wherein the payload template comprises an intron.117SUBSTITUTE SHEET (RULE 26)